Vol. 172, No. 7

JOURNAL OF BACTERIOLOGY, JUlY 1990, p. 4064-4071

0021-9193/90/074064-08$02.00/0 Copyright X) 1990, American Society for Microbiology

Transcriptional Regulation of comC: Evidence for a CompetenceSpecific Transcription Factor in Bacillus subtilis S. MOHANt AND D. DUBNAU* Department of Microbiology, The Public Health Research Institute, 455 First Avenue, New York, NY 10016 Received 14 February 1990/Accepted 24 April 1990 comC specifies a protein product that is required for genetic competence in Bacillus subtilis. The probable transcriptional start site of comC has been localized by high-resolution primer extension analysis and shown to be preceded by an appropriately positioned sequence that resembles the consensus promoter for the 7A form of RNA polymerase. Low-resolution Si nuclease transcription mapping was used to identify the comC terminator, which is located 6ear a palindromic element recognizable in the DNA sequence. Deletion analysis of the sequence upstream from the lilkely promoter identified a region required in cis for the expression of comC. An overlapping, and,possibly identical, sequence was shown to inhibit the expression of competence and of several late competence genes, when present in multiple copies. This was interpreted as due to the titration of a positively acting competence transdiption factor (CTF) by multiple copies of the promoter-bearing fragment. In crude lysates of B. subtilis grown to competence, a DNA-binding activity that appeared to be specific for the comC promoter fragment was detected by gel retardation assays. This activity, postulated to be due to CTF, was detected only following growth in competence medium, only in the stationary phase of growth, and was dependent on the expression of ComA, a known competence-regulatory factor. In the presence of the mecA42 mutation, the ComA requirement for CTF activity was bypassed, and CTF activity could be detected in lysates prepared from a strain grown in complex medium. This behavior suggested that either the expression or the activation of CTF was regulaied in a competence-specific manner. Comparison of the putative CTF-binding site defined by deletion analysis with a similarly positioned sequence upstream from the start site of the late competence gene comG revealed that both sequences contained palindromes, with 5 of 6 identical base pairs in each aim. It is suggested that these palindromic sequences comprise recognition elements for CTF binding and that CTF binding must occur for the appropriate expression of late competence genes.

Albano et al. (1) observed that a promoter-bearing fragment of the comG operon, when present in multiple copies, inhibited the expression of competence and of all the late competence genes tested, including comG. This finding was interpreted as implying the existence of a positively acting transcriptional factor that was common to the expression of all late competence genes. In the present report, we extend this observation to a comC promoter fragment, locate a binding site for the putative factor upstream from the start site for comC transcription, and present evidence for the competence-specific regulation of the binding factor.

Genetic competence in Bacillus subtilis develops during stationary phase, in response to poorly understood nutritional signals. A number of late competence genes have been discovered, the products of which are presumably directly involved in the binding, uptake, and processing of transforming DNA (1, 2, 5, 13; reviewed in reference 6). Several regulatory genes have also been identified that are required for the appropriate development of competence and for the expression of the late competence genes. Although some of these may specify transcriptional factors, it is unlikely that the products of these regulatory genes interact directly with the cis-acting sequences of the late genes. This may be inferred from the properties of mecA or mecB mutations. mec mutants express late competence genes in any medium, whereas in mec+ strains, expression occurs only in glucoseminimal salts-based media (7). mec mutations also bypass the requirements for most of the regulatory genes; they allow apparently normal post-exponential-phase expression of the late competence genes in the absence of these regulatory gene products (15). These observations suggest that most of the regulatory genes, including comA, comP, comB, degS, degU, sin, and abrB, are involved in detecting and transducing nutritional signals and that information from these signals is relayed via mecA and mecB. The output of information from this signal transduction system might then impinge on a mechanism that directly activates transcription of the late competence genes. The nature of this mechanism is the subject of the present study.

MATERUILS AND METHODS Strains. The B. subtilis strains used were all derivatives of strain 168. The parental strains from which all the mutant constructs were derived are listed in Table 1. Comparative studies were carried out by using isogenic sets of strains constructed in the BD630 background. Strains BD1237 to -1248, BD1722, and BD1743 (Table 1) carried the Tn917lacZ element inserted in the indicated com genes, creating lacZ fusion mutations (11, 18). This element carries an erythromycin resistance (Em') gene. In two other strains (BD1697 and BD1714), the Tn917lacZ element has been replaced with a Cmr Lac- element (9). The strains carrying mecA42 also carried the comG12-lacZ fusion to permit monitoring on L-broth agar plates containing 5-bromo-4-chloro-3-indolyl,-D-galactopyranoside, to ensure the presence of the mecA42 mutation (7). Plasmids and bacteriophage. Several vectors were employed. pMM37 was derived from pIM13 and confers resistance to chloramphenicol (14). pIS184 is a derivative of pUC19 that contains the replication functions of pMM37,

Corresponding author. t Present address: Department of Biochemistry, Merck Sharp &

*

Dohme Research Laboratories, Rahway, NJ 47065.

4064

REGULATION OF GENETIC COMPETENCE

VOL. 172, 1990

TABLE 1. B. subtilis strains Strain

Genotype

BD630 BD1237 BD1401 BD1776 BD1245 BD1246 BD1248 BD1697 BD1714 BD1722 BD1743

hisAl leuA8 metB5 hisAl leuA8 metB5 comC530 hisAl leuA8 metB5 comA124 comA+a hisAl leuA8 metB5 comBl38 comB+a hisAl leuA8 metBS comD413 hisAl leuA8 metB5 comE510 hisAl leuA8 metB5 comGJ2 aroD120 comA124b mecA42 comG12 aroD120 comA124b comG12 hisAl leuA8 metB5 comG12 mecA42 hisAl leuA8 metB5 comC530 comC+a

Source

11 9 9 11 11 11

7, 15 7, 15 7

a This strain was created by Campbell integration, using a donor plasmid carrying a promoter-bearing fragment from comC (13) and consequently has both an interrupted copy of comC fused to lacZ and an intact copy of comC. This integration resulted in a Cmr construct which was converted to Emr by transformation with chromosomal DNA from the original Tn9171acZ fusion strain. b The Emr Lac+ comA124 mutation has been replaced by a Cmr Lac- comA mutant construct inserted at precisely the same place in comA (9).

permitting replication in both Escherichia coli and B. subtilis. It confers Cmr in B. subtilis and ampicillin resistance in E. coli. It was kindly provided by N. Gaur and I. Smith. The M13cat phage vector was constructed by Guzman and Youngman (10). It consists of M13mpl9 into which was inserted a B. subtilis Cmr cassette. pSMO consists of pBR322 carrying a 2-kilobase-pair HindIII comC fragment (13). pSM2 and pSM3 are derivatives of pMM37 that carry the entire comC gene and a comC promoter fragment, respectively. To construct pSM2, the large HindIII-MboI fragment of pMM37 that carries the replication genes and the Cmr determinant was ligated to a BglII-HindIII fragment of pSMO that carried all of comC (see Fig. 1) (13). The ligation mixture was transformed into B. subtilis with selection for Cmr. To create pSM3, pSM2 was first cleaved with PstI and EcoRI and the large fragment was isolated. This eliminated the small fragment containing most of the comC coding region. The large fragment was trimmed by using T4 DNA polymerase, self-ligated, and used to transform B. subtilis with selection for Cmr. The portion of comC retained by pSM3 consisted of 267 base pairs (bp) upstream from the transcriptional start and 159 bp downstream. This included the coding region for 44 of the 248 comC amino acid residues. M13cat was used to construct pSM4, to facilitate deletion analysis of the comC promoter. pSMO was cleaved with BglII and StuI (see Fig. 1), and the small fragment carrying the comC promoter was ligated to double-stranded DNA from M13cat that had been cut with BamHI and SmaI. The ligation mixture was transformed into E. coli JM109, and white plaques were picked and analyzed for the presence of recombinant phage DNA (pSM4). pIS184 derivatives carrying deleted promoter fragments were constructed by cleaving the deleted pSM4 derivatives with XhoI and PstI and ligating the deletion fragments to SalI-PstI-cleaved pIS184, followed by transformation into E. coli AMA10004. Competence and transformation. Competent cells were prepared by using the one-step regimen and competence medium, as described previously (3, 4). Transformation to measure competence levels was carried out by using 1 jig of chromosomal DNA from an appropriate donor strain per ml with incubation for 30 min before selection was applied. DNA manipulations. Plasmid DNA was isolated as described previously (5). 5'- and 3'-end-labeled DNA probes

4065

were prepared by reaction with T4 polynucleotide kinase and by fill-in with the Klenow fragment of DNA polymerase I, respectively (12). BAL 31 deletion. pSM4 DNA (10 ,ug) was cut with XbaI, ethanol precipitated, and suspended in H20. A 2-,ug amount of cut DNA was added to 30 ,ul of 20 mM Tris hydrochloride (pH 8.0)-0.6 M NaCI-12.5 mM MgCl2-12.5 mM CaCl2 containing 1 U of BAL 31 mixed nuclease (International Biotechnologies, Inc.). Incubation was for 5, 10, and 15 min at 30°C. The reaction was stopped by adding 3 ,ul of 0.5 M EDTA and heating to 65°C for 10 min. The samples were phenol-chloroform treated, ethanol precipitated, and redissolved in H20. The DNA samples were trimmed by using T4 polymerase in the presence of the four deoxynucleotide triphosphates and then self-ligated in the presence of an excess of phosphorylated XhoI linkers. Competent JM109 was transformed with the DNA samples. Replicative-form DNA was prepared from individual plaques and analyzed by restriction digestion. Single-stranded DNA was prepared from the useful deletants, which were further characterized by sequencing by the dideoxynucleotide-chain termination method. RNA isolation. RNA was isolated by the method of Ulmanen et al. (16) and treated with RNase-free RQ1 DNase (Promega Biotec) on ice for 10 min, followed by phenol extraction and ethanol precipitation. The RNA was analyzed on 0.8% agarose gels before and after DNase treatment. Transcription mapping. Low-resolution Si nuclease mapping was carried out by using 5'- or 3'-end-labeled probes as described previously (9). The probes and RNA preparations used are described in Results. Primer extension mapping of mRNA termini was carried out by using a synthetic oligonucleotide primer (5' TCCTATGCCCGCAGCTT 3') that was complementary to a comC sequence located at nucleotides 1003 to 1020 in the published sequence (according to the published numbering system) (13). The primer was 5' end labeled with polynucleotide kinase, extended with reverse transcriptase, and analyzed as described previously (17). Dideoxynucleotide-chain termination reactions were run in parallel, using the same primer and a Sequenase kit (U.S. Biochemicals). Gel retardation analysis. Gel retardation assays were carried out essentially as described by Ebbole and Zalkin (8). To prepare crude extracts, the desired strain was grown as described in Results and the cells were washed in Spizizen minimal salts (4) and suspended in 2 ml of breaking buffer per g (wet weight). The buffer contained 10 mM HEPES (N2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid, pH 8.0), 100 mM KCI, 1 mM EDTA, 1 mM dithiothreitol, and 1 mM phenylmethylsulfonyl fluoride. The cells were ruptured by two passages through a French pressure press at 12,000 lb/in2. The lysates were centrifuged at 17,000 x g in an SS34 rotor for 30 min. Glycerol was added to 20% (vol/vol) to the supernatants, and samples were stored at -70°C. Protein concentrations were estimated by using the Bio-Rad reagent. The 273-bp MboI-CfoI fragment from 10 ,ug of pSM3 DNA was 5' end labeled and suspended in 20 pul of H20 for use as a probe. A 1-,ul volume of a 100-fold dilution of the probe was used for each assay. DNA binding was carried out in 20-,lI reaction volumes containing 10 mM HEPES (pH 7.6), 50 mM KCI, 10% (vol/vol) glycerol, 1 mM EDTA, 5 mM MgCl2, 5 mM dithiothreitol, and 50 ,ug of poly(dL-dC) per ml (Sigma Chemical Co.) and DNA fragment and cell lysate as indicated. The lysate was added last, and the contents of the tubes were mixed gently. Incubation was for 30 min at room temperature. A 5-pd volume of 50% glycerol was then added,

MOHAN AND DUBNAU

4066

J. BACTERIOL.

11 I I .

I

°Start

0.5

A

e8 *2

o.)w I

g

O

*

I I

.1

comC530

1 Stop

3

'%

A-3L

u!

I

1.5 kb

A

7

FIG. 1. Physical map of the BglII-HindIII fragment that carries comC (13). The location of the Tn9171acZ insertion that created

_g

...

_1 4

"J

;".I

i

comC530 is shown by an open arrow. The comC transcriptional start

W.

.1

and stop sites identified in this study are indicated, as are relevant restriction enzyme cleavage sites. The solid rectangle marks the location of a cis-acting regulatory sequence also identified in this study. kb, Kilobase pairs.

.1

't

-i~

.-k

5

and the samples were loaded on a 4% polyacrylamide gel containing 2.5% glycerol, while the gel was running. The gel buffer consisted of 0.04 M Tris-acetate (pH 7.5)-2 mM EDTA. The gel (15.9 cm by 14 cm by 1.2 mm) was run at 100 V for 2 h while the buffer was recirculated. All gels were prerun overnight with buffer recirculation. Following electrophoresis, the gels were dried and autoradiographed. RESULTS Transcription mapping. Figure 1 shows a physical map of the comC region, including relevant restriction sites. pSMO was digested with TaqI, and the 520-bp fragment known to carry the promoter (13) was 5' end labeled and isolated. The fragment was hybridized to RNA isolated from a com+ strain (BD630) at six time points (in hours before or after To, the transition between the exponential and stationary growth phases) during growth (T-2, T_1, To, T1, T2, and T3). The hybridization mixture was digested with Si nuclease and electrophoresed under denaturing conditions (Fig. 2). A 375-bp protected band appeared at To, placing the apparent transcriptional start approximately 800 bp downstream from the HindlIl site (Fig. 1) and confirming that comC transcription increases postexponentially (3, 13). 1

2

3

4

5

6

7

B 0T)

~0 CL 0)

8 -T

3 96 -5

2202 01 - 9 1

54-

-

;lx

FIG. 3. (A) Primer extension analysis of comC mRNA. Total RNA samples isolated at T_1, To, T1, T2, and T3 (lanes 1 to 5, respectively) were annealed to an end-labeled synthetic primer and extended with reverse transcriptase. A set of dideoxynucleotidechain termination sequencing reactions were run in parallel, using the same primer, together with comC single-stranded DNA. A primer extension signal appears after To. The sequence given at the right is the complement of the coding strand. The probable start sites for transcription therefore correspond to the complements of the C and T residues marked by dashes. (B) Expression of ,B-galactosidase at several times in the culture used for isolation of RNA. Expression is apparent after To.

13 4FIG. 2. S1 nuclease mapping of the comC mRNA 5' terminus. Total RNA samples from T-2 (lane 2), T-1 (lane 3), To (lane 4), T1 (lane 5), T2 (lanes 6 and 7), and T3 (lane 8) were hybridized to a 5'-end-labeled 520-bp TaqI fragment that was known to carry the comC promoter (13). The hybridization products were treated with Si nuclease and analyzed by polyacrylamide gel electrophoresis. Lane 1 contained an end-labeled mixture of molecular weight standards, the lengths of which are given in base pairs. A 375-bp protected fragment is visible starting at To.

In order to define the apparent start site of the comC mRNA more precisely, primer extension experiments were carried out. RNA was prepared from BD1237 (comC530) at several times. Samples of the BD1237 culture were also assayed for expression of P-galactosidase. The RNA samples were annealed to end-labeled synthetic primer, which was then extended by using reverse transcriptase. Dideoxynucleotide-chain termination sequencing reactions were run, using the same primer, and electrophoresed together with

VOL. 172, 1990

REGULATION OF GENETIC COMPETENCE

(A)

1

comC promoter

TTGGAG

(N19)

coA COnsensus

TTGACA

(N17-19) TATAAT

(B)

2

3

4

5

*

_

6

4067 7

TACAAT

A

A A A G A C-G GOT G-C A-T A-T C-G A-T

506 3 9 6 -i 3444 -

_i

298--

C

GOT 5' G-C

TTTTTTT 3' FIG. 4. Putative comC promoter (A) and transcriptional terminator (B) sequences. N, Nucleotide.

the extension products (Fig. 3A). A major signal appeared at To and decreased after T2. The expression of P-galactosidase increased after To and leveled off after T2 (Fig. 3B). Several much weaker extension signals are visible in Fig. 3 and may correspond to premature terminations or to degradation products. The size of the major signal placed the apparent start at the A or G residue at position 266 or 267, respectively. (The numbering system used here and below assigns the Bglll cleavage site to position 1 [Fig. 1] and differs from the system employed previously [13]). A nucleotide sequence 8 or 9 bases upstream from these positions resembled that of a oA promoter, with a 5- of 6-base match to the -10 consensus sequence and a 3- of 6-base match to the -35 consensus sequence (Fig. 4A). The comC transcriptional terminator was approximately localized by S1 nuclease mapping. pSM0 was digested with NcoI and 3' end labeled by fill-in with the Klenow fragment of DNA polymerase I. The labeled DNA was secondarily cut with EcoRI, and the resulting 600-bp radioactive probe was isolated and hybridized to RNA prepared from the comC+ strain (BD630) at T-1, To, and T2. After S1 nuclease treatment, the protected probe material was electrophoresed (Fig. 5). A protected band of about 300 bp was visible in the To and T2 samples, placing the termination site about 820 bp from the apparent initiation site and 330 bp from the site of the Tn9171acZ insertion that created comC530. Centered at position 1082 is a hyphenated dyad symmetry, followed by a string of seven T residues, that may constitute the comC terminator (13) (Fig. 4B). The first of these T residues is 816 bases downstream from the probable start site for transcription. These results were in excellent agreement with the finding from Northern (RNA) blotting that the comC mRNA consists of about 800 bp (13). Effects of multiple copies of the comC promoter. It has been shown that the comG promoter, when present in multiple copies, inhibits the expression of all late competence genes tested, including a chromosomal copy of comG itself (1). This was taken to imply the existence of an essential competence transcription factor (CTF) that was titrated by the comG promoter fragment. These results further implied

2 20 2 01 -

I

15 4 1 34...

w

I

75_

FIG. 5. Si nuclease mapping of the comC 3' terminus. Total RNA samples isolated at T-1 (lane 2), To (lane 3), and T2 (lane 4) were hybridized to an NcoI-EcoRI probe, 3' end labeled at the NcoI site. The hybridization products were treated with S1 nuclease and analyzed by polyacrylamide gel electrophoresis. Lane 1 contained a mixture of end-labeled molecular weight markers (sizes given in base pairs), lane 5 contained untreated probe, lane 6 contained probe treated with Si nuclease, and lane 7 contained probe hybridized to RNA from T2 but not treated with Si nuclease. A 300-bp protected fragment was visible at To.

that this factor was present in limiting amounts. To confirm the generality of these observations, experiments were conducted with a DNA fragment carrying the comC promoter. It was first necessary to construct multicopy plasmids carrying the comC promoter. For this, the vector pMM37 (14) was used. pMM37 was derived from pIM13, carries a Cmr determinant, and replicates in B. subtilis with a copy number of 150 to 200. Two derivatives were constructed. pSM2 carries the entire comC gene, while pSM3 carries the comC promoter region plus 165 bases downstream from the transcriptional start. pSM3 and the control plasmid (pMM37) were introduced into strains carrying chromosomal lacZ fusions to various com genes. In the case of comC530, pSM2 was introduced as well. In some cases the recipient strains carried intact com genes in addition to the lacZ fusions. The plasmids were introduced into these phenotypically Com+ strains by transformation. In all other cases, the plasmids were transferred by PBS1 transduction. ,B-Galactosidase expression was measured in the plasmid-carrying strains (Fig. 6). The promoter-bearing plasmid had no effect on expression of the competence-regulatory genes comA and comB. However, multiple copies of the comC promoter or of the entire gene reduced the expression from comC530 about 15-fold. Expression from the late competence genes comG12, comD413, and comE510 was also markedly reduced in the presence of pSM3. In all cases, the control plasmid (pMM37) had little or no effect on the expression of the com fusions. Multiple copies of the entire comC gene lowered competence in the wild-type (com+) background by about 15-fold but partly complemented for competence in the comC530 background (not shown). These results are best interpreted as indicating that the comC promoter fragment

4068

_=e~ ~ ~ ~ 1

MOHAN AND DUBNAU 15

comA 124 10

J. BACTERIOL. C(0.18) -97

comB 138 41 o

G(0.004) -79

H:NX14~~~~~~~~~~~~~

TAAAAGCATCCGGCTCCGGCAGAATCAAAAAAAGATTCTGCCGT

2(!0

I-, c

5

0._

0 L

E'

0

80

n

CA 40 aD CO)

8)

0

I(0.000006) 00

54 0

CIO

o

~~~~~~~0

LA

comE510

comD413

64

240 0)

34C

20

0

-1

0

1

2

3

-1

0

1

2

H(0.00002) l-37

TTTTTTCATGTGTAAAATTGAATATTCCCAATTGGAGCTCAGGA

comG12

comC530

F(0.0023) -74

-35

-21

TGTCCATTTTGCTACAATCCATACCAGAACTCAATGAGCTCAAT -10

Ah

+1

FIG. 7. Transformation frequencies of comC deletion mutants. The sequence surrounding the comC promoter is shown, together with the endpoints of five deletions that extend from the left (upstream). The locations of the probable -10, -35, and transcriptional start (+1) sites are indicated. The deletion endpoints are also given in numbers designating distances in base pairs from +1. Values in parentheses refer to transformation frequencies for the metB5 marker obtained with each of the deletion mutants.

3

Time (hours) FIG. 6. Effect of multiple copies of the comC promoter fragment expression of com genes. Strains with the indicated fusions of Tn917lacZ to com genes were grown in competence medium and analyzed for expression of 3-galactosidase at various times. In each panel, results are shown for the Tn917IacZ fusion strain carrying no plasmid (O), carrying the pMM37 vector (U), or carrying pSM3, which contains the comC promoter fragment (/\). The times refer to hours before or after To, the transition between the exponential and stationary growth phases. on

titrating the positively acting CTF, preventing full expression of the late com genes but not of the regulatory genes comA and comB. Deletion analysis of the comC promoter. In order to identify sequences required in cis for the regulation of comC, deletions were made into the 5' end of the gene by using BAL 31 nuclease. The deletions were then integrated into the chromosome so that the comC coding sequence was placed downstream from the deletions, and competence was measured. Since the deletions were constructed with a derivative of the M13cat vector (10), the extent of each deletion could be readily determined by DNA sequencing. Figure 7 shows the endpoints of several deletions, together with the transformation frequencies determined after integration in the chromosome. The wild-type control yielded a transformation frequency of 0.1. One additional deletion that terminated 165 bases upstream from position + 1 exhibited a frequency of 0.2. When the deletion endpoint was further than 97 bp from the transcription start of comC, no effect on transformability was noted. When the deletion terminated 79 bp from the start site, the transformation frequency was reduced about 25-fold. Larger deletions had even greater effects on transformability. Since the comC product is apparently required for transformation, we conclude that sequences downstream from a point located between positions -79 and -97 are needed for the appropriate expression of was

comC.

Effects of multiple copies of the deleted promoters. To determine whether the sequences required for full expression of comC were also those titrating the competence factor, several of the deleted promoter derivatives were cloned into a multicopy vector and the effects on expression

of P-galactosidase from late com gene fusions were measured. For this experiment, the vector pIS184 was used. pIS184 is a derivative of pUC19 that contains the replication function of pMM37, permitting replication in both E. coli and B. subtilis. The copy number of similar plasmids which use the pIM13 replication machinery is 150 to 200 (14). After construction of the desired plasmids in E. coli, they were introduced into a com+ B. subtilis strain by transformation and then into a comC530 strain by transduction. The strain used for this purpose was BD1743, which carried an intact copy of comC in addition to comC530 and was therefore phenotypically Com+. This permitted the measurement of competence as well as of ,-galactosidase. Figure 8 shows the effects of the deletions on the expression of 3-galactosidase. These effects were the reciprocals of the effects on competence shown in Fig. 7, when the deleted promoters in single copy were driving comC expression. This suggested that the sequences required in cis for comC expression overlapped with or were identical to those that titrated CTF. The effects of the deleted multicopy promoter fragments on competence were also determined (Table 2). Again, the promoter sequences shown above to be required for comC expression were also required to exhibit multicopy inhibition of competence. These results are most readily explained by a model in which CTF binds to upstream targets and activates transcription of comC and the other late competence genes. comC promoter-binding activity. Gel retardation assays were done by using crude extracts of competent cells to detect comC promoter-specific binding activity. The cells were grown through the competence regimen to T2 before disruption. The probe DNA fragment used was derived from pSM3 by digestion with MboI and CfoI (Fig. 1). The 273-bp MboI-CfoI fragment was 5' end labeled at the MboI site and used as described in Materials and Methods. Figure 9 shows typical gel retardation results with this system. As the concentration of crude extract in the assay was increased, a slow-moving band increased in intensity, while the intensity of the uncomplexed MboI-CfoI band was seen to decrease. Several experiments were performed to determine favorable conditions for this assay (not shown). They were found to be 30-min incubation in the presence of 50 pLg of poly(dL-dC) per ml and 5 mM MgCl2. The binding activity was found to be specific for the promoter fragment, since other fragments

REGULATION OF GENETIC COMPETENCE

VOL. 172, 1990

80

2

1

3

4069

4

3%60 0 0.

E

Ch

f:.:**

..40 U) CU co

:2

0

CZ cz

20 0)

-1

0

1 Time (hours)

2

3

FIGi. 8. Effects of multiple copies of deleted comC promoter fragments on expression of ,-galactosidase. Strain BD1743, carrying in the chromosome a Tn9171acZ fusion to comC (comC530), was grown in competence medium and ,3-galactosidase expression was measured at the indicated times (O). Isogenic strains containing the comC530-lacZ fusion in the chromosome and carrying either the promoter fragment plasmid pSM3 (0) or multicopy plasmids with deletion fragment C (A), G (A), or F (U) were also grown and ,-galactosidase was measured. The deletions are described in Fig. 7.

derived from pSM3 did not reveal binding activity, and cleavage of the MboI-CfoI fragment in its unique SstI site (Fig. 1) eliminated the retarded fragment (not shown). We suggest that this binding activity was due to the presence of the CTF, postulated from the genetic experiments described above. CTF activity is subject to competence-specffic regulation. None of the experiments described so far address the question whether CTF is a regulatory factor. If we assume that CTF and the factor detected by the in vivo titration experiments are the same, it is still possible that intracellular CTF activity remains constant and that the expression of competence is triggered by some other factor which is regulated in a competence-specific manner. We can address this problem in the case of CTF by assaying binding activity as a function of growth stage, in various media and in different mutational backgrounds. Such experiments strongly suggested that CTF activity was expressed in a competence-specific manner.

FIG. 9. Gel retardation of the comC MboI-CfoI fragment. The 273-bp comC MboI-CfoI fragment was 5' end labeled and mixed with increasing amounts of a crude extract of strain BD630 (com+) grown in competence medium to T2. The samples were incubated at room temperature for 30 min and electrophoresed on a 4% polyacrylamide gel. Lane 1, DNA and no protein; lanes 2, 3, and 4; 20, 40, and 60 ,ug of protein, respectively, in the 20-,ul reaction mixtures. The upper and lower arrowheads mark the retarded and unretarded probe fragments, respectively.

CTF activity was not detectable at T_1 and To and was clearly visible at T2 (Fig. 10). Although not evident in the figure, a faint band was visible in the original autoradiogram in the T1 lane. This result suggested that CTF activity was regulated in response to growth stage. To further investigate the apparent competence dependence of CTF activity, crude protein extracts were prepared from BD1697 (mecA42 comA124) and from BD1714 (mec+ comA124) and assayed for binding activity (Fig. 11). mecA and mecB mutations permit the expression of late competence genes in complex media such as L broth and bypass the requirements for 2

1

3

4

5

6

7

k&

TABLE 2. Effect of deleted promoter fragments in multicopy on competence Insert on vector plasmid

Deletion endpoint

Frequency of transformationa

Entire'

None -97 -79 -74

0.04 0.05 0.28 0.24 0.40

C G F

Nonec

a Transformation was measured to Met prototrophy. b Refers to the 730-bp promoter-bearing fragment of comC. The precise endpoints of deletion fragments C, G, and F are shown in Fig. 7. c Refers to the presence of the vector (pIS184) without any cloned insert.

FIG. 10. Time course of development of CTF activity. Extracts were prepared from strain BD630 (com+) following growth in competence medium. The assays were carried out as described for Fig. 9. Lane 1, probe and no protein; lanes 2 and 3, 40 and 60 jig, respectively, of extract from stage T2; lanes 4 to 7, 40 ,ug of extracts from stages T-1, To, T1, and T2, respectively.

4070

J. BACTERIOL.

MOHAN AND DUBNAU

AG

AC L

~~-84

AF

X

comC

GGCTCCGGCAGAATCAAAKAAAGATTCTGCCGTTTTTTT

comG

TTTCTTGCCAGAAAGAATTGGTTTTTCAGCATATAACAT -81

FIG. 11. Dependence of CTF expression on genetic background and growth medium. Assays were carried out as described for Fig. 9 with extracts from strains grown to T2. The strains for preparation of extracts were grown in competence medium unless otherwise indicated. Lane 1, Probe and no protein; lanes 2 and 15, 40 ,ug of extract from strain BD630 (com+); lanes 3 and 5, 40 and 60 ,ug, respectively, of protein from BD1697 (comA124 mecA42 comG12); lanes 4 and 6, 40 and 60 ,ug, respectively, of protein from BD1714 (comA124); lanes 7 and 9, 40 and 60 ,.g, respectively, of protein from BD1248 (comG12) grown in L broth; lanes 8 and 10, 40 and 60 ,ug, respectively, of protein from BD1722 (comG12 mecA42) grown in L broth; lanes 11 and 13, 40 and 60 ,ug, respectively, of protein from BD1248 (comG12); lanes 12 and 14, 40 and 60 ,ug, respectively, of protein from BD1722 (comG12 mecA42). The mecA42 strains carried the comG12-Tn9171acZ fusion to permit monitoring to ensure the presence of the mec mutation (7).

certain regulatory genes, including comA, for the expression of late competence genes (7, 15). No CTF activity was detected in the comA124 mec+ extract, demonstrating that this activity was dependent on ComA. On the other hand, the comA124 mecA42 extract exhibited CTF activity (Fig. 11, lanes 3 and 4). Since the mecA42 mutation has been shown to bypass the dependence of competence on ComA (15), these results strongly suggested that CTF activity was under competence control and that it was not encoded by comA. Finally, CTF activity was detected in extracts of wild-type (Fig. 11, lanes 2 and 15) and comG12 (Fig. 11, lanes 11 and 12) strains grown in competence medium but not in L broth (Fig. 11, lanes 7 and 9). However, extracts of the mecA42 strain exhibited CTF activity following growth in either medium. Thus CTF expression was subject to growth medium dependence, similar to the development of competence.

In several of the lanes of Fig. 10 and 11, a band that migrates more slowly than the principal retarded band is visible, notably in those samples that lack CTF activity. We do not yet understand the origin of these bands. They may be due to an activity that is masked when CTF is present or perhaps represent a partial activity related to CTF.

DISCUSSION The CTF-binding site. We have demonstrated that sequences upstream from the probable comC transcriptional start site resemble the consensus -35 and -10 sequences for the (A form of RNA polymerase. Since comC is transcribed only after To, and only in certain media, it is clear that the availability of a specific cr factor probably does not govern its expression, since arA is the major vegetative a factor in B. subtilis. Upstream from the putative promoter are additional sequences required for the appropriate expression of comC. These sequences, which may extend as far as 97 bp from the

FIG. 12. Comparison of the comC and comG (1) upstream DNA sequences. Identities are indicated with vertical bars. Heavy arrows mark dyad symmetries, and the vertical dashed line establishes the axes of symmetry. Numbers refer to distances from the probable transcription starts of the two genes. The endpoints of three deletion mutations described in Fig. 7 (C, G, and F) are also indicated.

start site, are also able to inhibit of competence expression when present in multiple copies. Since this inhibition is most readily explained by the titration of a positive transcription factor which we have named CTF, it appears likely that the site defined as essential in cis for expression of comC and the site mediating titration of CTF are the same and that CTF is needed for the transcription of late competence genes. Figure 12 shows the comC upstream sequences compared with those of comG, the only other late competence gene for which both a sequence and a high-resolution transcription map are available. comG also appears to be read by a CA promoter, and when present in multiple copies the DNA sequences surrounding its promoter, like those of comC, are capable of inhibiting the expression of other late competence genes (1). Centered at position -84 for comC and at -81 for comG are palindromic sequences. The comC dyad contains a perfect inverted repeat of 10 bases, whereas that of comG contains only 6 bases, including one noncomplementary pair. The repeats are separated by seven and nine bases, respectively. If we regard the right and left arms of the comG element as comprising six bases each, five of them in each arm can be aligned with identical residues in comC. It is noteworthy that when the two sequences were aligned so as to maximize the match of identical residues the axes of symmetry of the two dyads corresponded exactly and that these axes were similarly placed with respect to the transcriptional start sites. Deletion C (Fig. 12) removed sequences up to the upstream border of the comC palindrome, with no discernible effect on the expression of competence or on the ability of a cloned fragment to inhibit the expression of competence. Deletion of the left arm of the comC dyad (as in deletions G and F) eliminated both effects. The available information is therefore entirely compatible with the tentative conclusion that the similar dyad elements in comC and comG represent at least part of their respective CTF-binding sites. Regulation of CTF activity. The effects of multicopy plasmids bearing either the comC or comG promoter fragments suggested that CTF was required for expression of all late competence genes. We cannot tell whether CTF is sufficient for this expression. However, there is no need to postulate additional activities needed for competence expression, since the regulation of CTF activity appears to be competence specific. This activity appears after To, is expressed in competence medium and not in L broth, and is dependent on the comA product, and the latter dependence and the medium dependence are bypassed by mecA42. We can say little about the gene that encodes CTF, except that it is not comA. One candidate for this determinant is mecA, in which case

VOL. 172, 1990

the mecA42 mutation would probably result in either constitutive expression or constitutive activation of CTF. We propose as a working hypothesis that the final event regulating the expression of late competence genes is the appearance of CTF activity. It cannot yet be determined whether this appearance represents the activation of CTF or its synthesis. The nature of this factor and its mechanism of action and regulation must await the purification of CTF and the cloning of the ctf determinant. ACKNOWLEDGMENTS We gratefully acknowledge discussions with F. Breidt, J. Dubnau, J. Hahn, I. Smith, and Y. Weinrauch. This work was supported by Public Health Service grant A110311 from the National Institutes of Health.

LITERATURE CITED 1. Albano, M., R. Breitling, and D. Dubnau. 1989. Nucleotide sequence and genetic organization of the Bacillus subtilis comG operon. J. Bacteriol. 171:5386-5404. 2. Albano, M., and D. Dubnau. 1989. Cloning and characterization of a cluster of linked Bacillus subtilis late competence mutants. J. Bacteriol. 171:5376-5385. 3. Albano, M., J. Hahn, and I). Dubnau. 1987. Expression of competence genes in Bacillus subtilis. J. Bacteriol. 169:31103117. 4. Anagnostopoulos, C., and J. Spizizen. 1961. Requirements for transformation in Bacillus subtilis. J. Bacteriol. 81:741-746. 5. Breitling, R., and D. Dubnau. 1990. A membrane protein with similarity to N-methylphenylalanine is essential for DNA binding by competent Bacillus subtilis. J. Bacteriol. 172:1499-1508. 6. Dubnau, D. 1989. The competence regulon of Bacillus subtilis, p. 147-166. In I. Smith, R. Slepecky, and P. Setlow (ed.), Regulation of procaryotic development. American Society for Microbiology, Washington, D.C. 7. Dubnau, D., and M. Roggiani. 1990. Growth medium-independent genetic competence mutants of Bacillus subtilis. J. Bacte-

REGULATION OF GENETIC COMPETENCE

4071

riol. 172:4048-4055. 8. Ebbole, D. W., and H. Zalkin. 1989. Interaction of a putative repressor protein with an extended control region of the Bacillus subtilis pur operon. J. Biol. Chem. 264:3553-3561. 9. Guillen, N., Y. Weinrauch, and D. Dubnau. 1989. Cloning and characterization of the regulatory Bacillus subtilis competence genes comA and comB. J. Bacteriol. 171:5354-5361. 10. Guzman, P., and P. Youngman. 1987. Novel integrational vectors for Bacillus subtilis based on the coliphage M13 and their use for the analysis of regulated promoters, p. 299-305. In I. A. T. Ganesan and J. A. Hoch (ed.), Genetics and biotechnology of bacilli, vol. 2. Academic Press, Inc., New York. 11. Hahn, J., M. Albano, and D. Dubnau. 1987. Isolation and characterization of competence mutants in Bacillus subtilis. J. Bacteriol. 169:3104-3109. 12. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 13. Mohan, S., J. Aghion, N. Guillen, and D. Dubnau. 1989. Molecular cloning and characterization of comC, a late competence gene of Bacillus subtilis. J. Bacteriol. 171:6043-6051. 14. Monod, M., C. Denoya, and D. Dubnau. 1986. Sequence and properties of pIM13, a macrolide-lincosamide-streptogramin B resistance plasmid from Bacillus subtilis. J. Bacteriol. 167: 138-147. 15. Roggiani, M., J. Hahn, and D. Dubnau. 1990. Suppression of early competence mutations in Bacillus subtilis by mec mutations. J. Bacteriol. 172:4056-4063. 16. Ulmanen, I., K. Lundstrom, P. Lehtovaara, M. Sarvas, M. Ruohonen, and I. Palva. 1985. Transcription and translation of foreign genes in Bacillus subtilis by the aid of a secretion vector. J. Bacteriol. 162:176-182. 17. Weinrauch, Y., N. Guillen, and D. A. Dubnau. 1989. Sequence and transcription mapping of Bacillus subtilis competence genes comB and comA, one of which is related to a family of bacterial regulatory determinants. J. Bacteriol. 171:5362-5375. 18. Youngman, P., P. Zuber, J. B. Perkins, K. Sandman, M. Igo, and R. Losick. 1985. New ways to study developmental genes in spore-forming bacteria. Science 228:285-291.