Molecular and Cellular Endocrinology, 14 (1990) C97-Cl04 Elsevier Scientific Publishers Ireland, Ltd.
MOLCEL
c97
02437
At the Cutting
Transcriptional
Edge
regulation of hepatic angiotensinogen by the acute-phase response
gene expression
David Ron, Allan R. Brasier and Joel F. Habener Laboratory of Molecular Endocrinology, Massachusetts
Key worrls: Angiotensinogen;
Acute phase response;
General Hospital, Howard Hughes Medical Institute, Harvard Medical School, Boston MA 02114, U.S.A.
Gene transcription;
Interleukin-1;
Nuclear
factor
kB; Glucocorticoids
Summary The acute-phase response is a protective physiological reaction to tissue injury manifested by the immediate increase in production and secretion of liver proteins the function of which is to re-establish the homeostasis altered by injury. Such proteins include blood coagulation factors, opsonins, protease-inhibitors and angiotensinogen, a precursor of the potent vasopressor peptide angiotensin II. The angiotensinogen gene is typical of genes regulated during the acute-phase response inasmuch as the promoter regulating its transcription rate is acutely responsive to three known mediators of the acute-phase response: glucocorticoids, and the cytokines interleukin-1 and tumor necrosis factor. We present a model, based on experimental evidence, for the mechanism by which angiotensinogen gene transcription is regulated in a graded fashion by the interplay of several hormonally-inducible transcription factors that bind a hormonally-inducible enhancer unit of the angiotensinogen promoter. These factors include the glucocorticoid receptor, nuclear factor kappa B and members of the GMT/viral enhancer (C/EBP) family of DNAbinding proteins.
Background Angiotensinogen, produced by and secreted from hepatocytes and other cells, is the precursor of the potent vasoactive peptide angiotensin II. In various physiological states, levels of angiotensin II, the recognized effector molecule of the reninangiotensin system (RAS), are regulated predominantly by the activity of renin. Renin cleaves angiotensinogen to liberate angiotensin I, a de-
Address for correspondence: David Ron, Laboratory of Molecular Endocrinology, Massachusetts General Hospital, Howard Hughes Medical Institute, Harvard Medical School, Boston MA 02114, U.S.A.
0303-7207/90/$03.50
0 1990 Elsevier Scientific
Publishers
Ireland,
capeptide that is further processed to the bioactive octapeptide angiotensin II (Reid et al., 1978). Under conditions of rapid conversion of angiotensinogen to angiotensin II, such as occurs during hemorrhagic shock, increased production of angiotensinogen to keep pace with its consumption is important in preserving the activity of the RAS (Beaty et al., 1976). The importance of adequate levels of renin substrate (angiotensinogen) to the function of the RAS is underscored by the observation that physiological concentrations of angiotensinogen in plasma are close to the K, of the proteolytic activity of renin (Dzau and Hermann, 1975). The absence of evidence for storage or regulated secretion of angiotensinogen by hepatocytes Ltd.
C98
implies that the regulation of the rate of hepatic angiotensinogen production is effected predominantly at the level of angiotensinogen synthesis. The rate of angiotensinogen production by hepatocytes cultured in vitro correlates with the level of cellular angiotensinogen mRNA (Ben-Ari and Garrison, 1988) and levels of mRNA appear to be regulated predominantly at the transcriptional level as assayed by nuclear run-on experiments (Brasier et al., 1986). It follows therefore that the transcription rate of the single-copy angiotensinogen gene is an important factor in determining angiotensinogen production rates. The relevance of the regulation of angiotensinogen gene transcription to the function of the RAS is supported by the observation that transcriptional deregulation of angiotensinogen production (in transgenic mice) can give rise to severe hypertension (Ohkubo et al., 1990). Hepatic production of angiotensinogen and accumulation of its mRNA are under hormonal control. Glucocorticoid stimulation, as well as the increase in circulating levels of inflammatory cytokines associated with the induction of the acutephase response, leads to a rapid increase in hepatic angiotensinogen mRNA in rat liver (Kagayama et
al., 1985; Campbell et al., 1986; Bohnik et al., 1988; Ron et al., 1990a). Thyroid hormones also augment angiotensinogen gene transcription but less potently than glucocorticoids (Campbell and Habener, 1986; Brasier et al., 1986b). Similar effects have been noted in a variety of angiotensinogen-expressing cell lines (Brasier et al., 1986a, 1987; Chang and Perlman, 1987; Ben-Ari and Garrison, 1988). These observations are consistent with a role for hormonally-mediated changes in rates of angiotensinogen gene transcription in regulating the coupling of angiotensinogen production to its consumption during physiologically stressful events such as those that give rise to the induction of the acute-phase response. For these reasons we have embarked on a series of studies to define the molecular mechanisms involved in regulation of angiotensinogen gene transcription during the acute-phase response. Cytokine and glucocorticoid tensinogen gene transcription
activation
of angio-
The hepatic acute-phase response represents a stereotyped alteration in the transcription rate of a
Converging hormonal signals released during the acute-phase response stimulate angiotensinogen gene expression
PITUITARY
ADRENAL
Mononuclear
LIVER
Fig. 1. Schematic representation of the interrelated effects of the inflammatory cytokine network and the pituitary-adrenal axis on the induction of angiotensinogen gene transcription during the acute-phase response. Monocyte derived mediator proteins such as tumor necrosis factor (TNFa) and interleukin-la (IL-la) and glucocorticoids produced by ACTH stimulation of the adrenal cortex stimulate angiotensinogen gene transcription through the regulation of an interplay of transcription factors on the hormonally-inducible enhancer unit. The enhancer unit is comprised of several enhancons including the cytokine-responsive acute-phase response element (APRE) and glucocorticoid-response elements (GREs). ACE refers to angiotensin I converting enzyme.
c99
To assay for the role of cytokines in the induction of angiotensinogen mRNA levels during the acute-phase response, we chose the rat hepatoma cell line H35, a well established cell culture model system for studying the effects of cytokines on the transcription of hepatic genes (Baumann, 1989). Addition of cytokine-containing conditioned medium (obtained from a monocytic cell line that had been stimulated to produce cytokines by exposure to bacterial lipopolysaccharide) to the culture medium of H35 cells elicited a rapid 4-fold increase in angiotensinogen mRNA. This increase is comparable, in its magnitude and time-course, to the increase in hepatic angiotensinogen mRNA obtained by inducing the acute-phase response in vivo by injecting rats with bacterial lipopolysaccharide (Ron et al., 1990a). This cytokine-induced increase in angiotensinogen mRNA manifested itself only when the cells were cultured in the presence of glucocorticoid, which thus appears to have an obligatory permissive role in angiotensinogen gene induction by cytokines (Ron et al., 1990b). Activation in lymphocytes of the transcription rates of specific genes by interleukin-1 and tumor necrosis factor has been demonstrated to be mediated by a &-acting DNA element that binds a cytokine-inducible transcription factor identical to nuclear factor kappa B (NFkB, reviewed in Lenardo and Baltimore 1989). We identified a sequence of nucleotides in the promoter of the rat angiotensinogen gene (between nt -552 and nt - 537) that resembles the consensus sequence for binding by NFkB (Fig. 2). This NFkB-like enhancer sequence is flanked on both sides by DNA
set of genes. This response is elicited by inflammatory cytokines elaborated at the site of inflammation, tissue destruction, or tumor growth. Members of this family of cytokines, exemplified by interleukin-1 alpha and beta, tumor necrosis factors and hepatocyte-stimulating factors, are each capable of modulating the production rate of other members (Akira et al., 1990) as well as giving rise to an increase in circulating levels of glucocorticoids through induction of pituitary ACTH secretion (Besedovski et al., 1986). The acute-phase response is therefore effected by the concerted action of an elaborate network of cytokines and glucocorticoids (Fig. 1). To dissect the contribution of the various components of the cytokine-glucocorticoid network to the activation of the angiotensinogen gene during the acute-phase response, we sought to recreate a cell culture model in which individual components could be separately tested for their ability to increase angiotensinogen mRNA levels. The expression of the angiotensinogen gene in hepatocytes is under the control of numerous positively and negatively-regulated cis-acting DNA elements (Brasier et al., 1989). Glucocorticoids increase the levels of angiotensinogen mRNA when added to the culture medium of a variety of cell lines (Brasier et al., 1986, 1989, 1990; Chang and Perlman, 1987; Ben-Ari and Garrison, 1988). The increase is rapid, independent of new protein synthesis and inhibited by the receptor-binding antagonist RU486, implying that it is mediated directly by the ligand-activated glucocorticoid receptor.
Angiotensinogen Gene Promoter Hormonal/y Inducible Enhancer Unit
-586
-552
-537
1 GM l&TrmL
APRE Hormonally
lnduclble
Enhancer
TRX ----___
Unit
-----._____ GRE I
---__ GRE II ------
APRE -135
.586
I
I
I
CCAGAACATTTTGTTTCAATATGGCTTTACCACAGTTGGGATTTCCCAACCTGAC
I
-478
-465
I
I
CAGAACAGACAACT
Fig. 2. The modular structure of the hormonally-inducible enhancer unit’ of the rat angiotensinogen gene. GRE I and II refer to the glucocorticoid response elements that bind l&and-activated ghxocorticoid receptor. APRE refers to the Acute-Phase Response Element that binds a cytokine-inducible NFkB-like factor as well as members of the C/EBP family of transcription factors.
Cl00
sequences containing the canonical motifs of glucocorticoid receptor binding sites or glucocorticoid-response elements (GREs). As will be argued, this modular array of activator protein binding sites (enhancons) constitutes the ‘ hormonally-inducible enhancer unit’ of the angiotensinogen gene promoter and is comprised of an acute-phase response element (APRE) with adjacent both upstream and downstream GREs. Modulation of gene transcription by acute-phase reactants and glucocorticoids is synergistic and interdependent. Mutation of the NFkB-like element in a chimeric reporter gene (consisting of 615 base pairs of the angiotensinogen promoter fused to a luciferase reporter cDNA) led to loss of cytokine inducibility of the reporter gene activity when introduced as a stably integrated plasmid into H35 cells, whereas the wild type construct was fully inducible by cytokines and glucocorticoids. Furthermore, mirroring the behavior of the endogenous angiotensinogen gene, cytokine inducibility of reporter gene activity was also dependent on the presence of glucocorticoids (Ron et al., 1990a, b). These experiments have thus identified and localized a c&acting DNA element essential for cytokine activation of angiotensinogen gene transcription. A promoter fragment that contains this element can act as a surrogate for the endogenous angiotensinogen gene, exhibiting the full range of complex regulatory phenomena associated with our tissue culture model of the acutephase response. Thus this genomic fragment contains the sequences necessary for the acute-phase response of the rat angiotensinogen gene. A similar sized fragment (0.75 kb of 5’ flanking region driving an angiotensinogen ‘mini-gene’) of the highly homologous mouse angiotensinogen gene, expressed in liver after introduction into the germline of transgenic mice, was fully capable of responding to bacterial lipopolysaccharide (Clouston et al., 1989). These experiments in transgenic mice support the identification of the aforementioned c&acting DNA element as being important to acute-phase activation of angiotensinogen gene transcription. To determine whether or not the cis element of the angiotensinogen gene homologous to the NFkB-binding site is also sufficient for imparting cytokine inducibility on an inert reporter gene, we
fused four copies of an oligonucleotide spanning the element to a minimal promoter-luciferase reporter plasmid. Treatment of HepG2 human hepatoblastoma cells transfected with this reporter plasmid with either monocyte conditioned medium, pure recombinant interleukin-1, or tumor necrosis factor led to a marked induction of reporter gene activity. Quantification of the correctly initiated reporter gene transcripts indicated that this induction was due to an increase in the transcription rate of the reporter gene. Therefore, in view of the ability of the angiotensinogen gene DNA element -552 to - 537 in cis to confer cytokine responsiveness on an otherwise unresponsive promoter, this DNA element in the promoter of the angiotensinogen seems appropriately designated as an acute-phase response element (APRE). Two discoordinately bind the APRJ3
regulated classes of proteins
Activation of transcription by the APRE was rapid, occurring within 2 h after the addition of cytokines to the culture medium of HepG2 cells, and was not inhibited by cycloheximide, indicating that new protein synthesis is not necessary for the induction of transcription. These features are typical of signals that are transduced by the rapid nuclear translocation of NFkB (Sen and Baltimore, 1986b). We therefore used nuclear extracts prepared from acute-phase response rat liver, and cytokine-treated hepatoma cells, to correlate the transcriptional events with alterations in the patterns of proteins binding to the APRE. Electrophoretic mobility shift assays (EMSA) and DNase I footprint protection assays revealed the presence of two distinct classes of proteins binding the APRE: a constitutively present binding activity termed binding proteins constitutive (BPc) and an inducible activity termed binding protein inducible (BPi; Ron et al., 1990a). Chromatographic separation of the two protein species enabled us to study their sequence-specific binding characteristics. Methylation of distinct guanosine residues within the APRE selectivity interfered with DNA binding by BPi and BPc. BPi gave a methylation interference pattern indistinguishable from that of NFkB whereas BPc gave
Cl01
a different pattern. The identification of BPi as NFkB was further strengthened by the estimated molecular weight of the cytokine inducible protein, 50 kDa by U.V.-crosslinking (Baeuerele and Baltimore, 1989) and the ability of cytokines or phorbol esters to induce BPi in the presence of cycloheximide (Sen and Baltimore, 1986). Thus the two classes of proteins contact different nucleotides within overlapping binding sites (Brasier et al., 1990a; Ron et al., 1990a). The information from the binding studies allowed us to construct point mutations in the APRE that selectively interfered with binding by either BPi or BPc. By transfecting reporter gene plasmids that contained such mutant APREs in their promoter, we were able to assay selectively for the activity of BPi or BPc. Only reporter genes that contained BPi-binding sites were inducible by cytokines, thus demonstrating that induction of the NFkB-like BPi is essential for rapid acute-phase induction of the APRE. Reporter genes devoid of both BPi and BPc binding activity were very poorly transcribed, whereas reporter genes that bound either BPi or BPc had significantly higher basal activity. These results indicate that both BPi and BPc are transcriptional activators and that, though barely detectable by EMSA in nuclei prepared from unstimulated cells, basal levels of BPi are sufficiently high in HepG2 cells to activate the APRE. The EMSA indicated that the level of BPi present in uninduced hepatoma cells was far less than that of BPc, so that BPi appears to be intrinsically a more potent transcriptional activator than BPc. Furthermore, upon treatment of HepG2 cells with cytokines, we consistently found that mutant reporter genes that bound only BPi were more active than the wild type APRE-containing genes that bound both BPi and BPc (Brasier et al., 1990a). These results imply that BPc attenuates the BPi-mediated truns-activation of the APRE by displacing a relatively scarce (but powerful) truns-activator with a relatively abundant weaker one (Fig. 3). Support for this model came with the discovery that BPc represents a heterogeneous family of proteins with apparent molecular weights ranging from 15 to 42 kDa, all of which are related to the well-characterized transcription factor CAAT/enhancer binding protein (C/EBP). This relation-
A.
Stem/d Medlated induction of Anglotenslnogen Gene Expression (in the absence of acute phase Induction)
TAX
I B.
Hormonally-Inducible
Enhancer
InductIon
Unit
Acute Phase Induction of Angiotensinogen Gene Expression
GlUCOCO~tiCOi
(NFkB)
Acute Phase TRX Induction
ILl/TNFa
Fig. 3. Synergistic activation of the angiotensinogen promoter by glucocorticoid receptor (CR), NFkB and members of the C/EBP family of transcription factors. A: Synergism between CR and C/EBP proteins under non-cytokine-induced conditions. B: Replacement of C/EBP proteins by NFkB during the acute-phase response results in further synergistic activation of the angiotensinogen promoter. (Figure modified from that in Brasier et al., 1990b).
ship manifests itself in the following ways: (1) Known C/EBP binding sites compete for binding of members of the BPc family to the APRE. (2) Anti-C/EBP antiserum binds to members of the BPc family. (3) Bacterially-expressed C/EBP heterodimerizes with members of the BPc family. (4) Bacterially-expressed C/EBP binds directly to the APRE. (5) Overexpressing C/EBP in HepG2 cells (by transfecting a viral promoter-driven expression vector encoding the cloned C/EBP cDNA) led to a striking activation of the APRE. Furthermore, the overexpression of C/EBP led to an attenuation of cytokine-mediated activation of the APRE (Brasier et al., 1990a). These experiments provide direct evidence that competition between BPi and BPc for a common binding site results in
Cl02
the modulation gene APRE.
of activity
of the angiotensinogen
Functional interaction between APRE-binding proteins and the ligand-activated glucocorticoid receptor In H35 rat hepatoma cells we noted that the induction of angiotensinogen mRNA levels by cytokines required that the cells be co-stimulated with glucocorticoids. A stably integrated reporter gene plasmid consisting of 615 base pairs of the angiotensinogen promoter fused to a luciferase reporter exhibited similar behavior (Ron et al., 1990b). In transient transfections, however, reporter genes consisting of four copies of the APRE fused to a minimal promoter were inducible by cytokines even in the absence of co-stimulation by glucocorticoids. Furthermore, cytokine induction of BPi binding activity was not dependent on glucocorticoids, suggesting that glucocorticoids are unlikely to exert their permissive effect by facilitating the signal transduction pathway from the cytokine receptor to the activation of BPi. This conclusion is supported by the lack of a glucocorticoid dependence on the cytokine-mediated activation of other genes, such as serum amyloid A protein, interleukin-2 receptor alpha gene, and human immunodeficiency virus, where responsiveness to cytokines is mediated by the binding of an NFkB-like factor (Bohnlein et al., 1988; Edbrooke et al., 1989; Osbourne et al., 1989). The architecture of the rat angiotensinogen promoter, in which the APRE is flanked by two glucocorticoid-response element (GRE) motifs, suggested to us the possibility that glucocorticoid dependence of angiotensinogen gene cytokine responsiveness is a consequence of this particular arrangement (Fig. 2). To address the role of the two GREs in glucocorticoid activation of angiotensinogen gene transcription, we constructed a reporter plasmid incorporating the angiotensinogen gene sequences spanning the GREs and the APRE, as well as a series of mutant reporter constructs in which either one or both of the GREs were altered by the introduction of discrete point-mutations that affect glucocorticoid receptor binding. In preliminary cell culture studies we found that to obtain dexamethasone responsive-
ness in the HepG2 cell line we needed to express the glucocorticoid receptor by co-transfecting an expression plasmid encoding the receptor (Brasier et al., 1990b). In transient transfection experiments into glucocorticoid receptor-complemented HepG2 cells we found that both GRE elements were necessary for full glucocorticoid inducibility of the reporter gene. The downstream GRE plays an ancillary role in glucocorticoid inducibility, limited to synergizing with the upstream GRE; in the absence of the downstream element, glucocorticoid inducibility is diminished but not lost, whereas mutations of the upstream GRE lead to a loss of all glucocorticoid inducibility. Both elements bind glucocorticoid receptor in vitro, and are capable, when fused upstream of a minimal promoter, of activating transcription in a hormone dependent manner (Brasier et al., 1990b). Consistent with the results obtained with the endogenous angiotensinogen gene in H35 cells the same reporter plasmid was responsive to interleukin-1 or tumor necrosis factor only if the transfected cells were co-stimulated with dexamethasone (Ron et al., 1990b). Mutations of either one of the two GREs (resulting in a striking fall in dexamethasone-stimulated reporter gene activity) had no effect on the extent of cytokine inducibility of the gene, which still remained glucocorticoid-depenent. This finding suggests a functional redundancy of the two GREs in their permissive actions on cytokine inducibility of angiotensinogen gene transcription. When mutations were introduced into both GREs, however, there was a striking loss of cytokine inducibility (Ron et al., 1990b). These observations suggest a model in which the glucocorticoid dependence of cytokine activation of the angiotensinogen gene is a consequence of an inability of the single copy APRE to activate transcription from the distantly located promoter (Fig. 3). As is the case for many other enhancers, the activity of NFkB-binding sites is dependent on number of copies of the protein-binding site as well as their distance from the transcription startsite (Pierce et al., 1988). In concert with ligandactivated glucocorticoid receptor, bound at either one of the two adjacent GREs, the APRE becomes able to activate transcription in a cytokinedependent manner. This model is consistent with
Cl03
the well-established capacity of GREs to unmask the latent activity of adjacent ‘dormant’ enhancers (Cordingly et al., 1987; Schule et al., 1988; Strahle et al., 1988). Thus the angiotensinogen gene APRE appears to function within the context of a larger DNA regulatory element: the ‘ hormonally-inducible enhancer unit’ that also contains the two GREs (Fig. 2). The modular structure of this ‘hormonally-inducible enhancer unit’, vis-a-vis the responsiveness of the angiotensinogen gene to cytokines, led us to question whether or not the proteins binding to the APRE under non-cytokine induced conditions might also play a role in the glucocorticoid inducibility of the gene. Analysis of the transcriptional activity of mutant APREs fused to a minimal promoter demonstrated that both BPi and BPc were also activators of the APRE in uninduced nuclei (Brasier et al., 1990a). To address the potential role of these two proteins in regulating the glucocorticoid responsiveness of the angiotensinogen gene we constructed reporter plasmids in which the APRE in the angiotensinogen promoter had been mutated to create an enhancer that selectivity bound BPi, BPc, or neither protein. When transfected into glucocorticoid receptorcomplemented HepG2 cells mutant reporter genes that bound selectivity BPi or BPc were fully inducible by glucocorticoids. However, a mutation that abolished both BPi and BPc binding led to a significant (Cfold) loss of glucocorticoid inducibility (Brasier, 1990b). These findings indicate that the transcriptional activators that bind to the APRE are capable of a productive interaction with adjacently-bound ligand-activated glucocorticoid receptors. This interaction is, in turn, necessary to manifest the full glucocorticoid induction of transcription of the angiotensinogen gene. Functional implications hle enhancer unit
of the hormonally-induci-
The interdependence of the transcriptional activities of the APRE and the two GREs of potential importance to the regulation of angiotensinogen gene expression under a variety of physiological conditions. The identified ‘ hormonally-inducible enhancer unit’ of the APRE and two GREs
functions at the level of the regulation of angiotensinogen gene transcription as an integrator of signals transmitted through two distinct signaling pathways. Cytokine induction of hepatic angiotensinogen gene transcription will occur if, and only if, glucocorticoid receptors are concomitantly activated. This limits the cytokine-mediated activation of angiotensinogen gene to circumstances in which both pathways are simultaneously activated, such as during the acute-phase response. Thus we note the convergence of information from two interrelated stress-response pathways (the hypothalamic-pituitary-adrenal axis and the network of inflammatory cytokines) on the angiotensinogen gene ‘ hormonally-inducible enhancer unit’ (Fig. 1). This convergence results in an adaptive increase in the production of renin substrate allowing its rapid consumption. Dependence of the response to cytokines on glucocorticoids distinguishes angiotensinogen from many other acute-phase response genes. At the level of the organization of the promoter genes responsive to cytokines in the absence of additional stimuli contain either a multiplicity of NFkB sites (such as can be found in the serum amyloid A protein gene (Edbrooke et al., 1989) and the human immunodeficiency virus long terminal repeat (Nabel and Baltimore, 1988)) or have these sites positioned very close to the transcription start-site (as exemplified by the interferon-beta gene (Fan and Maniatis, 1989)). In contrast, the single copy rat angiotensinogen gene NFkB-binding APRE is unusual in its relatively long distance from the major transcription startsite. Thus it appears that different topological organizations of functionally interchangeable regulatory-protein binding sites within the promoter can give rise to networks of genes that are differentially regulated by similar, if not identical, physiological events. The dependence of a full glucocorticoid inducibility of the transcription of the angiotensinogen gene on the activity of the APRE represents a facet of the functional importance of the modularity of the angiotensinogen ‘ hormonally-inducible enhancer unit’. In non-cytokine-stimulated cells the APRE is bound by BPc’s members of a C/EBP-like family of transcription factors. In liver and adipose tissue expression of members of this
Cl0 4
family is regulated in a developmental stagespecific manner (Birkenmeier et al., 1989; Mueller et al., 1990). We have observed differences in the pattern of BPc’s present in various tissues when nuclear extracts have been studied by EMSA. These findings suggest the possibility that the APRE is occupied by functionally distinct proteins in different cell types and that the ‘hormonally-inducible enhancer unit’ integrates developmental (i.e., cell-type specific) as well as hormonal signals at the level of the activation of angiotensinogen gene transcription. Acknowledgements We thank Kathryn A. Wright and James E. Tate for expert experimental assistance and Townley Freeman for preparation of the manuscript. References Akira, S., Hirano, T., Taga, T. and Kishimoto, T. (1990) FASEB .I. 4, 2860-2867. Baeuerle, P.A. and Baltimore, D. (1989) Genes Dev. 3, 16891698. Baumann, H. (1989) In Vitro Cell. Dev. Biol. 25, 115-126. Beaty, O., Sioop, C.H. S&mid, H.E. and Buckalow, V.M. (1976) Am. J. Physiol. 231, 1300-1307. Ben Ari, E.T. and Garrison, J.C. (1988) Am. J. Physiol. 255, E70-E79. Besedovsky, H., Del Rey, A., Sorkin, E. and Dinarello, C.A. (1986) Science 233, 652-654. Birkenmeier, E.H., Gwyenn, B., Howard, S., Jerry, J., Gordon, J.I., Landschulz, W.H. and M&night, S.L. (1989) Genes Dev. 3, 1146-1156. Bohnlein, E., Lowenthal, J.W., Siekevitz, M., Ballard, D.W., Franza, B.R. and Green, W.C. (1988) Cell 53, 827-836. Bouhnik, J., Savoie, F. and Corvol, P. (1988) B&hem. Pharmacol. 37, 1099-1102. Brasier, A.R., Philippe, J., Campbell, D.J. and Habener, J.F. (1986a) J. Biol. Chem. 261, 16148-16154. Brasier, A.R., Philippe, J., Campbell, D.J. and Habener, J.F. (1986b) Trans. Assoc. Am. Phys. 49, 13-19.
Brasier, A.R., Tate, J.E., Ron, D. and Habener, J.F. (1989) Mol. Endocrinol. 3, 1022-1034. Brasier, A.R., Ron, D., Tate, J.E. and Habener, J.F. (1990a) EMBO. J. (in press). Brasier, A.R., Ron, D., Tate, J.E. and Habener, J.F. (1990b) Mol. Endocrinol. (in press). Campbell, D.J. and Habener, J.F. (1986) J. Clin. Invest. 78, 31-39. Chang, E. and Perlman, A.J. (1987) Endocrinology 121, 513519. Clouston, W.M., Lyons, LG. and Richards, RI. (1989) EMBO J. 8, 3337-3343. Cordingly, M.G., Riegel, A.T. and Hager, G.L. (1987) Cell 48, 261-270. Dzau, V.J. and Hermann, H.C. (1982) Life Sci. 30, 577-584. Edbrooke, M.R., Burt, D.W., Cheshire, J.K. and Woo, P. (1989) Mol. Cell. Biol. 9, 1908-1916. Fan, C.M. and Maniatis, J.T. (1989) EMBO J. 8, 101-110. Kageyama, R., Ohkubu, H. and Nakanishi, S. (1985) Biochem. Biophys. Res. Commun. 129, 826-832. Lenardo, M.J. and Baltimore, D. (1989) Cell 58, 227-229. Mueller, C.R., Marie, P. and Schibler, U. (1990) Cell 61, 279-291. Nabel, G. and Baltimore, D. (1987) Nature 326, 711-713. Ohkubo, H., Kawakami, H., Kakehi, Y., Takumi, T., Arai, H., Yokota, Y., lwai, M., Tanabe, Y., Masu, M., Hata, J., Iwao, H., Okamoto, H., Yokoyama, M., Nomura, T., Katsuki, M. and Nakanishi, S. (1990) Proc. Natl. Acad. Sci. U.S.A. 87, 5153-5157. Osboume, L., Kunkel, S. and Nabel, G.J. (1989) Proc. Natl. Acad. Sci. U.S.A. 86, 2336-2340. Pierce, J.W., Lenardo, M. and Baltimore, D. (1988) Proc. Natl. Acad. Sci. U.S.A. 85, 1482-1486. Reid, LA., Morris, B.J. and Ganong, W.F. (1978) Annu. Rev. Physiol. 40, 377-410. Ron, D., Brasier, A.R., Wright, K.W. and Habener, J.F. (1990a) Mol. Cell. Biol. 10, 4389-4395. Ron, D., Brasier, A.R., Wright, K.A., Tate, J.E. and Habener, J.F. (1990b) Mol. Cell. Biol. 10, 1023-1032. Schule, R., Muller, M., Kaltschmidt, C. and Renkawitz, R. (1988) Science 242, 1418-1420. Sen, R. and Baltimore, D. (1986) Cell 47, 921-928. StrahIe, U., Schmid, W. and Schutz, G. (1988) EMBO J. 7, 3389-3395.
MOLCEL
c97
02437
At the Cutting
Transcriptional
Edge
regulation of hepatic angiotensinogen by the acute-phase response
gene expression
David Ron, Allan R. Brasier and Joel F. Habener Laboratory of Molecular Endocrinology, Massachusetts
Key worrls: Angiotensinogen;
Acute phase response;
General Hospital, Howard Hughes Medical Institute, Harvard Medical School, Boston MA 02114, U.S.A.
Gene transcription;
Interleukin-1;
Nuclear
factor
kB; Glucocorticoids
Summary The acute-phase response is a protective physiological reaction to tissue injury manifested by the immediate increase in production and secretion of liver proteins the function of which is to re-establish the homeostasis altered by injury. Such proteins include blood coagulation factors, opsonins, protease-inhibitors and angiotensinogen, a precursor of the potent vasopressor peptide angiotensin II. The angiotensinogen gene is typical of genes regulated during the acute-phase response inasmuch as the promoter regulating its transcription rate is acutely responsive to three known mediators of the acute-phase response: glucocorticoids, and the cytokines interleukin-1 and tumor necrosis factor. We present a model, based on experimental evidence, for the mechanism by which angiotensinogen gene transcription is regulated in a graded fashion by the interplay of several hormonally-inducible transcription factors that bind a hormonally-inducible enhancer unit of the angiotensinogen promoter. These factors include the glucocorticoid receptor, nuclear factor kappa B and members of the GMT/viral enhancer (C/EBP) family of DNAbinding proteins.
Background Angiotensinogen, produced by and secreted from hepatocytes and other cells, is the precursor of the potent vasoactive peptide angiotensin II. In various physiological states, levels of angiotensin II, the recognized effector molecule of the reninangiotensin system (RAS), are regulated predominantly by the activity of renin. Renin cleaves angiotensinogen to liberate angiotensin I, a de-
Address for correspondence: David Ron, Laboratory of Molecular Endocrinology, Massachusetts General Hospital, Howard Hughes Medical Institute, Harvard Medical School, Boston MA 02114, U.S.A.
0303-7207/90/$03.50
0 1990 Elsevier Scientific
Publishers
Ireland,
capeptide that is further processed to the bioactive octapeptide angiotensin II (Reid et al., 1978). Under conditions of rapid conversion of angiotensinogen to angiotensin II, such as occurs during hemorrhagic shock, increased production of angiotensinogen to keep pace with its consumption is important in preserving the activity of the RAS (Beaty et al., 1976). The importance of adequate levels of renin substrate (angiotensinogen) to the function of the RAS is underscored by the observation that physiological concentrations of angiotensinogen in plasma are close to the K, of the proteolytic activity of renin (Dzau and Hermann, 1975). The absence of evidence for storage or regulated secretion of angiotensinogen by hepatocytes Ltd.
C98
implies that the regulation of the rate of hepatic angiotensinogen production is effected predominantly at the level of angiotensinogen synthesis. The rate of angiotensinogen production by hepatocytes cultured in vitro correlates with the level of cellular angiotensinogen mRNA (Ben-Ari and Garrison, 1988) and levels of mRNA appear to be regulated predominantly at the transcriptional level as assayed by nuclear run-on experiments (Brasier et al., 1986). It follows therefore that the transcription rate of the single-copy angiotensinogen gene is an important factor in determining angiotensinogen production rates. The relevance of the regulation of angiotensinogen gene transcription to the function of the RAS is supported by the observation that transcriptional deregulation of angiotensinogen production (in transgenic mice) can give rise to severe hypertension (Ohkubo et al., 1990). Hepatic production of angiotensinogen and accumulation of its mRNA are under hormonal control. Glucocorticoid stimulation, as well as the increase in circulating levels of inflammatory cytokines associated with the induction of the acutephase response, leads to a rapid increase in hepatic angiotensinogen mRNA in rat liver (Kagayama et
al., 1985; Campbell et al., 1986; Bohnik et al., 1988; Ron et al., 1990a). Thyroid hormones also augment angiotensinogen gene transcription but less potently than glucocorticoids (Campbell and Habener, 1986; Brasier et al., 1986b). Similar effects have been noted in a variety of angiotensinogen-expressing cell lines (Brasier et al., 1986a, 1987; Chang and Perlman, 1987; Ben-Ari and Garrison, 1988). These observations are consistent with a role for hormonally-mediated changes in rates of angiotensinogen gene transcription in regulating the coupling of angiotensinogen production to its consumption during physiologically stressful events such as those that give rise to the induction of the acute-phase response. For these reasons we have embarked on a series of studies to define the molecular mechanisms involved in regulation of angiotensinogen gene transcription during the acute-phase response. Cytokine and glucocorticoid tensinogen gene transcription
activation
of angio-
The hepatic acute-phase response represents a stereotyped alteration in the transcription rate of a
Converging hormonal signals released during the acute-phase response stimulate angiotensinogen gene expression
PITUITARY
ADRENAL
Mononuclear
LIVER
Fig. 1. Schematic representation of the interrelated effects of the inflammatory cytokine network and the pituitary-adrenal axis on the induction of angiotensinogen gene transcription during the acute-phase response. Monocyte derived mediator proteins such as tumor necrosis factor (TNFa) and interleukin-la (IL-la) and glucocorticoids produced by ACTH stimulation of the adrenal cortex stimulate angiotensinogen gene transcription through the regulation of an interplay of transcription factors on the hormonally-inducible enhancer unit. The enhancer unit is comprised of several enhancons including the cytokine-responsive acute-phase response element (APRE) and glucocorticoid-response elements (GREs). ACE refers to angiotensin I converting enzyme.
c99
To assay for the role of cytokines in the induction of angiotensinogen mRNA levels during the acute-phase response, we chose the rat hepatoma cell line H35, a well established cell culture model system for studying the effects of cytokines on the transcription of hepatic genes (Baumann, 1989). Addition of cytokine-containing conditioned medium (obtained from a monocytic cell line that had been stimulated to produce cytokines by exposure to bacterial lipopolysaccharide) to the culture medium of H35 cells elicited a rapid 4-fold increase in angiotensinogen mRNA. This increase is comparable, in its magnitude and time-course, to the increase in hepatic angiotensinogen mRNA obtained by inducing the acute-phase response in vivo by injecting rats with bacterial lipopolysaccharide (Ron et al., 1990a). This cytokine-induced increase in angiotensinogen mRNA manifested itself only when the cells were cultured in the presence of glucocorticoid, which thus appears to have an obligatory permissive role in angiotensinogen gene induction by cytokines (Ron et al., 1990b). Activation in lymphocytes of the transcription rates of specific genes by interleukin-1 and tumor necrosis factor has been demonstrated to be mediated by a &-acting DNA element that binds a cytokine-inducible transcription factor identical to nuclear factor kappa B (NFkB, reviewed in Lenardo and Baltimore 1989). We identified a sequence of nucleotides in the promoter of the rat angiotensinogen gene (between nt -552 and nt - 537) that resembles the consensus sequence for binding by NFkB (Fig. 2). This NFkB-like enhancer sequence is flanked on both sides by DNA
set of genes. This response is elicited by inflammatory cytokines elaborated at the site of inflammation, tissue destruction, or tumor growth. Members of this family of cytokines, exemplified by interleukin-1 alpha and beta, tumor necrosis factors and hepatocyte-stimulating factors, are each capable of modulating the production rate of other members (Akira et al., 1990) as well as giving rise to an increase in circulating levels of glucocorticoids through induction of pituitary ACTH secretion (Besedovski et al., 1986). The acute-phase response is therefore effected by the concerted action of an elaborate network of cytokines and glucocorticoids (Fig. 1). To dissect the contribution of the various components of the cytokine-glucocorticoid network to the activation of the angiotensinogen gene during the acute-phase response, we sought to recreate a cell culture model in which individual components could be separately tested for their ability to increase angiotensinogen mRNA levels. The expression of the angiotensinogen gene in hepatocytes is under the control of numerous positively and negatively-regulated cis-acting DNA elements (Brasier et al., 1989). Glucocorticoids increase the levels of angiotensinogen mRNA when added to the culture medium of a variety of cell lines (Brasier et al., 1986, 1989, 1990; Chang and Perlman, 1987; Ben-Ari and Garrison, 1988). The increase is rapid, independent of new protein synthesis and inhibited by the receptor-binding antagonist RU486, implying that it is mediated directly by the ligand-activated glucocorticoid receptor.
Angiotensinogen Gene Promoter Hormonal/y Inducible Enhancer Unit
-586
-552
-537
1 GM l&TrmL
APRE Hormonally
lnduclble
Enhancer
TRX ----___
Unit
-----._____ GRE I
---__ GRE II ------
APRE -135
.586
I
I
I
CCAGAACATTTTGTTTCAATATGGCTTTACCACAGTTGGGATTTCCCAACCTGAC
I
-478
-465
I
I
CAGAACAGACAACT
Fig. 2. The modular structure of the hormonally-inducible enhancer unit’ of the rat angiotensinogen gene. GRE I and II refer to the glucocorticoid response elements that bind l&and-activated ghxocorticoid receptor. APRE refers to the Acute-Phase Response Element that binds a cytokine-inducible NFkB-like factor as well as members of the C/EBP family of transcription factors.
Cl00
sequences containing the canonical motifs of glucocorticoid receptor binding sites or glucocorticoid-response elements (GREs). As will be argued, this modular array of activator protein binding sites (enhancons) constitutes the ‘ hormonally-inducible enhancer unit’ of the angiotensinogen gene promoter and is comprised of an acute-phase response element (APRE) with adjacent both upstream and downstream GREs. Modulation of gene transcription by acute-phase reactants and glucocorticoids is synergistic and interdependent. Mutation of the NFkB-like element in a chimeric reporter gene (consisting of 615 base pairs of the angiotensinogen promoter fused to a luciferase reporter cDNA) led to loss of cytokine inducibility of the reporter gene activity when introduced as a stably integrated plasmid into H35 cells, whereas the wild type construct was fully inducible by cytokines and glucocorticoids. Furthermore, mirroring the behavior of the endogenous angiotensinogen gene, cytokine inducibility of reporter gene activity was also dependent on the presence of glucocorticoids (Ron et al., 1990a, b). These experiments have thus identified and localized a c&acting DNA element essential for cytokine activation of angiotensinogen gene transcription. A promoter fragment that contains this element can act as a surrogate for the endogenous angiotensinogen gene, exhibiting the full range of complex regulatory phenomena associated with our tissue culture model of the acutephase response. Thus this genomic fragment contains the sequences necessary for the acute-phase response of the rat angiotensinogen gene. A similar sized fragment (0.75 kb of 5’ flanking region driving an angiotensinogen ‘mini-gene’) of the highly homologous mouse angiotensinogen gene, expressed in liver after introduction into the germline of transgenic mice, was fully capable of responding to bacterial lipopolysaccharide (Clouston et al., 1989). These experiments in transgenic mice support the identification of the aforementioned c&acting DNA element as being important to acute-phase activation of angiotensinogen gene transcription. To determine whether or not the cis element of the angiotensinogen gene homologous to the NFkB-binding site is also sufficient for imparting cytokine inducibility on an inert reporter gene, we
fused four copies of an oligonucleotide spanning the element to a minimal promoter-luciferase reporter plasmid. Treatment of HepG2 human hepatoblastoma cells transfected with this reporter plasmid with either monocyte conditioned medium, pure recombinant interleukin-1, or tumor necrosis factor led to a marked induction of reporter gene activity. Quantification of the correctly initiated reporter gene transcripts indicated that this induction was due to an increase in the transcription rate of the reporter gene. Therefore, in view of the ability of the angiotensinogen gene DNA element -552 to - 537 in cis to confer cytokine responsiveness on an otherwise unresponsive promoter, this DNA element in the promoter of the angiotensinogen seems appropriately designated as an acute-phase response element (APRE). Two discoordinately bind the APRJ3
regulated classes of proteins
Activation of transcription by the APRE was rapid, occurring within 2 h after the addition of cytokines to the culture medium of HepG2 cells, and was not inhibited by cycloheximide, indicating that new protein synthesis is not necessary for the induction of transcription. These features are typical of signals that are transduced by the rapid nuclear translocation of NFkB (Sen and Baltimore, 1986b). We therefore used nuclear extracts prepared from acute-phase response rat liver, and cytokine-treated hepatoma cells, to correlate the transcriptional events with alterations in the patterns of proteins binding to the APRE. Electrophoretic mobility shift assays (EMSA) and DNase I footprint protection assays revealed the presence of two distinct classes of proteins binding the APRE: a constitutively present binding activity termed binding proteins constitutive (BPc) and an inducible activity termed binding protein inducible (BPi; Ron et al., 1990a). Chromatographic separation of the two protein species enabled us to study their sequence-specific binding characteristics. Methylation of distinct guanosine residues within the APRE selectivity interfered with DNA binding by BPi and BPc. BPi gave a methylation interference pattern indistinguishable from that of NFkB whereas BPc gave
Cl01
a different pattern. The identification of BPi as NFkB was further strengthened by the estimated molecular weight of the cytokine inducible protein, 50 kDa by U.V.-crosslinking (Baeuerele and Baltimore, 1989) and the ability of cytokines or phorbol esters to induce BPi in the presence of cycloheximide (Sen and Baltimore, 1986). Thus the two classes of proteins contact different nucleotides within overlapping binding sites (Brasier et al., 1990a; Ron et al., 1990a). The information from the binding studies allowed us to construct point mutations in the APRE that selectively interfered with binding by either BPi or BPc. By transfecting reporter gene plasmids that contained such mutant APREs in their promoter, we were able to assay selectively for the activity of BPi or BPc. Only reporter genes that contained BPi-binding sites were inducible by cytokines, thus demonstrating that induction of the NFkB-like BPi is essential for rapid acute-phase induction of the APRE. Reporter genes devoid of both BPi and BPc binding activity were very poorly transcribed, whereas reporter genes that bound either BPi or BPc had significantly higher basal activity. These results indicate that both BPi and BPc are transcriptional activators and that, though barely detectable by EMSA in nuclei prepared from unstimulated cells, basal levels of BPi are sufficiently high in HepG2 cells to activate the APRE. The EMSA indicated that the level of BPi present in uninduced hepatoma cells was far less than that of BPc, so that BPi appears to be intrinsically a more potent transcriptional activator than BPc. Furthermore, upon treatment of HepG2 cells with cytokines, we consistently found that mutant reporter genes that bound only BPi were more active than the wild type APRE-containing genes that bound both BPi and BPc (Brasier et al., 1990a). These results imply that BPc attenuates the BPi-mediated truns-activation of the APRE by displacing a relatively scarce (but powerful) truns-activator with a relatively abundant weaker one (Fig. 3). Support for this model came with the discovery that BPc represents a heterogeneous family of proteins with apparent molecular weights ranging from 15 to 42 kDa, all of which are related to the well-characterized transcription factor CAAT/enhancer binding protein (C/EBP). This relation-
A.
Stem/d Medlated induction of Anglotenslnogen Gene Expression (in the absence of acute phase Induction)
TAX
I B.
Hormonally-Inducible
Enhancer
InductIon
Unit
Acute Phase Induction of Angiotensinogen Gene Expression
GlUCOCO~tiCOi
(NFkB)
Acute Phase TRX Induction
ILl/TNFa
Fig. 3. Synergistic activation of the angiotensinogen promoter by glucocorticoid receptor (CR), NFkB and members of the C/EBP family of transcription factors. A: Synergism between CR and C/EBP proteins under non-cytokine-induced conditions. B: Replacement of C/EBP proteins by NFkB during the acute-phase response results in further synergistic activation of the angiotensinogen promoter. (Figure modified from that in Brasier et al., 1990b).
ship manifests itself in the following ways: (1) Known C/EBP binding sites compete for binding of members of the BPc family to the APRE. (2) Anti-C/EBP antiserum binds to members of the BPc family. (3) Bacterially-expressed C/EBP heterodimerizes with members of the BPc family. (4) Bacterially-expressed C/EBP binds directly to the APRE. (5) Overexpressing C/EBP in HepG2 cells (by transfecting a viral promoter-driven expression vector encoding the cloned C/EBP cDNA) led to a striking activation of the APRE. Furthermore, the overexpression of C/EBP led to an attenuation of cytokine-mediated activation of the APRE (Brasier et al., 1990a). These experiments provide direct evidence that competition between BPi and BPc for a common binding site results in
Cl02
the modulation gene APRE.
of activity
of the angiotensinogen
Functional interaction between APRE-binding proteins and the ligand-activated glucocorticoid receptor In H35 rat hepatoma cells we noted that the induction of angiotensinogen mRNA levels by cytokines required that the cells be co-stimulated with glucocorticoids. A stably integrated reporter gene plasmid consisting of 615 base pairs of the angiotensinogen promoter fused to a luciferase reporter exhibited similar behavior (Ron et al., 1990b). In transient transfections, however, reporter genes consisting of four copies of the APRE fused to a minimal promoter were inducible by cytokines even in the absence of co-stimulation by glucocorticoids. Furthermore, cytokine induction of BPi binding activity was not dependent on glucocorticoids, suggesting that glucocorticoids are unlikely to exert their permissive effect by facilitating the signal transduction pathway from the cytokine receptor to the activation of BPi. This conclusion is supported by the lack of a glucocorticoid dependence on the cytokine-mediated activation of other genes, such as serum amyloid A protein, interleukin-2 receptor alpha gene, and human immunodeficiency virus, where responsiveness to cytokines is mediated by the binding of an NFkB-like factor (Bohnlein et al., 1988; Edbrooke et al., 1989; Osbourne et al., 1989). The architecture of the rat angiotensinogen promoter, in which the APRE is flanked by two glucocorticoid-response element (GRE) motifs, suggested to us the possibility that glucocorticoid dependence of angiotensinogen gene cytokine responsiveness is a consequence of this particular arrangement (Fig. 2). To address the role of the two GREs in glucocorticoid activation of angiotensinogen gene transcription, we constructed a reporter plasmid incorporating the angiotensinogen gene sequences spanning the GREs and the APRE, as well as a series of mutant reporter constructs in which either one or both of the GREs were altered by the introduction of discrete point-mutations that affect glucocorticoid receptor binding. In preliminary cell culture studies we found that to obtain dexamethasone responsive-
ness in the HepG2 cell line we needed to express the glucocorticoid receptor by co-transfecting an expression plasmid encoding the receptor (Brasier et al., 1990b). In transient transfection experiments into glucocorticoid receptor-complemented HepG2 cells we found that both GRE elements were necessary for full glucocorticoid inducibility of the reporter gene. The downstream GRE plays an ancillary role in glucocorticoid inducibility, limited to synergizing with the upstream GRE; in the absence of the downstream element, glucocorticoid inducibility is diminished but not lost, whereas mutations of the upstream GRE lead to a loss of all glucocorticoid inducibility. Both elements bind glucocorticoid receptor in vitro, and are capable, when fused upstream of a minimal promoter, of activating transcription in a hormone dependent manner (Brasier et al., 1990b). Consistent with the results obtained with the endogenous angiotensinogen gene in H35 cells the same reporter plasmid was responsive to interleukin-1 or tumor necrosis factor only if the transfected cells were co-stimulated with dexamethasone (Ron et al., 1990b). Mutations of either one of the two GREs (resulting in a striking fall in dexamethasone-stimulated reporter gene activity) had no effect on the extent of cytokine inducibility of the gene, which still remained glucocorticoid-depenent. This finding suggests a functional redundancy of the two GREs in their permissive actions on cytokine inducibility of angiotensinogen gene transcription. When mutations were introduced into both GREs, however, there was a striking loss of cytokine inducibility (Ron et al., 1990b). These observations suggest a model in which the glucocorticoid dependence of cytokine activation of the angiotensinogen gene is a consequence of an inability of the single copy APRE to activate transcription from the distantly located promoter (Fig. 3). As is the case for many other enhancers, the activity of NFkB-binding sites is dependent on number of copies of the protein-binding site as well as their distance from the transcription startsite (Pierce et al., 1988). In concert with ligandactivated glucocorticoid receptor, bound at either one of the two adjacent GREs, the APRE becomes able to activate transcription in a cytokinedependent manner. This model is consistent with
Cl03
the well-established capacity of GREs to unmask the latent activity of adjacent ‘dormant’ enhancers (Cordingly et al., 1987; Schule et al., 1988; Strahle et al., 1988). Thus the angiotensinogen gene APRE appears to function within the context of a larger DNA regulatory element: the ‘ hormonally-inducible enhancer unit’ that also contains the two GREs (Fig. 2). The modular structure of this ‘hormonally-inducible enhancer unit’, vis-a-vis the responsiveness of the angiotensinogen gene to cytokines, led us to question whether or not the proteins binding to the APRE under non-cytokine induced conditions might also play a role in the glucocorticoid inducibility of the gene. Analysis of the transcriptional activity of mutant APREs fused to a minimal promoter demonstrated that both BPi and BPc were also activators of the APRE in uninduced nuclei (Brasier et al., 1990a). To address the potential role of these two proteins in regulating the glucocorticoid responsiveness of the angiotensinogen gene we constructed reporter plasmids in which the APRE in the angiotensinogen promoter had been mutated to create an enhancer that selectivity bound BPi, BPc, or neither protein. When transfected into glucocorticoid receptorcomplemented HepG2 cells mutant reporter genes that bound selectivity BPi or BPc were fully inducible by glucocorticoids. However, a mutation that abolished both BPi and BPc binding led to a significant (Cfold) loss of glucocorticoid inducibility (Brasier, 1990b). These findings indicate that the transcriptional activators that bind to the APRE are capable of a productive interaction with adjacently-bound ligand-activated glucocorticoid receptors. This interaction is, in turn, necessary to manifest the full glucocorticoid induction of transcription of the angiotensinogen gene. Functional implications hle enhancer unit
of the hormonally-induci-
The interdependence of the transcriptional activities of the APRE and the two GREs of potential importance to the regulation of angiotensinogen gene expression under a variety of physiological conditions. The identified ‘ hormonally-inducible enhancer unit’ of the APRE and two GREs
functions at the level of the regulation of angiotensinogen gene transcription as an integrator of signals transmitted through two distinct signaling pathways. Cytokine induction of hepatic angiotensinogen gene transcription will occur if, and only if, glucocorticoid receptors are concomitantly activated. This limits the cytokine-mediated activation of angiotensinogen gene to circumstances in which both pathways are simultaneously activated, such as during the acute-phase response. Thus we note the convergence of information from two interrelated stress-response pathways (the hypothalamic-pituitary-adrenal axis and the network of inflammatory cytokines) on the angiotensinogen gene ‘ hormonally-inducible enhancer unit’ (Fig. 1). This convergence results in an adaptive increase in the production of renin substrate allowing its rapid consumption. Dependence of the response to cytokines on glucocorticoids distinguishes angiotensinogen from many other acute-phase response genes. At the level of the organization of the promoter genes responsive to cytokines in the absence of additional stimuli contain either a multiplicity of NFkB sites (such as can be found in the serum amyloid A protein gene (Edbrooke et al., 1989) and the human immunodeficiency virus long terminal repeat (Nabel and Baltimore, 1988)) or have these sites positioned very close to the transcription start-site (as exemplified by the interferon-beta gene (Fan and Maniatis, 1989)). In contrast, the single copy rat angiotensinogen gene NFkB-binding APRE is unusual in its relatively long distance from the major transcription startsite. Thus it appears that different topological organizations of functionally interchangeable regulatory-protein binding sites within the promoter can give rise to networks of genes that are differentially regulated by similar, if not identical, physiological events. The dependence of a full glucocorticoid inducibility of the transcription of the angiotensinogen gene on the activity of the APRE represents a facet of the functional importance of the modularity of the angiotensinogen ‘ hormonally-inducible enhancer unit’. In non-cytokine-stimulated cells the APRE is bound by BPc’s members of a C/EBP-like family of transcription factors. In liver and adipose tissue expression of members of this
Cl0 4
family is regulated in a developmental stagespecific manner (Birkenmeier et al., 1989; Mueller et al., 1990). We have observed differences in the pattern of BPc’s present in various tissues when nuclear extracts have been studied by EMSA. These findings suggest the possibility that the APRE is occupied by functionally distinct proteins in different cell types and that the ‘hormonally-inducible enhancer unit’ integrates developmental (i.e., cell-type specific) as well as hormonal signals at the level of the activation of angiotensinogen gene transcription. Acknowledgements We thank Kathryn A. Wright and James E. Tate for expert experimental assistance and Townley Freeman for preparation of the manuscript. References Akira, S., Hirano, T., Taga, T. and Kishimoto, T. (1990) FASEB .I. 4, 2860-2867. Baeuerle, P.A. and Baltimore, D. (1989) Genes Dev. 3, 16891698. Baumann, H. (1989) In Vitro Cell. Dev. Biol. 25, 115-126. Beaty, O., Sioop, C.H. S&mid, H.E. and Buckalow, V.M. (1976) Am. J. Physiol. 231, 1300-1307. Ben Ari, E.T. and Garrison, J.C. (1988) Am. J. Physiol. 255, E70-E79. Besedovsky, H., Del Rey, A., Sorkin, E. and Dinarello, C.A. (1986) Science 233, 652-654. Birkenmeier, E.H., Gwyenn, B., Howard, S., Jerry, J., Gordon, J.I., Landschulz, W.H. and M&night, S.L. (1989) Genes Dev. 3, 1146-1156. Bohnlein, E., Lowenthal, J.W., Siekevitz, M., Ballard, D.W., Franza, B.R. and Green, W.C. (1988) Cell 53, 827-836. Bouhnik, J., Savoie, F. and Corvol, P. (1988) B&hem. Pharmacol. 37, 1099-1102. Brasier, A.R., Philippe, J., Campbell, D.J. and Habener, J.F. (1986a) J. Biol. Chem. 261, 16148-16154. Brasier, A.R., Philippe, J., Campbell, D.J. and Habener, J.F. (1986b) Trans. Assoc. Am. Phys. 49, 13-19.
Brasier, A.R., Tate, J.E., Ron, D. and Habener, J.F. (1989) Mol. Endocrinol. 3, 1022-1034. Brasier, A.R., Ron, D., Tate, J.E. and Habener, J.F. (1990a) EMBO. J. (in press). Brasier, A.R., Ron, D., Tate, J.E. and Habener, J.F. (1990b) Mol. Endocrinol. (in press). Campbell, D.J. and Habener, J.F. (1986) J. Clin. Invest. 78, 31-39. Chang, E. and Perlman, A.J. (1987) Endocrinology 121, 513519. Clouston, W.M., Lyons, LG. and Richards, RI. (1989) EMBO J. 8, 3337-3343. Cordingly, M.G., Riegel, A.T. and Hager, G.L. (1987) Cell 48, 261-270. Dzau, V.J. and Hermann, H.C. (1982) Life Sci. 30, 577-584. Edbrooke, M.R., Burt, D.W., Cheshire, J.K. and Woo, P. (1989) Mol. Cell. Biol. 9, 1908-1916. Fan, C.M. and Maniatis, J.T. (1989) EMBO J. 8, 101-110. Kageyama, R., Ohkubu, H. and Nakanishi, S. (1985) Biochem. Biophys. Res. Commun. 129, 826-832. Lenardo, M.J. and Baltimore, D. (1989) Cell 58, 227-229. Mueller, C.R., Marie, P. and Schibler, U. (1990) Cell 61, 279-291. Nabel, G. and Baltimore, D. (1987) Nature 326, 711-713. Ohkubo, H., Kawakami, H., Kakehi, Y., Takumi, T., Arai, H., Yokota, Y., lwai, M., Tanabe, Y., Masu, M., Hata, J., Iwao, H., Okamoto, H., Yokoyama, M., Nomura, T., Katsuki, M. and Nakanishi, S. (1990) Proc. Natl. Acad. Sci. U.S.A. 87, 5153-5157. Osboume, L., Kunkel, S. and Nabel, G.J. (1989) Proc. Natl. Acad. Sci. U.S.A. 86, 2336-2340. Pierce, J.W., Lenardo, M. and Baltimore, D. (1988) Proc. Natl. Acad. Sci. U.S.A. 85, 1482-1486. Reid, LA., Morris, B.J. and Ganong, W.F. (1978) Annu. Rev. Physiol. 40, 377-410. Ron, D., Brasier, A.R., Wright, K.W. and Habener, J.F. (1990a) Mol. Cell. Biol. 10, 4389-4395. Ron, D., Brasier, A.R., Wright, K.A., Tate, J.E. and Habener, J.F. (1990b) Mol. Cell. Biol. 10, 1023-1032. Schule, R., Muller, M., Kaltschmidt, C. and Renkawitz, R. (1988) Science 242, 1418-1420. Sen, R. and Baltimore, D. (1986) Cell 47, 921-928. StrahIe, U., Schmid, W. and Schutz, G. (1988) EMBO J. 7, 3389-3395.
