The official journal of INTERNATIONAL FEDERATION OF PIGMENT CELL SOCIETIES · SOCIETY FOR MELANOMA RESEARCH
PIGMENT CELL & MELANOMA Research Transcriptome sequencing of melanocytic nevi and melanomas from Grm1 transgenic mice to determine melanoma driver mutations Miriam M. de Jel, Julia C. Engelmann, Manfred Kunz, Susanne Schiffner, Silke Kuphal and Anja K. Bosserhoff
DOI: 10.1111/pcmr.12244 Volume 27, Issue 4, Pages 678–680 If you wish to order reprints of this article, please see the guidelines here
EMAIL ALERTS Receive free email alerts and stay up-to-date on what is published in Pigment Cell & Melanoma Research – click here
Submit your next paper to PCMR online at http://mc.manuscriptcentral.com/pcmr
Subscribe to PCMR and stay up-to-date with the only journal committed to publishing basic research in melanoma and pigment cell biology As a member of the IFPCS or the SMR you automatically get online access to PCMR. Sign up as a member today at www.ifpcs.org or at www.societymelanomaresarch.org
To take out a personal subscription, please click here More information about Pigment Cell & Melanoma Research at www.pigment.org
Pigment Cell Melanoma Res. 27; 678–680
LETTER TO THE EDITOR
Transcriptome sequencing of melanocytic nevi and melanomas from Grm1 transgenic mice to determine melanoma driver mutations Miriam M. de Jel1, Julia C. Engelmann2, Manfred Kunz3, Susanne Schiffner1, Silke Kuphal1 and Anja K. Bosserhoff1 1 Institute of Pathology, Molecular Pathology, University of Regensburg, Regensburg, Germany 2 Institute for Functional Genomics, Statistical Bioinformatics, Regensburg, Germany 3 Department of Dermatology, Venereology and Allergology, University of Leipzig, Leipzig, Germany Correspondence Anja K. Bosserhoff, e-mail: anja.bosserhoff@klinik. uni-regensburg.de
doi: 10.1111/pcmr.12244
Dear Editor, Malignant melanoma is thought to exhibit a high base mutation rate compared with other solid tumors. Therefore, there is a strong interest in discovering new mutations and understanding their impact on melanoma pathogenesis. Mutations in several genes such as BRAF, NRAS, or KIT are associated with melanoma development and progression. The most common BRAF mutation, BRAF V600E, results in the constitutive activation of MAPK/ERK signaling in the tumor cells affecting cell division and differentiation. Moreover, previous studies have shown that allele variations of the CDKN2A gene and OCA2 gene are associated with melanoma susceptibility. Recently, two new driver mutations of malignant melanoma were discovered, both are located in the promoter region of the telomerase enzyme TERT (Huang et al., 2013). Approximately 71% of the examined melanomas harbor these mutations, making them even more frequent than the most common BRAF mutation. Furthermore, by analyzing 147 primary and metastatic melanoma samples, Krauthammer et al. (2012) detected more than 26 000 mutations. These findings reveal the high mutation potential of this tumor and emphasize the importance of understanding the role of mutations in melanoma development. The aim of our investigation was to identify additional melanoma-associated mutations by analyzing benign melanocytic nevus and melanoma samples from the transgenic mouse line Tg(Grm1)EPv. These transgenic mice spontaneously develop melanomas due to an aberrant expression of Grm1. In this strain of mice, the
678
metabotropic glutamate receptor 1 is under the control of the melanocyte-specific Dct-promoter, causing dermal lesions with melanin overproduction (Pollock et al., 2003; Schiffner et al., 2012). To detect novel mutations in malignant melanoma, we analyzed two nevi and two tumor samples (based on histology and staining for proliferation marker) from the transgenic line using transcriptome sequencing. Four poly-A RNA sequence libraries were generated: two from nevus material and two from tumor material. Single-end reads of 100 bp were sequenced at the Center of Excellence for Fluorescent Bioanalytics (KFB) (Regensburg, Germany; http://www.kfb-regensburg.de) with HiScanSQ (TruSeq SBS kit v3; Illumina, San Diego, CA, USA) technology from Illumina. We obtained on average 17.4 million reads per sample, which were then aligned to the mouse reference genome mm9 (NCBI37) from UCSC (University of California, Santa Cruz, CA, USA) using TopHat2 (Kim et al., 2013) with the default parameters. The overall alignment rate was on average 80.5% of the reads per sample. SAMtools (Li et al., 2009) was used to sort and index the alignment files and to generate pileup files with base pair information for each chromosomal position (using function ‘mpileup’). VarScan2 (Koboldt et al., 2012) was then used to call somatic variants in the tumor samples, requiring a coverage of at least 10 reads in both the tumor and normal sample, a minimum variation frequency of 0.1, and a minimum number of variation reads of 2. Annotation data for mm9 were downloaded from UCSC, on Sep 28, 2012, to focus on single nucleotide variations in coding regions. The sequence data are publicly available at NCBI’s Short Read Archive under accession PRJNA237546. Through this analysis, three chromosomal positions with somatic alterations in both tumor samples were identified but none of them is listed in the dbSNP (Single Nucleotide Polymorphism database) build 128 for mm9. These allele variations affected the Fam53b, Stat6, and Gm15725 genes (Table 1). While the nucleotide substitutions in Fam53b and Gm15725 did not alter the protein sequence, the mutation in Stat6 (signal transducer and activator of transcription 6) resulted in an amino acid exchange from phenylalanine to leucine (F41L). Interestingly, the position F41 in the Stat6 gene is highly conserved between species.
ª 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd
Letter to the Editor
C
C/G
G
indicate that this nucleotide variation is not linked with melanoma progression. Interestingly, mutations that had been described in melanomas by previous studies were not detected in our mouse model using transcriptome sequencing. Therefore, we manually analyzed the common mutated positions in melanoma-associated genes using the Integrative ttir et al., 2012) to ensure Genomics Viewer (Thorvaldsdo that they truly held no variation and did not merely fail to be identified using the substitution frequency. Sequences for the NRAS, KIT, OCA2, and RAC1 genes displayed high quality but no variations. Additionally, analyses of the BRAF sequences revealed that neither nevus nor tumor samples carried the V600E mutation. The earlier described mutation in the CDKN2A promoter (Liu et al., 1999) could not be validated with the present transcriptome sequencing approach. Hence, we speculate that no additional coding mutations in specific genes seem to be necessary in the transgenic mouse line Tg(Grm1)EPv for melanoma development. Here, epigenetic events and variations in gene expression appear to be more important.
50% (n = 4) 16.7% (n = 1)
50% (n = 4) 50% (n = 3)
0% (n = 0) 33.3% (n = 2)
Acknowledgements
Table 1. Summary of NGS analysis
Gene
Nucleotide substitution
Amino acid change
Mutation localization
Fam53b Stat6 Gm15725
G?A c.C123G A?G
No p.F41L No
50 UTR Exonic Exonic
Table 2. Primers used for PCR and Sanger sequencing
Sequence (50 ?30 )
TM
CCCCAGAAAAACTGCAACGG GTTTCCCTTCCCCTGCTCTC
59.97 60.03
Product length (bp) 194
Table 3. Summary of sequencing data
Nevi Melanomas
The role of Stat6 in cancer progression is not fully understood and remains controversial. On the one hand, Stat6 seems to induce apoptosis in human breast cancer cells (Gooch et al., 2002). On the other hand, the downregulation of Stat6 was reported to induce apoptosis in human prostate cancer (Das et al., 2007). Moreover, Stat6 enhances both cell proliferation and invasion in glioblastomas (Merk et al., 2011). A mutation in the Stat6 gene could therefore enhance its influence on cancer progression. Of the four analyzed samples, one nevus displayed no mutation at the described position, one nevus and one tumor sample were heterozygous, and one tumor sample was homozygous for the variant G allele. To confirm the nucleotide substitution c.C123G identified by transcriptome sequencing, we performed polymerase chain reactions and analyzed the Stat6 sequence of further tissue samples. We selected eight nevus samples and six tumor samples from Tg(Grm1)EPv mice in total. The nevus samples were taken from mice between 36 and 98 days old, and the tumor samples were taken from mice between 155 and 330 days old. The primers used for the polymerase chain reaction and Sanger sequencing are listed in Table 2. Sequencing revealed that half of the nevus samples carried the expected C allele and the other half were heterozygous (C/G) at this locus (Table 3). No nevus sample displayed a homozygous nucleotide substitution C?G. Within the tumor samples, only 16.7% displayed the wild-type allele, 50% were heterozygous, and 33.3% carried the variant G allele. These findings ª 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd
We are indebted to Lisa Ellmann for technical assistance. This study was supported by the Melanoma Research Network of the Deutsche Krebshilfe e.V. (German Cancer Aid) and Bavarian Ministry of Sciences, Research and the Arts in the framework of the Bavarian Molecular Biosystems Research Network (BioSysNet).
References Das, S., Roth, C.P., Wasson, L.M., and Vishwanatha, J.K. (2007). Signal transducer and activator of transcription-6 (STAT6) is a constitutively expressed survival factor in human prostate cancer. Prostate 67, 1550–1564. Gooch, J.L., Christy, B., and Yee, D. (2002). STAT6 mediates interleukin-4 growth inhibition in human breast cancer cells. Neoplasia 4, 324–331. Huang, F.W., Hodis, E., Xu, M.J., Kryukov, G.V., Chin, L., and Garraway, L.A. (2013). Highly recurrent TERT promoter mutations in human melanoma. Science 339, 957–959. Kim, D., Pertea, G., Trapnell, C., Pimentel, H., Kelley, R., and Salzberg, S.L. (2013). TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 14, R36. Koboldt, D.C., Zhang, Q., Larson, D.E., Shen, D., McLellan, M.D., Lin, L., Miller, C.A., Mardis, E.R., Ding, L., and Wilson, R.K. (2012). VarScan 2: somatic mutation and copy number alteration discovery in cancer by exome sequencing. Genome Res. 22, 568– 576. Krauthammer, M., Kong, Y., Ha, B.H. et al. (2012). Exome sequencing identifies recurrent somatic RAC1 mutations in melanoma. Nat. Genet. 44, 1006–1014. Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., and Durbin, R. (2009). The sequence alignment/map format and SAMtools. Bioinformatics 25, 2078– 2079. Liu, L., Dilworth, D., Gao, L., Monzon, J., Summers, A., Lassam, N., and Hogg, D. (1999). Mutation of the CDKN2A 50 UTR creates an
679
Letter to the Editor aberrant initiation codon and predisposes to melanoma. Nat. Genet. 21, 128–132. Merk, B.C., Owens, J.L., Lopes, M.B., Silva, C.M., and Hussaini, I.M. (2011). STAT6 expression in glioblastoma promotes invasive growth. BMC Cancer 11, 184. Pollock, P.M., Cohen-Solal, K., Sood, R. et al. (2003). Melanoma mouse model implicates metabotropic glutamate signaling in melanocytic neoplasia. Nat. Genet. 34, 108–112.
680
Schiffner, S., Chen, S., Becker, J.C., and Bosserhoff, A.K. (2012). Highly pigmented Tg(Grm1) mouse melanoma develops non-pigmented melanoma cells in distant metastases. Exp. Dermatol. 21, 786–788. ttir, H., Robinson, J.T., and Mesirov, J.P. (2012). Thorvaldsdo Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Brief Bioinform 14, 178–192.
ª 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd
PIGMENT CELL & MELANOMA Research Transcriptome sequencing of melanocytic nevi and melanomas from Grm1 transgenic mice to determine melanoma driver mutations Miriam M. de Jel, Julia C. Engelmann, Manfred Kunz, Susanne Schiffner, Silke Kuphal and Anja K. Bosserhoff
DOI: 10.1111/pcmr.12244 Volume 27, Issue 4, Pages 678–680 If you wish to order reprints of this article, please see the guidelines here
EMAIL ALERTS Receive free email alerts and stay up-to-date on what is published in Pigment Cell & Melanoma Research – click here
Submit your next paper to PCMR online at http://mc.manuscriptcentral.com/pcmr
Subscribe to PCMR and stay up-to-date with the only journal committed to publishing basic research in melanoma and pigment cell biology As a member of the IFPCS or the SMR you automatically get online access to PCMR. Sign up as a member today at www.ifpcs.org or at www.societymelanomaresarch.org
To take out a personal subscription, please click here More information about Pigment Cell & Melanoma Research at www.pigment.org
Pigment Cell Melanoma Res. 27; 678–680
LETTER TO THE EDITOR
Transcriptome sequencing of melanocytic nevi and melanomas from Grm1 transgenic mice to determine melanoma driver mutations Miriam M. de Jel1, Julia C. Engelmann2, Manfred Kunz3, Susanne Schiffner1, Silke Kuphal1 and Anja K. Bosserhoff1 1 Institute of Pathology, Molecular Pathology, University of Regensburg, Regensburg, Germany 2 Institute for Functional Genomics, Statistical Bioinformatics, Regensburg, Germany 3 Department of Dermatology, Venereology and Allergology, University of Leipzig, Leipzig, Germany Correspondence Anja K. Bosserhoff, e-mail: anja.bosserhoff@klinik. uni-regensburg.de
doi: 10.1111/pcmr.12244
Dear Editor, Malignant melanoma is thought to exhibit a high base mutation rate compared with other solid tumors. Therefore, there is a strong interest in discovering new mutations and understanding their impact on melanoma pathogenesis. Mutations in several genes such as BRAF, NRAS, or KIT are associated with melanoma development and progression. The most common BRAF mutation, BRAF V600E, results in the constitutive activation of MAPK/ERK signaling in the tumor cells affecting cell division and differentiation. Moreover, previous studies have shown that allele variations of the CDKN2A gene and OCA2 gene are associated with melanoma susceptibility. Recently, two new driver mutations of malignant melanoma were discovered, both are located in the promoter region of the telomerase enzyme TERT (Huang et al., 2013). Approximately 71% of the examined melanomas harbor these mutations, making them even more frequent than the most common BRAF mutation. Furthermore, by analyzing 147 primary and metastatic melanoma samples, Krauthammer et al. (2012) detected more than 26 000 mutations. These findings reveal the high mutation potential of this tumor and emphasize the importance of understanding the role of mutations in melanoma development. The aim of our investigation was to identify additional melanoma-associated mutations by analyzing benign melanocytic nevus and melanoma samples from the transgenic mouse line Tg(Grm1)EPv. These transgenic mice spontaneously develop melanomas due to an aberrant expression of Grm1. In this strain of mice, the
678
metabotropic glutamate receptor 1 is under the control of the melanocyte-specific Dct-promoter, causing dermal lesions with melanin overproduction (Pollock et al., 2003; Schiffner et al., 2012). To detect novel mutations in malignant melanoma, we analyzed two nevi and two tumor samples (based on histology and staining for proliferation marker) from the transgenic line using transcriptome sequencing. Four poly-A RNA sequence libraries were generated: two from nevus material and two from tumor material. Single-end reads of 100 bp were sequenced at the Center of Excellence for Fluorescent Bioanalytics (KFB) (Regensburg, Germany; http://www.kfb-regensburg.de) with HiScanSQ (TruSeq SBS kit v3; Illumina, San Diego, CA, USA) technology from Illumina. We obtained on average 17.4 million reads per sample, which were then aligned to the mouse reference genome mm9 (NCBI37) from UCSC (University of California, Santa Cruz, CA, USA) using TopHat2 (Kim et al., 2013) with the default parameters. The overall alignment rate was on average 80.5% of the reads per sample. SAMtools (Li et al., 2009) was used to sort and index the alignment files and to generate pileup files with base pair information for each chromosomal position (using function ‘mpileup’). VarScan2 (Koboldt et al., 2012) was then used to call somatic variants in the tumor samples, requiring a coverage of at least 10 reads in both the tumor and normal sample, a minimum variation frequency of 0.1, and a minimum number of variation reads of 2. Annotation data for mm9 were downloaded from UCSC, on Sep 28, 2012, to focus on single nucleotide variations in coding regions. The sequence data are publicly available at NCBI’s Short Read Archive under accession PRJNA237546. Through this analysis, three chromosomal positions with somatic alterations in both tumor samples were identified but none of them is listed in the dbSNP (Single Nucleotide Polymorphism database) build 128 for mm9. These allele variations affected the Fam53b, Stat6, and Gm15725 genes (Table 1). While the nucleotide substitutions in Fam53b and Gm15725 did not alter the protein sequence, the mutation in Stat6 (signal transducer and activator of transcription 6) resulted in an amino acid exchange from phenylalanine to leucine (F41L). Interestingly, the position F41 in the Stat6 gene is highly conserved between species.
ª 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd
Letter to the Editor
C
C/G
G
indicate that this nucleotide variation is not linked with melanoma progression. Interestingly, mutations that had been described in melanomas by previous studies were not detected in our mouse model using transcriptome sequencing. Therefore, we manually analyzed the common mutated positions in melanoma-associated genes using the Integrative ttir et al., 2012) to ensure Genomics Viewer (Thorvaldsdo that they truly held no variation and did not merely fail to be identified using the substitution frequency. Sequences for the NRAS, KIT, OCA2, and RAC1 genes displayed high quality but no variations. Additionally, analyses of the BRAF sequences revealed that neither nevus nor tumor samples carried the V600E mutation. The earlier described mutation in the CDKN2A promoter (Liu et al., 1999) could not be validated with the present transcriptome sequencing approach. Hence, we speculate that no additional coding mutations in specific genes seem to be necessary in the transgenic mouse line Tg(Grm1)EPv for melanoma development. Here, epigenetic events and variations in gene expression appear to be more important.
50% (n = 4) 16.7% (n = 1)
50% (n = 4) 50% (n = 3)
0% (n = 0) 33.3% (n = 2)
Acknowledgements
Table 1. Summary of NGS analysis
Gene
Nucleotide substitution
Amino acid change
Mutation localization
Fam53b Stat6 Gm15725
G?A c.C123G A?G
No p.F41L No
50 UTR Exonic Exonic
Table 2. Primers used for PCR and Sanger sequencing
Sequence (50 ?30 )
TM
CCCCAGAAAAACTGCAACGG GTTTCCCTTCCCCTGCTCTC
59.97 60.03
Product length (bp) 194
Table 3. Summary of sequencing data
Nevi Melanomas
The role of Stat6 in cancer progression is not fully understood and remains controversial. On the one hand, Stat6 seems to induce apoptosis in human breast cancer cells (Gooch et al., 2002). On the other hand, the downregulation of Stat6 was reported to induce apoptosis in human prostate cancer (Das et al., 2007). Moreover, Stat6 enhances both cell proliferation and invasion in glioblastomas (Merk et al., 2011). A mutation in the Stat6 gene could therefore enhance its influence on cancer progression. Of the four analyzed samples, one nevus displayed no mutation at the described position, one nevus and one tumor sample were heterozygous, and one tumor sample was homozygous for the variant G allele. To confirm the nucleotide substitution c.C123G identified by transcriptome sequencing, we performed polymerase chain reactions and analyzed the Stat6 sequence of further tissue samples. We selected eight nevus samples and six tumor samples from Tg(Grm1)EPv mice in total. The nevus samples were taken from mice between 36 and 98 days old, and the tumor samples were taken from mice between 155 and 330 days old. The primers used for the polymerase chain reaction and Sanger sequencing are listed in Table 2. Sequencing revealed that half of the nevus samples carried the expected C allele and the other half were heterozygous (C/G) at this locus (Table 3). No nevus sample displayed a homozygous nucleotide substitution C?G. Within the tumor samples, only 16.7% displayed the wild-type allele, 50% were heterozygous, and 33.3% carried the variant G allele. These findings ª 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd
We are indebted to Lisa Ellmann for technical assistance. This study was supported by the Melanoma Research Network of the Deutsche Krebshilfe e.V. (German Cancer Aid) and Bavarian Ministry of Sciences, Research and the Arts in the framework of the Bavarian Molecular Biosystems Research Network (BioSysNet).
References Das, S., Roth, C.P., Wasson, L.M., and Vishwanatha, J.K. (2007). Signal transducer and activator of transcription-6 (STAT6) is a constitutively expressed survival factor in human prostate cancer. Prostate 67, 1550–1564. Gooch, J.L., Christy, B., and Yee, D. (2002). STAT6 mediates interleukin-4 growth inhibition in human breast cancer cells. Neoplasia 4, 324–331. Huang, F.W., Hodis, E., Xu, M.J., Kryukov, G.V., Chin, L., and Garraway, L.A. (2013). Highly recurrent TERT promoter mutations in human melanoma. Science 339, 957–959. Kim, D., Pertea, G., Trapnell, C., Pimentel, H., Kelley, R., and Salzberg, S.L. (2013). TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 14, R36. Koboldt, D.C., Zhang, Q., Larson, D.E., Shen, D., McLellan, M.D., Lin, L., Miller, C.A., Mardis, E.R., Ding, L., and Wilson, R.K. (2012). VarScan 2: somatic mutation and copy number alteration discovery in cancer by exome sequencing. Genome Res. 22, 568– 576. Krauthammer, M., Kong, Y., Ha, B.H. et al. (2012). Exome sequencing identifies recurrent somatic RAC1 mutations in melanoma. Nat. Genet. 44, 1006–1014. Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., and Durbin, R. (2009). The sequence alignment/map format and SAMtools. Bioinformatics 25, 2078– 2079. Liu, L., Dilworth, D., Gao, L., Monzon, J., Summers, A., Lassam, N., and Hogg, D. (1999). Mutation of the CDKN2A 50 UTR creates an
679
Letter to the Editor aberrant initiation codon and predisposes to melanoma. Nat. Genet. 21, 128–132. Merk, B.C., Owens, J.L., Lopes, M.B., Silva, C.M., and Hussaini, I.M. (2011). STAT6 expression in glioblastoma promotes invasive growth. BMC Cancer 11, 184. Pollock, P.M., Cohen-Solal, K., Sood, R. et al. (2003). Melanoma mouse model implicates metabotropic glutamate signaling in melanocytic neoplasia. Nat. Genet. 34, 108–112.
680
Schiffner, S., Chen, S., Becker, J.C., and Bosserhoff, A.K. (2012). Highly pigmented Tg(Grm1) mouse melanoma develops non-pigmented melanoma cells in distant metastases. Exp. Dermatol. 21, 786–788. ttir, H., Robinson, J.T., and Mesirov, J.P. (2012). Thorvaldsdo Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Brief Bioinform 14, 178–192.
ª 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd
