Biometals DOI 10.1007/s10534-014-9746-3
Transcriptomic profiling of intestinal epithelial cells in response to human, bovine and commercial bovine lactoferrins Rulan Jiang • Bo Lo¨nnerdal
Received: 9 April 2014 / Accepted: 26 April 2014 Ó Springer Science+Business Media New York 2014
Abstract Lactoferrin (Lf) is an iron-binding glycoprotein present in high concentration in human milk. It is a pleiotropic protein and involved in diverse bioactivities, such as stimulation of cell proliferation and immunomodulatory activities. Lf is partly resistant to proteolysis in the gastrointestinal tract. Thus, Lf may play important roles in intestinal development. Due to differences in amino acid sequences and isolation methods, Lfs from human and bovine milk as well as commercially available bovine Lf (CbLf) may differ functionally or exert their functions via various mechanisms. To provide a potential basis for further applications of CbLf, we compared effects of Lfs on intestinal transcriptomic profiling using an intestinal epithelial cell model, human intestinal epithelial crypt-like cells (HIEC). All Lfs significantly stimulated proliferation of HIEC and no significant differences were found among these three proteins. Microarray assays were used to investigate transcriptomic profiling of intestinal epithelial cells in response to Lfs. Selected genes were verified by RT-PCR with a high validation rate. Genes significantly regulated by hLf, bLf, and CbLf were 150, 395 and 453, respectively. Fifty-four genes were significantly regulated by both hLf and CbLf, whereas 129 genes were
R. Jiang B. Lo¨nnerdal (&) Department of Nutrition, University of California, Davis, CA 95616, USA e-mail: [email protected]
significantly modulated by bLf and CbLf. Although only a limited number of genes were regulated by all Lfs, the three Lfs positively influenced cellular development and immune functions based on pathway analysis using IPA (Ingenuity). Lfs stimulate cellular and intestinal development and immune functions via various signaling pathways, such as Wnt/b-catenin signaling, interferon signaling and IL-8 signaling. Keywords Human lactoferrin Bovine lactoferrin Cell proliferation Immune function
Introduction Lactoferrin (Lf) is an iron binding glycoprotein with a molecular weight of 80 kDa. It is present in mammalian milk and particularly abundant in human colostrum and milk, with concentrations ranging from 1 to 6 g/L (Lo¨nnerdal and Iyer 1995). The concentration of Lf in milk differs significantly among species. For example, it is high in pigs and mice, but low in cows with only 1.5 mg/L in colostrum and 0.5 mg/L in mature milk (Marshall 2004). It is also present in biological fluids, including amniotic fluid, saliva, tears, pancreatic fluid, bile, mucosal and gastrointestinal secretions and secondary granules of neutrophils (Lo¨nnerdal and Iyer 1995). Lf survives gastrointestinal digestion as revealed by both in vivo and in vitro
123
Biometals
studies (Davidson and Lo¨nnerdal 1987; Lonnerdal et al. 2011; Spik et al. 1982). Due to the high concentration of Lf in milk and its resistance to proteolysis, Lf may play important roles in intestinal development. Lf is a multifunctional protein and involved in promotion of cell proliferation and differentiation as well as bone growth, immunomodulatory activities, antimicrobial and antioxidant actions (Legrand et al. 2008; Lo¨nnerdal and Iyer 1995). Generally, Lf exerts its multiple functions via two mechanisms: Lf binds to its receptor on the cell membrane and then activate signaling transduction (Jiang and Lo¨nnerdal 2012) or act as a transcriptional factor to transactivate the expression of genes (He and Furmanski 1995), such as IL-1 beta (Son et al. 2002) and Skp1 (Mariller et al. 2007). Accumulating evidence indicates that Lf stimulate growth of the intestine. A mitogenic effect of Lf on the intestine was reported for crypt cells isolated from rats (Nichols et al. 1987), human intestinal epithelial cells (Caco-2) (Buccigrossi et al. 2007), mouse pups fed by hLf transgenic mice (Zhang et al. 2001) and piglets fed milk from hLf transgenic cattle (Cooper et al. 2013). Lf has beneficial effects on function and development of the immune system. It protects the intestine and the whole body against inflammation and infection via modulating cytokine secretion (Kuhara et al. 2014, 2006) and changing leukocyte populations (Cooper et al. 2013) as well as activities (Kuhara et al. 2006). Moreover, Lf exerts anti-microbial activities in the intestinal lumen (Tian et al. 2010). Human Lf (hLf) and bovine Lf (bLf) share 69 % amino acid identity (Lonnerdal et al. 2011) and bLf is commercially available. Due to differences in amino acid sequences and processing procedures, hLf, bLf and commercially available bLf (CbLf) may differ functionally. Non-transformed human crypt intestinal epithelial cells (HIEC) were isolated from fetal intestines at 14–20 weeks of gestation and express a number of intestinal crypt but not villus cell markers (Levy et al. 2000). The microarray assay is a powerful tool to identify large lists of genes simultaneously relevant to various treatments (Papp et al. 2012). To investigate effects of Lf on intestinal development, HIEC were treated with hLf, bLf and CbLf and the transcriptomic profiling of intestinal epithelial cells in response to Lfs was evaluated by microarray assays.
123
Materials and methods Cell culture Non-transformed HIEC (a gift from Dr. Jean-Franc¸ois Beaulieu, Universite´ de Sherbrooke) were maintained in a humidified incubator at 37 °C under an atmosphere of 5 % CO2 in Opti-MEM (Life Technologies Inc., Gaithersburg, MD, USA) supplemented with fetal bovine serum (FBS, 5 %, MP Biomedicals), GlutaMax (1 %, Gibco) and epidermal growth factor (EGF, 5 ng/mL, R&D Systems, Minneapolis, MN). Cells between passages 18–24 were harvested at 90 % confluence and medium was changed every other day. Preparation of Lfs Preparation of human and bovine Lfs from milk was described previously (Lonnerdal et al. 2011). CbLf was obtained from FrieslandCampina Domo (Amersfoort, the Netherlands) and dissolved in phosphate buffered saline (PBS) at a concentration similar to concentrated hLf and bLf. Immunoblotting After HIEC were treated with or without Lfs (50 lg/ mL) in 6- well (2.2 9 104/cm2) plates for two days, HIEC were lysed in homogenization buffer (20 mM Tris–HCl, pH 7.5, 150 mM NaCl, 1 mM EGTA, 1 % Triton X-100, Halt protease and phosphatase inhibitor cocktail, Thermo Scientific), sonicated briefly and centrifuged at 5009g for 10 min at 4 °C. Protein concentration was measured with the Bradford assay. Proteins (50 lg/lane) were boiled for 5 min in Laemmli sample buffer (Bio-Rad, Hercules, CA, USA) with b-mercaptoethanol (5 %, Sigma) and then separated by SDS–PAGE and transferred to a nitrocellulose membrane. The membrane was incubated in blocking buffer (5 % skim milk in PBST: 0.1 % Tween-20 in PBS) for 45 min at room temperature, washed three times with PBST and then probed with an antibody specific for human LfR which was described previously (Lopez et al. 2008) (rabbit antiLfR, 1 lg/mL) or phospho-b-catenin antibody (1:1,000, Ser33/37/Thr41, Cell Signaling, Danvers, MA, #9561) or b-catenin antibody (1:1,000, Cell Signaling, #9562) in blocking buffer for 45 min at room temperature. After three washes with PBST,
Biometals
primary antibodies were detected with horseradish peroxidase (HRP)-conjugated donkey anti-rabbit IgG (1:20,000, Amersham Pharmacia Biotech) in blocking buffer for 45 min. Bands were visualized with ECL Plus Substrate (GE Healthcare, Piscataway, NJ, USA) after a final wash (30 min wash with PBST). Proliferation assay To determine the effects of Lfs on cellular proliferation of intestinal epithelial cells, HIEC were grown on 96-well plates (2.2 9 104/cm2). Cells were incubated in cell culture medium with FBS (2 %, n = 6 samples/treatment) containing hLf, bLf and CbLf (1, 2, 4, 8, 10, 20 and 50 lg/mL), and effects of Lfs on cell proliferation were evaluated using a bromodeoxyuridine (BrdU) kit (Roche, Indianapolis, IN, USA) following the manufacturer’s instructions. Confocal fluorescence microscopy HIEC cells were seeded and grown on Lab-TekII chambered slides (Nalge Nunc International, Naperville, IL, USA) overnight. After cells were treated with Lfs (50 lg/mL) in serum free medium (SFM) for 30 min at 37 °C, cells were rinsed with PBS, fixed with phosphate-buffered paraformaldehyde (4 %, 0.4 mL/ well) for 10 min at room temperature and then permeabilized with Triton X-100 (0.2 %) in PBS for 10 min. Cells were then blocked with blocking buffer (5 % heat-inactivated rabbit serum and 1 % BSA in PBS, 0.5 mL/well) for 20 min. After the blocking buffer was removed, cells were rinsed with PBS and Lf was probed with rabbit anti-hLf (2 lg/mL, Abcam, Cambridge, MA) or goat anti-bLf (2 lg/mL, Bethyl Laboratories, Montgomery, TX, USA) and then Alexa 488-conjugated-anti-rabbit or Alexa 488-conjugatedanti-goat IgG (1 lg/mL; Molecular Probes, Eugene, OR, USA) in blocking buffer for 30 min. After several rinses, cells were rinsed with PBS and Lf was probed with rabbit anti-LfR (2 lg/mL) and then Alexa 647-conjugated-anti-rabbit (1 lg/mL; Molecular Probes, Eugene, OR, USA) in blocking buffer for 30 min. Coverslips were subsequently mounted with ProLong Gold Antifade Reagent (Invitrogen Molecular Probes) and sealed with nail polish. Non-specific binding was evaluated by using only secondary antibodies. A confocal laser scanning microscope (FV1000, Olympus America, Inc., Melville, NY,
USA) was used to perform immunofluorescence imaging and image analysis software systems (Olympus America, Inc.) were used to analyze the images. RNA extraction and array hybridization HIEC (6-well plate, 2.2 9 104/cm2) were grown for 24 h and then treated with Lfs (50 lg/mL) for 24 h. RNA was extracted with Trizol (Invitrogen) and then purified by an RNease kit (Qiagen) according to the manufacturer’s instructions. Measurement of RNA yield was performed using a NanoDrop 1000A Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) and RNA quality was verified using Bioanalyzer RNA Nano Chips (Agilent Technologies, Inc., Santa Clara, CA, USA) following the manufacturer’s procedure. Total RNA samples were amplified and labeled with biotinylated nucleotides using a kit from Ambion (TotalPrep -96 RNA Amplification Kit). Bioanalyzer analysis was then performed to verify if cRNA was at the expected 1.2 kb average size before applying to beadchips (HumanHT-12 v.4.0, Illumina, San Diego, USA). Beadchips were scanned with the Illumina iScan using standard conditions. Microarray data analysis GenomeStudio (Illumina) was used for microarray data analysis and rank invariant normalization was conducted to normalize the microarray data. Only probe sets with adjusted p value less than 0.05 were selected for subsequent analysis and a total of 13,716 genes were analyzed. Differentially expressed genes were selected following two criteria: fold-change C1.5 for up-regulation, fold-change B0.5 (represents as -2.0) for down-regulation. Pathway analysis was conducted using IPA (IngenuityÒ Systems, Mountain View, CA, USA) and the Core analysis included in IPA was used to interpret data in the context of biological processes, pathways, and networks. Quantitative real-time PCR RNA (1 lg) extracted for microarray assays was reverse-transcribed to cDNA using a high-capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, USA) following the manufacturer’s instructions. Gene-specific primers are listed in Table 1. Real-time polymerase chain reaction (RT-
123
Biometals Table 1 Primers for real-time PCR Primers
Sequence
IGF1R forward
AAGCCTCACCCTCTCTTTCC
IGF1R reverse
TGCCTAGTGTCTGCGGTTAA
IL8 forward IL8 reverse
TAGCCAGGATCCACAAGTCC TGTGAGGTAAGATGGTGGCT
MX1 forward
AGTCCGTCTCTGCTTATCCG
MX1 reverse
GGGGCTCTGTCTTCATGCTA
LRP1 forward
ATTGTGGAAAACGTGGGCTC
LRP1 reverse
TGGTGGATGTCGTGTAGCTT
IGFBP3 forward
CACAGCACCCAGACTTCATG
IGFBP3 reverse
CAGCCGCCTAAGTCACAAAG
PCR) was performed on the cDNA reaction mixture (2 lL) and SYBR Green (Thermo Scientific) using the iCycler real-time PCR system (Bio-Rad). The cycling parameters were 95 °C 15 min and 40 cycles including 95 °C for 15 s, 60 °C for 30 s and 72 °C for 30 s. Linearity of the dissociation curve was analyzed using the iCycler software, and the mean cycle time of the linear part of the curve was designated as Ct. Each sample was analyzed in triplicate and normalized to GAPDH using the following equation: fold change = 2(Ct Gene- Ct GAPDH). Values are shown as mean fold change ± standard deviation, relative to control (set to 1). Statistical analysis Data represent means ± standard deviations from 2 to 3 independent experiments. Comparisons between treatments and the control were conducted using Student’s t test or one-way ANOVA (Prism Graph Pad, Berkeley, CA, USA). p \ 0.05 was considered to be statistically significant.
Results Internalization of Lf by HIEC We have previously demonstrated that internalization of Lf by intestinal epithelial cells is partly LfR dependent (Jiang et al. 2011). Therefore, we first examined if HIEC expressed intestinal LfR. As shown in Fig. 1a, HIEC expressed two forms of LfR, with molecular weights of 35 and 105 kD. We next used
123
confocal microscopy to examine cellular localization of LfR as well as investigate if Lfs were able to be internalized by HIEC and if LfR mediated the internalization. As shown in Fig. 1b, LfR localized to the plasma membrane of HIEC and all three Lfs were internalized by HIEC. LfR mediated the internalization of Lfs as revealed by co-localization of Lf and LfR. No significant differences were observed in the post-internalization fate of the three Lfs. Effects of Lfs on proliferation of HIEC Proliferative effects of Lf on intestinal cells have been documented previously (Buccigrossi et al. 2007; Jiang et al. 2011). To determine effects of Lfs on proliferation of HIEC, after HIEC were treated with serial concentrations of Lfs (1–50 lg/L) for 24 h, the proliferation effect was evaluated with a BrdU kit. Starting from 4 lg/L, all Lfs exhibited proliferative effects, no differences were found among the three Lfs, and the effects were not significantly concentration dependent. Therefore, Fig. 2 only shows the effects of one concentration of Lf (50 lg/mL) on intestinal proliferation. As shown in Fig. 2, all Lfs significantly stimulated proliferation of HIEC. Validation of microarray results by real-time PCR Based on the results from proliferation assays, HIEC were treated with Lfs for 24 h and RNA was then extracted for microarray assays as described in the ‘‘Materials and methods’’ section. After obtaining the microarray results, real-time PCR was performed to verify the microarray results (Fig. 3). Five genes, IGG1R, IL8, MX1, LRP1 and IGFBP3, were randomly chosen for real-time PCR analysis. The results for these five genes were consistent with results from the microarrays (Fig. 3) and the R-value of association analysis was 0.95. Thus, results from microarray assays were validated. Microarray analysis of genes in HIEC in response to hLf, bLf and CbLf From Venn diagrams (Fig. 4), hLf, bLf and CbLf significantly regulated gene transcription in HIEC. Total genes significantly regulated by hLf, bLf and CbLf were 150, 395 and 453, respectively. Only 16 genes were regulated by all three Lfs. Fifty-four
Biometals
Fig. 1 HIEC expressed LfR and all Lfs were internalized by HIEC. a HIEC cell lysates were subjected to immunoblotting. HIEC expressed two molecular forms of LfR, (35 and 105 kD). b Indirect fluorescence detection, HIEC were seeded and grown on Lab-TekII chambered slides overnight. After cells were
treated with Lfs (50 lg/mL) for 30 min at 37 °C, cells were fixed and then stained with green fluorescence (Lf) and red fluorescence (LfR). The ruler represents 20 lm and the arrows indicate co-localization of Lf and LfR
Pathway analysis of genes regulated by Lfs
Fig. 2 Effects of Lfs on proliferation of HIEC cells. Proliferation effects were examined, after HIEC cells (7,000 cells/well, n = 5 for each treatment) grown on 96-well plates were treated with Lfs for 24 h. Data are shown as mean ± SD for three independent experiments (n = 5). Comparisons between treatments and controls were analyzed using one-way ANOVA. *p \ 0.001
genes were modulated by both hLf and CbLf, which is 36 % of the genes regulated by hLf alone, whereas only 29 genes were regulated by both hLf and bLf, indicating that CbLf may have effects more similar to hLf than bLf. One hundred and twentynine genes were modulated by both bLf and CbLf, which is 36 % and 28 % of the genes regulated by bLf and CbLf, respectively.
Genes regulated by Lfs are enriched in gene ontology functions of promotion of cell development and the digestive system, such as RhoA, Wnt/beta-catenin signaling, ERK/MAPK signaling, cyclins and cell cycle regulation (Fig. 5). Only RhoA and Wnt/betacatenin were modulated by all three Lfs. A number of pathways were regulated by two Lfs, such as VEGF, IGF-1, FGF and EGF signaling. Since Wnt/betacatenin signaling plays an essential role in intestinal development (Clevers 2006), we further investigated if Lfs activated this signaling pathway. All Lfs increased Wnt/b-catenin via increasing expression of different components of this signaling pathway or suppressing inhibitors of this signaling, such as DKK (Fig. 6a). The secreted Dickkopf (Dkk) proteins suppress Wnt signaling by direct binding to LRP 5/6 and thus down-regulating the Wnt signaling pathway (Glinka et al. 1998). In general, after Wnt binds to FZD, a downstream signaling cascade is triggered. The GSK3 cascade is activated and phosphorylated bcatenin is then trans-localized from the cytoplasm to the nucleus to regulate gene expression. Lf increased expression of Wnt5A and FZD8 and attenuated expression of DKK1. As a consequence, all Lfs may trigger Wnt/b-catenin. Whether Wnt/b-catenin signaling was activated by Lfs at the protein level was
123
Biometals Fig. 3 Real-time verification of microarray results. a RT-PCR b microarray results. Values are shown as mean foldchange ± standard deviation, relative to control (set to 1). *p \ 0.001
Fig. 4 Venn diagram of genes significantly regulated by Lfs. GenomeStudio (Illumina) was used for data analysis. Rank invariant normalization was performed to normalize the microarray data. Differentially expressed genes were selected following three criteria: fold change C1.5 for upregulation, fold change B0.5 (represents as -2.0) for down-regulation and detection probability greater than 0.95 in all samples
examined by immunoblotting. After HIEC were treated with Lfs for 48 h, expression of phosphorylated b-catenin was increased by the three Lfs (Fig. 6c), suggesting that Lfs enhance intestinal development by stimulating the Wnt/b-beta-catenin signaling pathway. In addition, the Lfs modified intestinal immune response of by activating cell signaling, such as interferon, IL-17, activation of IRF by cytosolic pattern recognition receptors, CD40 and IL-8 signaling (Fig. 7). Although the activated signaling pathways differ, the major impact of all these three Lfs on the immune system involves anti-pathogenic activities. For example, interferon signaling up-regulated by hLf and bLf leads to induction and regulation of innate and adaptive antiviral mechanisms (Ivashkiv and Donlin 2014). Interleukin (IL)-17 which is
123
up-regulated by bLf and CbLf is a pro-inflammatory cytokine that plays critical roles in host defense against extracellular bacteria and fungi particularly at mucosal and barrier sites (Kim and Jordan 2013). Thus, the main effects of all Lfs on the intestine include promotion of intestinal proliferation and development, increase of antibacterial and antivirus activities as well as enhancement of immunity, although various signaling pathways were triggered (Table 2).
Discussion LfR is localized to the plasma membrane of HIEC and is involved in internalization of Lfs by intestinal epithelial cells. We have shown that LfR mediates hLf
Biometals
Fig. 5 Major signaling pathways involved in intestinal proliferation and development triggered by Lfs
internalization by human intestinal epithelial cells (Caco-2) via a clathrin-dependent endocytosis pathway (Jiang et al. 2011). Here we report that LfR is also involved in endocytosis of bLf and CbLf by intestinal epithelial cells. LfR is expressed at early gestation (D 13.5) (Lopez et al. 2006) and Lf appears in amniotic fluid (Pacora et al. 2000). Therefore, LfR may mediate bioactivities of Lf during both fetal and infant development. Moreover, LfR may be involved in multiple signaling ways initiated by Lfs. As shown by confocal microscopy, LfR was localized at the plasma membrane in HIEC, which is consistent with our previous findings (Jiang et al. 2011; Lopez et al. 2008). According to prediation of transmembrane domain (http://www.ch.embnet.org) and kinase activities (www.cbs.dtu.dk/services/NetPhosK), LfR has one
transmembrane domain and many kinase activities including p38MAPK, PKA, PKB and CKII. After Lf is internalized by HIEC, Lf may enter the nucleus to act as a transcriptional factor to exert its multiple functions as well. As we found previously, the N-terminal domain of Lf is critical for entry to the nucleus (Suzuki et al. 2008). A normal human intestinal epithelial cell model, HIEC, was used in the present study. HIEC were isolated from the normal fetal human infant intestine. These cells have been used for studies on regulation of intestinal proliferation since they were established (Deschenes et al. 2004; Gagne et al. 2010). Compared with other intestinal epithelial cell models, HIEC have obvious advantages in studies on human normal intestinal epithelial cells in response to stimuli. Cell
123
Biometals
Fig. 6 Lfs mediated the Wnt/b-catenin signaling pathway. a Lfs significantly modulated genes involved in Wnt/b-catenin signaling. b Simplified schematic representation of the Wnt/b-
catenin signaling pathway. c Effects of Lfs on phosphorylation of b-catenin. HIEC were treated with Lf (50 lg/mL) for 48 h and then cell lysates were subjected to immunoblotting
models derived from human colonic adenocarcinoma, such as Caco-2 (Engle et al. 1998) and HT-29 (Marvaldi et al. 1979) or cells isolated from experimental animals such as IEC-6 cells (rat intestinal crypt cells) (Wenzl et al. 1989) may not correctly and appropriately reflect physiological functions of normal human intestinal epithelial cells. That may explain why we obtained significantly different results from global gene regulatory effects of hLf and bLf on intestinal epithelial cells when HIEC and mouse crypt cells were used (Liao et al. 2012). Human and bovine milk Lfs promoted proliferation of mouse crypt cells at 400 ng/mL and high similarity was found in global gene prolifing upon treatments of Lfs from human and bovine milk, whereas hLf and bLf did not show proliferative effects on HIEC at concentration lower than 1 lg/mL and hLf and bLf diversely modulated global gene prolifing in HIEC although they excerted similar effects on intestinal development.
All three Lfs significantly promote intestinal proliferation and development but via serial mechanisms, including initiating signaling of RhoA, Wnt/b-catenin, ERK/MAPK, telomerase, and growth hormone. We have previously reported the underlying mechanisms whereby Lf stimulates proliferation. Experiments using specific inhibitors for signaling pathways were shown to significantly attenuate proliferative effects exerted by Lf, implicating that Lf triggers intestinal proliferation via activating ERK and PI3 K/AKT signaling pathways in mouse crypt cells (Jiang and Lo¨nnerdal 2012). In a pig model, proliferative effects of Lf also depended on ERK activation (Nguyen et al. 2014). RhoA and Wnt/b-catenin signaling were upregulated by all three Lfs. RhoA is a member of the Ras superfamily of small GTPases that plays a central role in various biological processes including cell cycle progression (Amin et al. 2013). Wnt/b-catenin signaling plays a dominant role in crypt-villous
123
Biometals
Fig. 7 Major signaling pathways involved in immune response and development
homeostasis and crypt progenitor cells development throughout the whole life span (Reya et al. 2003). Although all Lfs significantly stimulated Wnt/b-catenin signaling, different components of this pathway were modified (Fig. 6a). Importantly, Lf may stimulate both intestinal proliferation and differentiation based on development stages. In early infancy, high concentrations of milk Lf enhance proliferation, whereas lower concentrations of milk Lf in late infancy promotes differentiation (Buccigrossi et al. 2007). Development of the small intestine consists of three stages: (1) morphogenesis and cell proliferation, (2) cell differentiation, and (3) functional maturation (Drozdowski et al. 2010). Lf appears to mediate all stages of intestinal development and may thus play important roles not only in early life but also probably in adulthood by modulating responses to physiological or pathological challenges (Koletzko et al. 1998). In fact, diet composition has been documented to
significantly affect intestinal development and functions (Perin et al. 1997). Lf has beneficial effects on intestinal immune development via modulating both innate and acquired immune responses. In our present study, non-transformed HIEC were used as an intestinal epithelial cell model. Crypts are formed by epithelial invaginations into the connective tissue of the intestine and are comprised of stem cells, their transit-amplifying daughter cells and Paneth cells, which secrete antibacterial peptides into the crypt lumen (Cheng 1974). Accumulating evidence shows that epithelial cells at mucosal surfaces are integral components of innate and adaptive immunity (Saenz et al. 2008). Therefore, intestinal epithelial cells are not only a mucosal barrier but also functional cells to provide defense against pathogens. Lfs treatments contributed to up-regulation of pro-inflammatory cytokines and their signaling, such as IL-8, IL-6, IL-17 and interferon, which is
123
Biometals Table 2 Gene network analysis
hLf
Associated network functions
Score
Cellular development, embryonic development, tissue development, digestive system development and function
30
(DKK3a, HDAC 7, IGF1R, ITPR1, LRP1, MYC, RBL1) Immune responses (CD55, CFD, CXCL10, IFIT1, IL8, NFKB2, MX1) bLf
Cellular growth and proliferation, digestive system development and function
48
(CCNE1, CDKN2B, CREB5, EIF4E, FZD8, IGFBP3, IGF1R, PDGFC, PIK3C2A, MYC, RHOJ, SKP2, TCF4, WNT5A) Cell-mediated immune response
38
(CXCL10, IL11, IL17RC, IL8, IL1RAPL, NFATC3, PAG1, TLR5, TRAF5) CbLf
Cellular development and digestive system development and function
References
39
a
The underlined genes were down-regulated. Others genes were up-regulated
agreement with observations in cells and animal models (Legrand et al. 2006). In hLf-transgenic mice, production of IFN-a and IFN-c was increased, indicating an enhanced cell-mediated immune response. Moreover, hLf-transgenic mice had a stronger potency to clear bacteria and lower infection susceptibility than wild type mice (Guillen et al. 2002). After mice were fed bLf, increased IL-18, interferon-a, and interferonb were found in Peyer’s patches and mesenteric lymph nodes, which leads to enhanced natural killer cell activity (Kuhara et al. 2006). Significantly, Lf displays immunomodulatory activities. Effects of Lf on immune responses depend on the scenario. In virusor bacterial- infected models, Lf exhibits anti-inflammatory activity by decreasing secretion of pro-inflammatory cytokines. In pigs who developed necrotizing enterocolitis (NEC), bLf decreased secretion of IL-1 b and IL-8 and prevented NF-kB and hypoxia-inducible factor-1a (HIF-1a) activation, indicating anti-
123
Acknowledgments We thank Dr. Jean-Franc¸ois Beaulieu for providing non-transformed human crypt intestinal epithelial cells. We gratefully acknowledge the assistance of Siranoosh Ashtari at the Expression Facility at University of California, Davis with microarray assays. This work was supported by a grant from Mead Johnson Nutrition.
35
(ABL2, ARHGEF11, CCRN4L CD44, CDK1, CDKN2B, DKK3, DLC1, FZD8, HDAC7, IGF2, IGF1R, IGFBP3, LIMK2, LRP1, MYC, PPP1CB,PPP2R3B, PPP2R5D, RFC2, WNT5A) Humoral immune response (IFIT1, IFIT3, IFNAR2, NFKB2, NFATC3, MADD, ITGA1)
inflammatory effects (Tian et al. 2010). Similar results were found in LPS treated rats, as decreased concentrations of serum TNF-a and IL-6 were seen upon bLf treatments (Tang et al. 2012). All three Lfs exhibited similar net effects on intestinal and immune development of intestinal epithelial cells via activating the same or functionally similar signaling pathways. In the present study, a primary human intestinal cell line was used. To further investigate and compare functions of Lfs, animal studies are required to confirm these results in the future.
Amin E et al (2013) Rho-kinase: regulation, (dys)function, and inhibition. Biol Chem 394:1399–1410 Buccigrossi V, de Marco G, Bruzzese E, Ombrato L, Bracale I, Polito G, Guarino A (2007) Lactoferrin induces concentration-dependent functional modulation of intestinal proliferation and differentiation. Pediatr Res 61:410–414 Cheng H (1974) Origin, differentiation and renewal of the four main epithelial cell types in the mouse small intestine. IV. Paneth cells. Am J Anat 141:521–535 Clevers H (2006) Wnt/beta-catenin signaling in development and disease. Cell 127:469–480 Cooper CA, Nelson KM, Maga EA, Murray JD (2013) Consumption of transgenic cows’ milk containing human lactoferrin results in beneficial changes in the gastrointestinal tract and systemic health of young pigs. Transgenic Res 22:571–578 Davidson LA, Lo¨nnerdal B (1987) Persistence of human milk proteins in the breast-fed infant. Acta Paediatr Scand 76:733–740 Deschenes C, Alvarez L, Lizotte ME, Vezina A, Rivard N (2004) The nucleocytoplasmic shuttling of E2F4 is involved in the regulation of human intestinal epithelial cell proliferation and differentiation. J Cell Physiol 199:262–273 Drozdowski LA, Clandinin T, Thomson AB (2010) Ontogeny, growth and development of the small intestine: understanding pediatric gastroenterology. World J Gastroenterol 16:787–799 Engle MJ, Goetz GS, Alpers DH (1998) Caco-2 cells express a combination of colonocyte and enterocyte phenotypes. J Cell Physiol 174:362–369 Gagne D, Groulx JF, Benoit YD, Basora N, Herring E, Vachon PH, Beaulieu JF (2010) Integrin-linked kinase regulates migration and proliferation of human intestinal cells under
Biometals a fibronectin-dependent mechanism. J Cell Physiol 222: 387–400 Glinka A, Wu W, Delius H, Monaghan AP, Blumenstock C, Niehrs C (1998) Dickkopf-1 is a member of a new family of secreted proteins and functions in head induction. Nature 391:357–362 Guillen C et al (2002) Enhanced Th1 response to Staphylococcus aureus infection in human lactoferrin-transgenic mice. J Immunol 168:3950–3957 He J, Furmanski P (1995) Sequence specificity and transcriptional activation in the binding of lactoferrin to DNA. Nature 373:721–724 Ivashkiv LB, Donlin LT (2014) Regulation of type I interferon responses. Nat Rev Immunol 14:36–49 Jiang R, Lo¨nnerdal B (2012) Apo- and holo-lactoferrin stimulate proliferation of mouse crypt cells but through different cellular signaling pathways. Int J Biochem Cell Biol 44:91–100 Jiang R, Lopez V, Kelleher SL, Lo¨nnerdal B (2011) Apo- and holo-lactoferrin are both internalized by lactoferrin receptor via clathrin-mediated endocytosis but differentially affect ERK-signaling and cell proliferation in Caco-2 cells. J Cell Physiol 226:3022–3031 Kim JS, Jordan MS (2013) Diversity of IL-17-producing T lymphocytes. Cell Mol Life Sci 70:2271–2290 Koletzko B et al (1998) Growth, development and differentiation: a functional food science approach. Br J Nutr 80(Suppl 1):S5–S45 Kuhara T, Yamauchi K, Tamura Y, Okamura H (2006) Oral administration of lactoferrin increases NK cell activity in mice via increased production of IL-18 and type I IFN in the small intestine. J Interferon Cytokine Res 26:489–499 Kuhara T, Tanaka A, Yamauchi K, Iwatsuki K (2014) Bovine lactoferrin ingestion protects against inflammation via IL11 induction in the small intestine of mice with hepatitis. Br J Nutr 111(10):1801–1810 Legrand D, Elass E, Carpentier M, Mazurier J (2006) Interactions of lactoferrin with cells involved in immune function. Biochem Cell Biol 84:282–290 Legrand D, Pierce A, Elass E, Carpentier M, Mariller C, Mazurier J (2008) Lactoferrin structure and functions. Adv Exp Med Biol 606:163–194 Levy E, Beaulieu JF, Delvin E, Seidman E, Yotov W, Basque JR, Menard D (2000) Human crypt intestinal epithelial cells are capable of lipid production, apolipoprotein synthesis, and lipoprotein assembly. J Lipid Res 41:12–22 Liao Y, Jiang R, Lo¨nnerdal B (2012) Biochemical and molecular impacts of lactoferrin on small intestinal growth and development during early life. Biochem Cell Biol 90:476–484 Lo¨nnerdal B, Iyer S (1995) Lactoferrin: molecular structure and biological function. Annu Rev Nutr 15:93–110 Lonnerdal B, Jiang R, Du X (2011) Bovine lactoferrin can be taken up by the human intestinal lactoferrin receptor and exert bioactivities. J Pediatr Gastroenterol Nutr 53:606–614 Lopez V, Suzuki YA, Lo¨nnerdal B (2006) Ontogenic changes in lactoferrin receptor and DMT1 in mouse small intestine: implications for iron absorption during early life. Biochem Cell Biol 84:337–344 Lopez V, Kelleher SL, Lo¨nnerdal B (2008) Lactoferrin receptor mediates apo- but not holo-lactoferrin internalization via
clathrin-mediated endocytosis in trophoblasts. Biochem J 411:271–278 Mariller C, Benaissa M, Hardiville S, Breton M, Pradelle G, Mazurier J, Pierce A (2007) Human delta-lactoferrin is a transcription factor that enhances Skp1 (S-phase kinaseassociated protein) gene expression. FEBS J 274:2038– 2053 Marshall K (2004) Therapeutic applications of whey protein. Altern Med Rev 9:136–156 Marvaldi J, Mangeat P, Ahmed OA, Coeroli C, Marchis-Mouren G (1979) Activation of cyclic AMP-dependent protein kinases in human gut adenocarcinoma (HT 29) cells in culture. Biochim Biophys Acta 588:12–19 Nguyen DN, Li Y, Sangild PT, Bering SB, Chatterton DE (2014) Effects of bovine lactoferrin on the immature porcine intestine. Br J Nutr 111:321–331 Nichols BL, McKee KS, Henry JF, Putman M (1987) Human lactoferrin stimulates thymidine incorporation into DNA of rat crypt cells. Pediatr Res 21:563–567 Pacora P, Maymon E, Gervasi MT, Gomez R, Edwin SS, Yoon BH, Romero R (2000) Lactoferrin in intrauterine infection, human parturition, and rupture of fetal membranes. Am J Obstet Gynecol 183:904–910 Papp K, Szittner Z, Prechl J (2012) Life on a microarray: assessing live cell functions in a microarray format. Cell Mol Life Sci 69:2717–2725 Perin NM, Clandinin T, Thomson AB (1997) Importance of milk and diet on the ontogeny and adaptation of the intestine. J Pediatr Gastroenterol Nutr 24:419–425 Reya T et al (2003) A role for Wnt signalling in self-renewal of haematopoietic stem cells. Nature 423:409–414 Saenz SA, Taylor BC, Artis D (2008) Welcome to the neighborhood: epithelial cell-derived cytokines license innate and adaptive immune responses at mucosal sites. Immunol Rev 226:172–190 Son KN, Park J, Chung CK, Chung DK, Yu DY, Lee KK, Kim J (2002) Human lactoferrin activates transcription of IL1beta gene in mammalian cells. Biochem Biophys Res Commun 290:236–241 Spik G, Brunet B, Mazurier-Dehaine C, Fontaine G, Montreuil J (1982) Characterization and properties of the human and bovine lactotransferrins extracted from the faeces of newborn infants. Acta Paediatr Scand 71:979–985 Suzuki YA, Wong H, Ashida KY, Schryvers AB, Lo¨nnerdal B (2008) The N1 domain of human lactoferrin is required for internalization by caco-2 cells and targeting to the nucleus. Biochemistry 47:10915–10920 Tang XS et al (2012) Dietary supplementation with bovine lactoferrampin-lactoferricin produced by Pichia pastoris fed-batch fermentation affects intestinal microflora in weaned piglets. Appl Biochem Biotechnol 168:887–898 Tian H, Maddox IS, Ferguson LR, Shu Q (2010) Influence of bovine lactoferrin on selected probiotic bacteria and intestinal pathogens. Biometals 23:593–596 Wenzl E, Sjaastad MD, Weintraub WH, Machen TE (1989) Intracellular pH regulation in IEC-6 cells, a cryptlike intestinal cell line. Am J Physiol 257:G732–G740 Zhang P, Sawicki V, Lewis A, Hanson L, Nuijens JH, Neville MC (2001) Human lactoferrin in the milk of transgenic mice increases intestinal growth in ten-day-old suckling neonates. Adv Exp Med Biol 501:107–113
123
Transcriptomic profiling of intestinal epithelial cells in response to human, bovine and commercial bovine lactoferrins Rulan Jiang • Bo Lo¨nnerdal
Received: 9 April 2014 / Accepted: 26 April 2014 Ó Springer Science+Business Media New York 2014
Abstract Lactoferrin (Lf) is an iron-binding glycoprotein present in high concentration in human milk. It is a pleiotropic protein and involved in diverse bioactivities, such as stimulation of cell proliferation and immunomodulatory activities. Lf is partly resistant to proteolysis in the gastrointestinal tract. Thus, Lf may play important roles in intestinal development. Due to differences in amino acid sequences and isolation methods, Lfs from human and bovine milk as well as commercially available bovine Lf (CbLf) may differ functionally or exert their functions via various mechanisms. To provide a potential basis for further applications of CbLf, we compared effects of Lfs on intestinal transcriptomic profiling using an intestinal epithelial cell model, human intestinal epithelial crypt-like cells (HIEC). All Lfs significantly stimulated proliferation of HIEC and no significant differences were found among these three proteins. Microarray assays were used to investigate transcriptomic profiling of intestinal epithelial cells in response to Lfs. Selected genes were verified by RT-PCR with a high validation rate. Genes significantly regulated by hLf, bLf, and CbLf were 150, 395 and 453, respectively. Fifty-four genes were significantly regulated by both hLf and CbLf, whereas 129 genes were
R. Jiang B. Lo¨nnerdal (&) Department of Nutrition, University of California, Davis, CA 95616, USA e-mail: [email protected]
significantly modulated by bLf and CbLf. Although only a limited number of genes were regulated by all Lfs, the three Lfs positively influenced cellular development and immune functions based on pathway analysis using IPA (Ingenuity). Lfs stimulate cellular and intestinal development and immune functions via various signaling pathways, such as Wnt/b-catenin signaling, interferon signaling and IL-8 signaling. Keywords Human lactoferrin Bovine lactoferrin Cell proliferation Immune function
Introduction Lactoferrin (Lf) is an iron binding glycoprotein with a molecular weight of 80 kDa. It is present in mammalian milk and particularly abundant in human colostrum and milk, with concentrations ranging from 1 to 6 g/L (Lo¨nnerdal and Iyer 1995). The concentration of Lf in milk differs significantly among species. For example, it is high in pigs and mice, but low in cows with only 1.5 mg/L in colostrum and 0.5 mg/L in mature milk (Marshall 2004). It is also present in biological fluids, including amniotic fluid, saliva, tears, pancreatic fluid, bile, mucosal and gastrointestinal secretions and secondary granules of neutrophils (Lo¨nnerdal and Iyer 1995). Lf survives gastrointestinal digestion as revealed by both in vivo and in vitro
123
Biometals
studies (Davidson and Lo¨nnerdal 1987; Lonnerdal et al. 2011; Spik et al. 1982). Due to the high concentration of Lf in milk and its resistance to proteolysis, Lf may play important roles in intestinal development. Lf is a multifunctional protein and involved in promotion of cell proliferation and differentiation as well as bone growth, immunomodulatory activities, antimicrobial and antioxidant actions (Legrand et al. 2008; Lo¨nnerdal and Iyer 1995). Generally, Lf exerts its multiple functions via two mechanisms: Lf binds to its receptor on the cell membrane and then activate signaling transduction (Jiang and Lo¨nnerdal 2012) or act as a transcriptional factor to transactivate the expression of genes (He and Furmanski 1995), such as IL-1 beta (Son et al. 2002) and Skp1 (Mariller et al. 2007). Accumulating evidence indicates that Lf stimulate growth of the intestine. A mitogenic effect of Lf on the intestine was reported for crypt cells isolated from rats (Nichols et al. 1987), human intestinal epithelial cells (Caco-2) (Buccigrossi et al. 2007), mouse pups fed by hLf transgenic mice (Zhang et al. 2001) and piglets fed milk from hLf transgenic cattle (Cooper et al. 2013). Lf has beneficial effects on function and development of the immune system. It protects the intestine and the whole body against inflammation and infection via modulating cytokine secretion (Kuhara et al. 2014, 2006) and changing leukocyte populations (Cooper et al. 2013) as well as activities (Kuhara et al. 2006). Moreover, Lf exerts anti-microbial activities in the intestinal lumen (Tian et al. 2010). Human Lf (hLf) and bovine Lf (bLf) share 69 % amino acid identity (Lonnerdal et al. 2011) and bLf is commercially available. Due to differences in amino acid sequences and processing procedures, hLf, bLf and commercially available bLf (CbLf) may differ functionally. Non-transformed human crypt intestinal epithelial cells (HIEC) were isolated from fetal intestines at 14–20 weeks of gestation and express a number of intestinal crypt but not villus cell markers (Levy et al. 2000). The microarray assay is a powerful tool to identify large lists of genes simultaneously relevant to various treatments (Papp et al. 2012). To investigate effects of Lf on intestinal development, HIEC were treated with hLf, bLf and CbLf and the transcriptomic profiling of intestinal epithelial cells in response to Lfs was evaluated by microarray assays.
123
Materials and methods Cell culture Non-transformed HIEC (a gift from Dr. Jean-Franc¸ois Beaulieu, Universite´ de Sherbrooke) were maintained in a humidified incubator at 37 °C under an atmosphere of 5 % CO2 in Opti-MEM (Life Technologies Inc., Gaithersburg, MD, USA) supplemented with fetal bovine serum (FBS, 5 %, MP Biomedicals), GlutaMax (1 %, Gibco) and epidermal growth factor (EGF, 5 ng/mL, R&D Systems, Minneapolis, MN). Cells between passages 18–24 were harvested at 90 % confluence and medium was changed every other day. Preparation of Lfs Preparation of human and bovine Lfs from milk was described previously (Lonnerdal et al. 2011). CbLf was obtained from FrieslandCampina Domo (Amersfoort, the Netherlands) and dissolved in phosphate buffered saline (PBS) at a concentration similar to concentrated hLf and bLf. Immunoblotting After HIEC were treated with or without Lfs (50 lg/ mL) in 6- well (2.2 9 104/cm2) plates for two days, HIEC were lysed in homogenization buffer (20 mM Tris–HCl, pH 7.5, 150 mM NaCl, 1 mM EGTA, 1 % Triton X-100, Halt protease and phosphatase inhibitor cocktail, Thermo Scientific), sonicated briefly and centrifuged at 5009g for 10 min at 4 °C. Protein concentration was measured with the Bradford assay. Proteins (50 lg/lane) were boiled for 5 min in Laemmli sample buffer (Bio-Rad, Hercules, CA, USA) with b-mercaptoethanol (5 %, Sigma) and then separated by SDS–PAGE and transferred to a nitrocellulose membrane. The membrane was incubated in blocking buffer (5 % skim milk in PBST: 0.1 % Tween-20 in PBS) for 45 min at room temperature, washed three times with PBST and then probed with an antibody specific for human LfR which was described previously (Lopez et al. 2008) (rabbit antiLfR, 1 lg/mL) or phospho-b-catenin antibody (1:1,000, Ser33/37/Thr41, Cell Signaling, Danvers, MA, #9561) or b-catenin antibody (1:1,000, Cell Signaling, #9562) in blocking buffer for 45 min at room temperature. After three washes with PBST,
Biometals
primary antibodies were detected with horseradish peroxidase (HRP)-conjugated donkey anti-rabbit IgG (1:20,000, Amersham Pharmacia Biotech) in blocking buffer for 45 min. Bands were visualized with ECL Plus Substrate (GE Healthcare, Piscataway, NJ, USA) after a final wash (30 min wash with PBST). Proliferation assay To determine the effects of Lfs on cellular proliferation of intestinal epithelial cells, HIEC were grown on 96-well plates (2.2 9 104/cm2). Cells were incubated in cell culture medium with FBS (2 %, n = 6 samples/treatment) containing hLf, bLf and CbLf (1, 2, 4, 8, 10, 20 and 50 lg/mL), and effects of Lfs on cell proliferation were evaluated using a bromodeoxyuridine (BrdU) kit (Roche, Indianapolis, IN, USA) following the manufacturer’s instructions. Confocal fluorescence microscopy HIEC cells were seeded and grown on Lab-TekII chambered slides (Nalge Nunc International, Naperville, IL, USA) overnight. After cells were treated with Lfs (50 lg/mL) in serum free medium (SFM) for 30 min at 37 °C, cells were rinsed with PBS, fixed with phosphate-buffered paraformaldehyde (4 %, 0.4 mL/ well) for 10 min at room temperature and then permeabilized with Triton X-100 (0.2 %) in PBS for 10 min. Cells were then blocked with blocking buffer (5 % heat-inactivated rabbit serum and 1 % BSA in PBS, 0.5 mL/well) for 20 min. After the blocking buffer was removed, cells were rinsed with PBS and Lf was probed with rabbit anti-hLf (2 lg/mL, Abcam, Cambridge, MA) or goat anti-bLf (2 lg/mL, Bethyl Laboratories, Montgomery, TX, USA) and then Alexa 488-conjugated-anti-rabbit or Alexa 488-conjugatedanti-goat IgG (1 lg/mL; Molecular Probes, Eugene, OR, USA) in blocking buffer for 30 min. After several rinses, cells were rinsed with PBS and Lf was probed with rabbit anti-LfR (2 lg/mL) and then Alexa 647-conjugated-anti-rabbit (1 lg/mL; Molecular Probes, Eugene, OR, USA) in blocking buffer for 30 min. Coverslips were subsequently mounted with ProLong Gold Antifade Reagent (Invitrogen Molecular Probes) and sealed with nail polish. Non-specific binding was evaluated by using only secondary antibodies. A confocal laser scanning microscope (FV1000, Olympus America, Inc., Melville, NY,
USA) was used to perform immunofluorescence imaging and image analysis software systems (Olympus America, Inc.) were used to analyze the images. RNA extraction and array hybridization HIEC (6-well plate, 2.2 9 104/cm2) were grown for 24 h and then treated with Lfs (50 lg/mL) for 24 h. RNA was extracted with Trizol (Invitrogen) and then purified by an RNease kit (Qiagen) according to the manufacturer’s instructions. Measurement of RNA yield was performed using a NanoDrop 1000A Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) and RNA quality was verified using Bioanalyzer RNA Nano Chips (Agilent Technologies, Inc., Santa Clara, CA, USA) following the manufacturer’s procedure. Total RNA samples were amplified and labeled with biotinylated nucleotides using a kit from Ambion (TotalPrep -96 RNA Amplification Kit). Bioanalyzer analysis was then performed to verify if cRNA was at the expected 1.2 kb average size before applying to beadchips (HumanHT-12 v.4.0, Illumina, San Diego, USA). Beadchips were scanned with the Illumina iScan using standard conditions. Microarray data analysis GenomeStudio (Illumina) was used for microarray data analysis and rank invariant normalization was conducted to normalize the microarray data. Only probe sets with adjusted p value less than 0.05 were selected for subsequent analysis and a total of 13,716 genes were analyzed. Differentially expressed genes were selected following two criteria: fold-change C1.5 for up-regulation, fold-change B0.5 (represents as -2.0) for down-regulation. Pathway analysis was conducted using IPA (IngenuityÒ Systems, Mountain View, CA, USA) and the Core analysis included in IPA was used to interpret data in the context of biological processes, pathways, and networks. Quantitative real-time PCR RNA (1 lg) extracted for microarray assays was reverse-transcribed to cDNA using a high-capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, USA) following the manufacturer’s instructions. Gene-specific primers are listed in Table 1. Real-time polymerase chain reaction (RT-
123
Biometals Table 1 Primers for real-time PCR Primers
Sequence
IGF1R forward
AAGCCTCACCCTCTCTTTCC
IGF1R reverse
TGCCTAGTGTCTGCGGTTAA
IL8 forward IL8 reverse
TAGCCAGGATCCACAAGTCC TGTGAGGTAAGATGGTGGCT
MX1 forward
AGTCCGTCTCTGCTTATCCG
MX1 reverse
GGGGCTCTGTCTTCATGCTA
LRP1 forward
ATTGTGGAAAACGTGGGCTC
LRP1 reverse
TGGTGGATGTCGTGTAGCTT
IGFBP3 forward
CACAGCACCCAGACTTCATG
IGFBP3 reverse
CAGCCGCCTAAGTCACAAAG
PCR) was performed on the cDNA reaction mixture (2 lL) and SYBR Green (Thermo Scientific) using the iCycler real-time PCR system (Bio-Rad). The cycling parameters were 95 °C 15 min and 40 cycles including 95 °C for 15 s, 60 °C for 30 s and 72 °C for 30 s. Linearity of the dissociation curve was analyzed using the iCycler software, and the mean cycle time of the linear part of the curve was designated as Ct. Each sample was analyzed in triplicate and normalized to GAPDH using the following equation: fold change = 2(Ct Gene- Ct GAPDH). Values are shown as mean fold change ± standard deviation, relative to control (set to 1). Statistical analysis Data represent means ± standard deviations from 2 to 3 independent experiments. Comparisons between treatments and the control were conducted using Student’s t test or one-way ANOVA (Prism Graph Pad, Berkeley, CA, USA). p \ 0.05 was considered to be statistically significant.
Results Internalization of Lf by HIEC We have previously demonstrated that internalization of Lf by intestinal epithelial cells is partly LfR dependent (Jiang et al. 2011). Therefore, we first examined if HIEC expressed intestinal LfR. As shown in Fig. 1a, HIEC expressed two forms of LfR, with molecular weights of 35 and 105 kD. We next used
123
confocal microscopy to examine cellular localization of LfR as well as investigate if Lfs were able to be internalized by HIEC and if LfR mediated the internalization. As shown in Fig. 1b, LfR localized to the plasma membrane of HIEC and all three Lfs were internalized by HIEC. LfR mediated the internalization of Lfs as revealed by co-localization of Lf and LfR. No significant differences were observed in the post-internalization fate of the three Lfs. Effects of Lfs on proliferation of HIEC Proliferative effects of Lf on intestinal cells have been documented previously (Buccigrossi et al. 2007; Jiang et al. 2011). To determine effects of Lfs on proliferation of HIEC, after HIEC were treated with serial concentrations of Lfs (1–50 lg/L) for 24 h, the proliferation effect was evaluated with a BrdU kit. Starting from 4 lg/L, all Lfs exhibited proliferative effects, no differences were found among the three Lfs, and the effects were not significantly concentration dependent. Therefore, Fig. 2 only shows the effects of one concentration of Lf (50 lg/mL) on intestinal proliferation. As shown in Fig. 2, all Lfs significantly stimulated proliferation of HIEC. Validation of microarray results by real-time PCR Based on the results from proliferation assays, HIEC were treated with Lfs for 24 h and RNA was then extracted for microarray assays as described in the ‘‘Materials and methods’’ section. After obtaining the microarray results, real-time PCR was performed to verify the microarray results (Fig. 3). Five genes, IGG1R, IL8, MX1, LRP1 and IGFBP3, were randomly chosen for real-time PCR analysis. The results for these five genes were consistent with results from the microarrays (Fig. 3) and the R-value of association analysis was 0.95. Thus, results from microarray assays were validated. Microarray analysis of genes in HIEC in response to hLf, bLf and CbLf From Venn diagrams (Fig. 4), hLf, bLf and CbLf significantly regulated gene transcription in HIEC. Total genes significantly regulated by hLf, bLf and CbLf were 150, 395 and 453, respectively. Only 16 genes were regulated by all three Lfs. Fifty-four
Biometals
Fig. 1 HIEC expressed LfR and all Lfs were internalized by HIEC. a HIEC cell lysates were subjected to immunoblotting. HIEC expressed two molecular forms of LfR, (35 and 105 kD). b Indirect fluorescence detection, HIEC were seeded and grown on Lab-TekII chambered slides overnight. After cells were
treated with Lfs (50 lg/mL) for 30 min at 37 °C, cells were fixed and then stained with green fluorescence (Lf) and red fluorescence (LfR). The ruler represents 20 lm and the arrows indicate co-localization of Lf and LfR
Pathway analysis of genes regulated by Lfs
Fig. 2 Effects of Lfs on proliferation of HIEC cells. Proliferation effects were examined, after HIEC cells (7,000 cells/well, n = 5 for each treatment) grown on 96-well plates were treated with Lfs for 24 h. Data are shown as mean ± SD for three independent experiments (n = 5). Comparisons between treatments and controls were analyzed using one-way ANOVA. *p \ 0.001
genes were modulated by both hLf and CbLf, which is 36 % of the genes regulated by hLf alone, whereas only 29 genes were regulated by both hLf and bLf, indicating that CbLf may have effects more similar to hLf than bLf. One hundred and twentynine genes were modulated by both bLf and CbLf, which is 36 % and 28 % of the genes regulated by bLf and CbLf, respectively.
Genes regulated by Lfs are enriched in gene ontology functions of promotion of cell development and the digestive system, such as RhoA, Wnt/beta-catenin signaling, ERK/MAPK signaling, cyclins and cell cycle regulation (Fig. 5). Only RhoA and Wnt/betacatenin were modulated by all three Lfs. A number of pathways were regulated by two Lfs, such as VEGF, IGF-1, FGF and EGF signaling. Since Wnt/betacatenin signaling plays an essential role in intestinal development (Clevers 2006), we further investigated if Lfs activated this signaling pathway. All Lfs increased Wnt/b-catenin via increasing expression of different components of this signaling pathway or suppressing inhibitors of this signaling, such as DKK (Fig. 6a). The secreted Dickkopf (Dkk) proteins suppress Wnt signaling by direct binding to LRP 5/6 and thus down-regulating the Wnt signaling pathway (Glinka et al. 1998). In general, after Wnt binds to FZD, a downstream signaling cascade is triggered. The GSK3 cascade is activated and phosphorylated bcatenin is then trans-localized from the cytoplasm to the nucleus to regulate gene expression. Lf increased expression of Wnt5A and FZD8 and attenuated expression of DKK1. As a consequence, all Lfs may trigger Wnt/b-catenin. Whether Wnt/b-catenin signaling was activated by Lfs at the protein level was
123
Biometals Fig. 3 Real-time verification of microarray results. a RT-PCR b microarray results. Values are shown as mean foldchange ± standard deviation, relative to control (set to 1). *p \ 0.001
Fig. 4 Venn diagram of genes significantly regulated by Lfs. GenomeStudio (Illumina) was used for data analysis. Rank invariant normalization was performed to normalize the microarray data. Differentially expressed genes were selected following three criteria: fold change C1.5 for upregulation, fold change B0.5 (represents as -2.0) for down-regulation and detection probability greater than 0.95 in all samples
examined by immunoblotting. After HIEC were treated with Lfs for 48 h, expression of phosphorylated b-catenin was increased by the three Lfs (Fig. 6c), suggesting that Lfs enhance intestinal development by stimulating the Wnt/b-beta-catenin signaling pathway. In addition, the Lfs modified intestinal immune response of by activating cell signaling, such as interferon, IL-17, activation of IRF by cytosolic pattern recognition receptors, CD40 and IL-8 signaling (Fig. 7). Although the activated signaling pathways differ, the major impact of all these three Lfs on the immune system involves anti-pathogenic activities. For example, interferon signaling up-regulated by hLf and bLf leads to induction and regulation of innate and adaptive antiviral mechanisms (Ivashkiv and Donlin 2014). Interleukin (IL)-17 which is
123
up-regulated by bLf and CbLf is a pro-inflammatory cytokine that plays critical roles in host defense against extracellular bacteria and fungi particularly at mucosal and barrier sites (Kim and Jordan 2013). Thus, the main effects of all Lfs on the intestine include promotion of intestinal proliferation and development, increase of antibacterial and antivirus activities as well as enhancement of immunity, although various signaling pathways were triggered (Table 2).
Discussion LfR is localized to the plasma membrane of HIEC and is involved in internalization of Lfs by intestinal epithelial cells. We have shown that LfR mediates hLf
Biometals
Fig. 5 Major signaling pathways involved in intestinal proliferation and development triggered by Lfs
internalization by human intestinal epithelial cells (Caco-2) via a clathrin-dependent endocytosis pathway (Jiang et al. 2011). Here we report that LfR is also involved in endocytosis of bLf and CbLf by intestinal epithelial cells. LfR is expressed at early gestation (D 13.5) (Lopez et al. 2006) and Lf appears in amniotic fluid (Pacora et al. 2000). Therefore, LfR may mediate bioactivities of Lf during both fetal and infant development. Moreover, LfR may be involved in multiple signaling ways initiated by Lfs. As shown by confocal microscopy, LfR was localized at the plasma membrane in HIEC, which is consistent with our previous findings (Jiang et al. 2011; Lopez et al. 2008). According to prediation of transmembrane domain (http://www.ch.embnet.org) and kinase activities (www.cbs.dtu.dk/services/NetPhosK), LfR has one
transmembrane domain and many kinase activities including p38MAPK, PKA, PKB and CKII. After Lf is internalized by HIEC, Lf may enter the nucleus to act as a transcriptional factor to exert its multiple functions as well. As we found previously, the N-terminal domain of Lf is critical for entry to the nucleus (Suzuki et al. 2008). A normal human intestinal epithelial cell model, HIEC, was used in the present study. HIEC were isolated from the normal fetal human infant intestine. These cells have been used for studies on regulation of intestinal proliferation since they were established (Deschenes et al. 2004; Gagne et al. 2010). Compared with other intestinal epithelial cell models, HIEC have obvious advantages in studies on human normal intestinal epithelial cells in response to stimuli. Cell
123
Biometals
Fig. 6 Lfs mediated the Wnt/b-catenin signaling pathway. a Lfs significantly modulated genes involved in Wnt/b-catenin signaling. b Simplified schematic representation of the Wnt/b-
catenin signaling pathway. c Effects of Lfs on phosphorylation of b-catenin. HIEC were treated with Lf (50 lg/mL) for 48 h and then cell lysates were subjected to immunoblotting
models derived from human colonic adenocarcinoma, such as Caco-2 (Engle et al. 1998) and HT-29 (Marvaldi et al. 1979) or cells isolated from experimental animals such as IEC-6 cells (rat intestinal crypt cells) (Wenzl et al. 1989) may not correctly and appropriately reflect physiological functions of normal human intestinal epithelial cells. That may explain why we obtained significantly different results from global gene regulatory effects of hLf and bLf on intestinal epithelial cells when HIEC and mouse crypt cells were used (Liao et al. 2012). Human and bovine milk Lfs promoted proliferation of mouse crypt cells at 400 ng/mL and high similarity was found in global gene prolifing upon treatments of Lfs from human and bovine milk, whereas hLf and bLf did not show proliferative effects on HIEC at concentration lower than 1 lg/mL and hLf and bLf diversely modulated global gene prolifing in HIEC although they excerted similar effects on intestinal development.
All three Lfs significantly promote intestinal proliferation and development but via serial mechanisms, including initiating signaling of RhoA, Wnt/b-catenin, ERK/MAPK, telomerase, and growth hormone. We have previously reported the underlying mechanisms whereby Lf stimulates proliferation. Experiments using specific inhibitors for signaling pathways were shown to significantly attenuate proliferative effects exerted by Lf, implicating that Lf triggers intestinal proliferation via activating ERK and PI3 K/AKT signaling pathways in mouse crypt cells (Jiang and Lo¨nnerdal 2012). In a pig model, proliferative effects of Lf also depended on ERK activation (Nguyen et al. 2014). RhoA and Wnt/b-catenin signaling were upregulated by all three Lfs. RhoA is a member of the Ras superfamily of small GTPases that plays a central role in various biological processes including cell cycle progression (Amin et al. 2013). Wnt/b-catenin signaling plays a dominant role in crypt-villous
123
Biometals
Fig. 7 Major signaling pathways involved in immune response and development
homeostasis and crypt progenitor cells development throughout the whole life span (Reya et al. 2003). Although all Lfs significantly stimulated Wnt/b-catenin signaling, different components of this pathway were modified (Fig. 6a). Importantly, Lf may stimulate both intestinal proliferation and differentiation based on development stages. In early infancy, high concentrations of milk Lf enhance proliferation, whereas lower concentrations of milk Lf in late infancy promotes differentiation (Buccigrossi et al. 2007). Development of the small intestine consists of three stages: (1) morphogenesis and cell proliferation, (2) cell differentiation, and (3) functional maturation (Drozdowski et al. 2010). Lf appears to mediate all stages of intestinal development and may thus play important roles not only in early life but also probably in adulthood by modulating responses to physiological or pathological challenges (Koletzko et al. 1998). In fact, diet composition has been documented to
significantly affect intestinal development and functions (Perin et al. 1997). Lf has beneficial effects on intestinal immune development via modulating both innate and acquired immune responses. In our present study, non-transformed HIEC were used as an intestinal epithelial cell model. Crypts are formed by epithelial invaginations into the connective tissue of the intestine and are comprised of stem cells, their transit-amplifying daughter cells and Paneth cells, which secrete antibacterial peptides into the crypt lumen (Cheng 1974). Accumulating evidence shows that epithelial cells at mucosal surfaces are integral components of innate and adaptive immunity (Saenz et al. 2008). Therefore, intestinal epithelial cells are not only a mucosal barrier but also functional cells to provide defense against pathogens. Lfs treatments contributed to up-regulation of pro-inflammatory cytokines and their signaling, such as IL-8, IL-6, IL-17 and interferon, which is
123
Biometals Table 2 Gene network analysis
hLf
Associated network functions
Score
Cellular development, embryonic development, tissue development, digestive system development and function
30
(DKK3a, HDAC 7, IGF1R, ITPR1, LRP1, MYC, RBL1) Immune responses (CD55, CFD, CXCL10, IFIT1, IL8, NFKB2, MX1) bLf
Cellular growth and proliferation, digestive system development and function
48
(CCNE1, CDKN2B, CREB5, EIF4E, FZD8, IGFBP3, IGF1R, PDGFC, PIK3C2A, MYC, RHOJ, SKP2, TCF4, WNT5A) Cell-mediated immune response
38
(CXCL10, IL11, IL17RC, IL8, IL1RAPL, NFATC3, PAG1, TLR5, TRAF5) CbLf
Cellular development and digestive system development and function
References
39
a
The underlined genes were down-regulated. Others genes were up-regulated
agreement with observations in cells and animal models (Legrand et al. 2006). In hLf-transgenic mice, production of IFN-a and IFN-c was increased, indicating an enhanced cell-mediated immune response. Moreover, hLf-transgenic mice had a stronger potency to clear bacteria and lower infection susceptibility than wild type mice (Guillen et al. 2002). After mice were fed bLf, increased IL-18, interferon-a, and interferonb were found in Peyer’s patches and mesenteric lymph nodes, which leads to enhanced natural killer cell activity (Kuhara et al. 2006). Significantly, Lf displays immunomodulatory activities. Effects of Lf on immune responses depend on the scenario. In virusor bacterial- infected models, Lf exhibits anti-inflammatory activity by decreasing secretion of pro-inflammatory cytokines. In pigs who developed necrotizing enterocolitis (NEC), bLf decreased secretion of IL-1 b and IL-8 and prevented NF-kB and hypoxia-inducible factor-1a (HIF-1a) activation, indicating anti-
123
Acknowledgments We thank Dr. Jean-Franc¸ois Beaulieu for providing non-transformed human crypt intestinal epithelial cells. We gratefully acknowledge the assistance of Siranoosh Ashtari at the Expression Facility at University of California, Davis with microarray assays. This work was supported by a grant from Mead Johnson Nutrition.
35
(ABL2, ARHGEF11, CCRN4L CD44, CDK1, CDKN2B, DKK3, DLC1, FZD8, HDAC7, IGF2, IGF1R, IGFBP3, LIMK2, LRP1, MYC, PPP1CB,PPP2R3B, PPP2R5D, RFC2, WNT5A) Humoral immune response (IFIT1, IFIT3, IFNAR2, NFKB2, NFATC3, MADD, ITGA1)
inflammatory effects (Tian et al. 2010). Similar results were found in LPS treated rats, as decreased concentrations of serum TNF-a and IL-6 were seen upon bLf treatments (Tang et al. 2012). All three Lfs exhibited similar net effects on intestinal and immune development of intestinal epithelial cells via activating the same or functionally similar signaling pathways. In the present study, a primary human intestinal cell line was used. To further investigate and compare functions of Lfs, animal studies are required to confirm these results in the future.
Amin E et al (2013) Rho-kinase: regulation, (dys)function, and inhibition. Biol Chem 394:1399–1410 Buccigrossi V, de Marco G, Bruzzese E, Ombrato L, Bracale I, Polito G, Guarino A (2007) Lactoferrin induces concentration-dependent functional modulation of intestinal proliferation and differentiation. Pediatr Res 61:410–414 Cheng H (1974) Origin, differentiation and renewal of the four main epithelial cell types in the mouse small intestine. IV. Paneth cells. Am J Anat 141:521–535 Clevers H (2006) Wnt/beta-catenin signaling in development and disease. Cell 127:469–480 Cooper CA, Nelson KM, Maga EA, Murray JD (2013) Consumption of transgenic cows’ milk containing human lactoferrin results in beneficial changes in the gastrointestinal tract and systemic health of young pigs. Transgenic Res 22:571–578 Davidson LA, Lo¨nnerdal B (1987) Persistence of human milk proteins in the breast-fed infant. Acta Paediatr Scand 76:733–740 Deschenes C, Alvarez L, Lizotte ME, Vezina A, Rivard N (2004) The nucleocytoplasmic shuttling of E2F4 is involved in the regulation of human intestinal epithelial cell proliferation and differentiation. J Cell Physiol 199:262–273 Drozdowski LA, Clandinin T, Thomson AB (2010) Ontogeny, growth and development of the small intestine: understanding pediatric gastroenterology. World J Gastroenterol 16:787–799 Engle MJ, Goetz GS, Alpers DH (1998) Caco-2 cells express a combination of colonocyte and enterocyte phenotypes. J Cell Physiol 174:362–369 Gagne D, Groulx JF, Benoit YD, Basora N, Herring E, Vachon PH, Beaulieu JF (2010) Integrin-linked kinase regulates migration and proliferation of human intestinal cells under
Biometals a fibronectin-dependent mechanism. J Cell Physiol 222: 387–400 Glinka A, Wu W, Delius H, Monaghan AP, Blumenstock C, Niehrs C (1998) Dickkopf-1 is a member of a new family of secreted proteins and functions in head induction. Nature 391:357–362 Guillen C et al (2002) Enhanced Th1 response to Staphylococcus aureus infection in human lactoferrin-transgenic mice. J Immunol 168:3950–3957 He J, Furmanski P (1995) Sequence specificity and transcriptional activation in the binding of lactoferrin to DNA. Nature 373:721–724 Ivashkiv LB, Donlin LT (2014) Regulation of type I interferon responses. Nat Rev Immunol 14:36–49 Jiang R, Lo¨nnerdal B (2012) Apo- and holo-lactoferrin stimulate proliferation of mouse crypt cells but through different cellular signaling pathways. Int J Biochem Cell Biol 44:91–100 Jiang R, Lopez V, Kelleher SL, Lo¨nnerdal B (2011) Apo- and holo-lactoferrin are both internalized by lactoferrin receptor via clathrin-mediated endocytosis but differentially affect ERK-signaling and cell proliferation in Caco-2 cells. J Cell Physiol 226:3022–3031 Kim JS, Jordan MS (2013) Diversity of IL-17-producing T lymphocytes. Cell Mol Life Sci 70:2271–2290 Koletzko B et al (1998) Growth, development and differentiation: a functional food science approach. Br J Nutr 80(Suppl 1):S5–S45 Kuhara T, Yamauchi K, Tamura Y, Okamura H (2006) Oral administration of lactoferrin increases NK cell activity in mice via increased production of IL-18 and type I IFN in the small intestine. J Interferon Cytokine Res 26:489–499 Kuhara T, Tanaka A, Yamauchi K, Iwatsuki K (2014) Bovine lactoferrin ingestion protects against inflammation via IL11 induction in the small intestine of mice with hepatitis. Br J Nutr 111(10):1801–1810 Legrand D, Elass E, Carpentier M, Mazurier J (2006) Interactions of lactoferrin with cells involved in immune function. Biochem Cell Biol 84:282–290 Legrand D, Pierce A, Elass E, Carpentier M, Mariller C, Mazurier J (2008) Lactoferrin structure and functions. Adv Exp Med Biol 606:163–194 Levy E, Beaulieu JF, Delvin E, Seidman E, Yotov W, Basque JR, Menard D (2000) Human crypt intestinal epithelial cells are capable of lipid production, apolipoprotein synthesis, and lipoprotein assembly. J Lipid Res 41:12–22 Liao Y, Jiang R, Lo¨nnerdal B (2012) Biochemical and molecular impacts of lactoferrin on small intestinal growth and development during early life. Biochem Cell Biol 90:476–484 Lo¨nnerdal B, Iyer S (1995) Lactoferrin: molecular structure and biological function. Annu Rev Nutr 15:93–110 Lonnerdal B, Jiang R, Du X (2011) Bovine lactoferrin can be taken up by the human intestinal lactoferrin receptor and exert bioactivities. J Pediatr Gastroenterol Nutr 53:606–614 Lopez V, Suzuki YA, Lo¨nnerdal B (2006) Ontogenic changes in lactoferrin receptor and DMT1 in mouse small intestine: implications for iron absorption during early life. Biochem Cell Biol 84:337–344 Lopez V, Kelleher SL, Lo¨nnerdal B (2008) Lactoferrin receptor mediates apo- but not holo-lactoferrin internalization via
clathrin-mediated endocytosis in trophoblasts. Biochem J 411:271–278 Mariller C, Benaissa M, Hardiville S, Breton M, Pradelle G, Mazurier J, Pierce A (2007) Human delta-lactoferrin is a transcription factor that enhances Skp1 (S-phase kinaseassociated protein) gene expression. FEBS J 274:2038– 2053 Marshall K (2004) Therapeutic applications of whey protein. Altern Med Rev 9:136–156 Marvaldi J, Mangeat P, Ahmed OA, Coeroli C, Marchis-Mouren G (1979) Activation of cyclic AMP-dependent protein kinases in human gut adenocarcinoma (HT 29) cells in culture. Biochim Biophys Acta 588:12–19 Nguyen DN, Li Y, Sangild PT, Bering SB, Chatterton DE (2014) Effects of bovine lactoferrin on the immature porcine intestine. Br J Nutr 111:321–331 Nichols BL, McKee KS, Henry JF, Putman M (1987) Human lactoferrin stimulates thymidine incorporation into DNA of rat crypt cells. Pediatr Res 21:563–567 Pacora P, Maymon E, Gervasi MT, Gomez R, Edwin SS, Yoon BH, Romero R (2000) Lactoferrin in intrauterine infection, human parturition, and rupture of fetal membranes. Am J Obstet Gynecol 183:904–910 Papp K, Szittner Z, Prechl J (2012) Life on a microarray: assessing live cell functions in a microarray format. Cell Mol Life Sci 69:2717–2725 Perin NM, Clandinin T, Thomson AB (1997) Importance of milk and diet on the ontogeny and adaptation of the intestine. J Pediatr Gastroenterol Nutr 24:419–425 Reya T et al (2003) A role for Wnt signalling in self-renewal of haematopoietic stem cells. Nature 423:409–414 Saenz SA, Taylor BC, Artis D (2008) Welcome to the neighborhood: epithelial cell-derived cytokines license innate and adaptive immune responses at mucosal sites. Immunol Rev 226:172–190 Son KN, Park J, Chung CK, Chung DK, Yu DY, Lee KK, Kim J (2002) Human lactoferrin activates transcription of IL1beta gene in mammalian cells. Biochem Biophys Res Commun 290:236–241 Spik G, Brunet B, Mazurier-Dehaine C, Fontaine G, Montreuil J (1982) Characterization and properties of the human and bovine lactotransferrins extracted from the faeces of newborn infants. Acta Paediatr Scand 71:979–985 Suzuki YA, Wong H, Ashida KY, Schryvers AB, Lo¨nnerdal B (2008) The N1 domain of human lactoferrin is required for internalization by caco-2 cells and targeting to the nucleus. Biochemistry 47:10915–10920 Tang XS et al (2012) Dietary supplementation with bovine lactoferrampin-lactoferricin produced by Pichia pastoris fed-batch fermentation affects intestinal microflora in weaned piglets. Appl Biochem Biotechnol 168:887–898 Tian H, Maddox IS, Ferguson LR, Shu Q (2010) Influence of bovine lactoferrin on selected probiotic bacteria and intestinal pathogens. Biometals 23:593–596 Wenzl E, Sjaastad MD, Weintraub WH, Machen TE (1989) Intracellular pH regulation in IEC-6 cells, a cryptlike intestinal cell line. Am J Physiol 257:G732–G740 Zhang P, Sawicki V, Lewis A, Hanson L, Nuijens JH, Neville MC (2001) Human lactoferrin in the milk of transgenic mice increases intestinal growth in ten-day-old suckling neonates. Adv Exp Med Biol 501:107–113
123
