Transdifferentiation of Human Fibroblasts to Endothelial Cells: Role of Innate Immunity Nazish Sayed, Wing Tak Wong, Frank Ospino, Shu Meng, Jieun Lee, Arshi Jha, Philip Dexheimer, Bruce J. Aronow and John P. Cooke Circulation. published online October 30, 2014; Circulation is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231 Copyright © 2014 American Heart Association, Inc. All rights reserved. Print ISSN: 0009-7322. Online ISSN: 1524-4539
The online version of this article, along with updated information and services, is located on the World Wide Web at: http://circ.ahajournals.org/content/early/2014/10/30/CIRCULATIONAHA.113.007394
Data Supplement (unedited) at: http://circ.ahajournals.org/content/suppl/2014/10/30/CIRCULATIONAHA.113.007394.DC1.html
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published in Circulation can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for which permission is being requested is located, click Request Permissions in the middle column of the Web page under Services. Further information about this process is available in the Permissions and Rights Question and Answer document. Reprints: Information about reprints can be found online at: http://www.lww.com/reprints Subscriptions: Information about subscribing to Circulation is online at: http://circ.ahajournals.org//subscriptions/
Downloaded from http://circ.ahajournals.org/ at Marquette University on November 4, 2014
DOI: 10.1161/CIRCULATIONAHA.113.007394
Transdifferentiation of Human Fibroblasts to Endothelial Cells: Role of Innate Immunity
Running title: Sayed et al.; Innate immunity pathway in transdifferentiation Nazish Sayed, MD, PhD1*; Wing Tak Wong, PhD1*; Frank Ospino, BS1, Shu Meng, PhD1; Jieun Lee, PhD2; Arshi Jha, MS2; Phillip Dexheimer, MS3; Bruce J. Aronow, PhD3, John P. Cooke, MD, PhD1
1
Dept De pt ooff Ca Cardiovascular ard rdio diovascular Sciences, Houstonn Methodist M thodist Research Me Resear arch Institute, Ins nsti titute, Houston, TX;
2
Division Divisi ion n ooff Ca Car Cardiovascular rd ova rdio vasc scul sc ular ul ar M Medicine, ed dic icin ine,, S Stanford tanfford Un Univ University, iver e si er sity ty, y St Stan Stanford, anfo f rd, CA CA;; 3Di Division Divi visi vi s on si n ooff
Biomedical B om Bi omed ed dic ical al Informatics, Infor nforma mati ticss, Cincinnati Cinc Ci ncin nc inna in naati Children’s Chi hild dre renn’ss Hospital Hoosppittal Medical Mediccal a Center, Cente enteer, r C Cincinnati, inci in cinnnaati,, O ci OH H *contributed *con *c ontr trib ibut uted ed eequally qual qu ally y
Address for Correspondence: John P. Cooke, MD, PhD Professor and Chair, Department of Cardiovascular Sciences Houston Methodist Research Institute 6670 Bertner Ave Houston TX 77030 Tel/Fax: 713-441-0601 E-mail: [email protected] Journal Subject Codes: Vascular biology:[95] Endothelium/vascular type/nitric oxide, Vascular biology:[97] Other vascular biology, Basic science research:[129] Angiogenesis, Basic science research:[130] Animal models of human disease 1 Downloaded from http://circ.ahajournals.org/ at Marquette University on November 4, 2014
DOI: 10.1161/CIRCULATIONAHA.113.007394
Abstract
Background—Cell fate is fluid, and may be altered experimentally by the forced expression of master regulators mediating cell lineage. Such reprogramming has been achieved using viral vectors encoding transcription factors. We recently discovered that the viral vectors are more than passive vehicles for transcription factors, as they participate actively in the process of nuclear reprogramming to pluripotency by increasing epigenetic plasticity. Based on this recognition, we hypothesized that small molecule activators of toll-like receptor 3 (TLR3), together with external microenvironmental cues that drive EC specification, might be sufficient to induce transdifferentiation of fibroblasts into ECs (iECs). Methods and Results—We show that TLR3 agonist Poly I:C, combined with exogenous EC growth factors, transdifferentiated human fibroblasts into ECs. These iECs were co omp m ar arab able le tto o comparable HMVEC in immunohistochemical, genetic and functional assays, including the aability bili bili l ty tto o fo form rm capillary-like structures and to incorporate acetylated-LDL. Furthermore, iECs significantly mpr prov oved ov ed llimb im mb pe erf r us u ion and neovascularizationn iin n the murine ischemi miic hi hhindlimb. ndlimb. Finally, using improved perfusion ischemic ge eneeti tic knoc ckdow kdow wn st stud udie ud iees, w find n tthat nd hat tthe he eeffective ffec ff ectiive ttransdifferentiation raans nsdi d fffer di eren enti en tiat atio io on off hhuman uman um an ffibroblasts ibro ib robl ro bllas asts ts to genetic knockdown studies, wee fi en end ndothelial do cells re equiires inna natte imm na mmuune act tivvatioon. on. endothelial requires innate immune activation. Co onc nclu lusi lu sion on ns—T —Thi hiis study sttuddy suggests suugg g es ests ts that thaat manipulation mannipu ma pula pu lattioon on of innate inn nnat atte immune im mmu munne signaling sig ignnali nali ling ng m ay y bee Conclusions—This may gene ge nera ne rall ra llyy used ll used to to modify modi mo dify di fy cell cel elll fate. fate fa te. As similar te sim imil ilaar si il sign gnal gn alin al ingg pa in path thwa th ways wa ys aare re ac acti tiva ti vate va tedd by ddamage te amag am agee ag generally signaling pathways activated asso as soci ciat ated ed molecular mol olec ecul ular ar patterns, pat atte tern rnss epigenetic epi pige gene neti ticc plasticity plas pl asti tici city ty induced ind nduc uced ed by by innate inna in nate te immunity imm mmun unit ityy may may play play a associated fundamental role in transdifferentiation during wound healing and regeneration. Finally, this study is a first step toward development of a small molecule strategy for therapeutic transdifferentiation for vascular disease.
Key words: endothelial cell, endothelial function, stem cell, transdifferentiation, immune system
2 Downloaded from http://circ.ahajournals.org/ at Marquette University on November 4, 2014
DOI: 10.1161/CIRCULATIONAHA.113.007394
Introduction Shinya Yamanaka received the Nobel Prize for Medicine or Physiology in 2012 for his discovery that the forced expression of the transcription factors Oct4, Sox2, Klf4 and cMyc (“OSKM”) can induce nuclear reprogramming of somatic cells to induced pluripotent stem cells (iPSCs)1, 2. We recently discovered that the retroviral vectors used in nuclear reprogramming are more than mere vehicles for the transcription factors. Indeed, by activating innate immune signaling (through Toll-like receptor 3; TLR3) these viral vectors cause global changes in the expression and activity of epigenetic modifiers. Specifically, viral dsRNA stimulated TLR3-activated transcriptional pathways (mediated by NF-țB and IRF3) that caused global changes in epigenetic modifiers (e.g. downregulation of the histone de-acetylase [HDAC] family; upregulation upreegu gula l tiion of la of histone acetyltransferases [HATs]). The altered expression of epigenetic enzymes favored hi istton onee modifications mod mo dificaati dif tioons on that facilitated activation ooff eendogenous ndogenous ge ene n s in n tthe he core pluripotency histone genes nnetwork etw work3. Fina Finally, nall l y, as as demonstrated deemo mons nsttrat ns tratted by by gaingain n- and and lo loss-of-function oss--of -of-fu f-fu uncti tioon on studies, stu tudi d es, innate in nnate nate immune immun mmun unee signaling ign gnal alin al ingg al in also so pparticipated arti tiici cipa pate teed in n tthe he iinduction nduc nd uccti tion on ooff ppluripotency lurrippot lu potenc tenc ncyy us using sin ingg ot othe other h r meth he m methods, eth hod ods, s iincluding s, nclu nc luddinng ng mmRNA-based mmRNA-ba aseed re reprogramming, epr prog ogra og r mm ra mmin i g, aand in nd re reprogramming epr prog ogra og ramm ra mmin mm ingg off ssomatic in omat om attic ce cell cells llss co ll cont containing n ai nt a niing tthe he ddoxoxinducible cassete encoding OKSM. Dr. Yamanaka’s discovery has stimulated others to search for sets of transcriptional factors that may induce transdifferentiation to another somatic cell type, also known as direct reprogramming. Indeed, several groups have converted fibroblasts to neurons4, cardiomyocytes5 or ECs6, 7 by overexpressing specific transcription factors. In each of these cases, transdifferentiation was induced using viral vectors encoding transcription factors. However, for clinical applications, it would be more desirable to develop strategies that avoid genetic manipulation. Accordingly, we sought to demonstrate that safe and functional ECs can be
3 Downloaded from http://circ.ahajournals.org/ at Marquette University on November 4, 2014
DOI: 10.1161/CIRCULATIONAHA.113.007394
generated from fibroblasts using small molecules alone. Cognizant of the role of innate immunity in nuclear reprogramming, and its directed manipulation to increase epigenetic plasticity, we hypothesized that activation of TLR3, together with inductive growth cues, may be sufficient to induce the transdifferentiation of fibroblasts into ECs (“iECs”).
Methods Cell Culture and iEC generation BJ human newborn foreskin fibroblast cells (Stemgent), tail-tip fibroblasts isolated from 6-week old Tie2GFP knock-in and TLR3 knock-out mice were cultured and maintained in DMEM with 10% FBS and 1% penicillin/streptomycin (5% CO2, 37°C). Human Dermal Mic Microvascular cro rova vasc va scul sc ular ul ar Endothelial Cells (HMVEC, Lonza) were cultured with endothelial cell growth medium-2MV (EGM-2, EGM GM M-2 -2,, Lonza). L nz Lo n a)). For For iEC generation, BJ fibroblasts fibrobblas asts t were seeded on ge gela gelatin-coated l tin-coated plates and la af fteer overnigh ghht cult cculture, ulturre, ccells ellss w ells eree tr er trea eate ea tedd wi with th hP oly I:C C (3 (30n 0ng/ 0n g ml) g/ ml an andd th the me medi dium di um cchanged hang ha ngged tto o after overnight were treated Poly (30ng/ml) medium DM DMEM MEM E withh 7. 77.5% 5% % FBS FBS and nd 77.5% .5% .5 % kn kno knockout ockout kout serum seerum erum m replacement rep plaace ceme ment ((KSR). me KSR). W KSR) With ith da ith dail daily ilyy ttreatments reaatm men ntss of Poly Po ly I:C I:C for for 7 days, day ayss, the the medium med ediu ium iu m was was gradually grad gr adua ad uall ua llyy transitioned ll tran tr ansi an siti si tion ti oned on ed tto o co cont contain ntai nt ainn 10 ai 10% % KS KSR KSR. R. F Following ollo ol lowi lo wing wi ng these treatments, cells were treated with transdifferentiation medium containing 20ng/ml bone morphogenetic protein-4 (BMP-4, Peprotech), 50ng/ml vascular endothelial growth factor (VEGF, Peprotech) and 20ng/ml basic fibroblast growth factor (bFGF, BD Bioscience) for another 7 days. Transdifferentiation medium was changed every 2 days. For maintenance of transdifferentiation, the cells were cultured for another 2 weeks in the presence of bFGF, VEGF and 0.1mM 8-bromoadenosine-3’:5’-cyclic monophosphate sodium salt (8-Br-cAMP, Sigma), with the medium changed every 2 days. Fluorescence Activated Cell Sorting (FACS) On day 28 of transdifferentiation, the iECs were purified using FACS. Cells were dissociated
4 Downloaded from http://circ.ahajournals.org/ at Marquette University on November 4, 2014
DOI: 10.1161/CIRCULATIONAHA.113.007394
into single cells with Accutase (Life Technologies) for 5 minutes at 37°C, washed with 1x PBS containing 5% BSA and passed through a 70-ȝm cell strainer. Cells were then incubated with either Alexa Fluor 488-conjugated CD31 antibody (eBioscience) or PE-conjugated CD144 antibody (eBioscience) for 30 mins. Isotype-matched antibody served as negative control. The purified iECs were expanded in EGM-2 media and 10uM SB431542, a specific TGFȕ receptor inhibitor that promotes ESC-derived endothelial cell growth and sheet formation6, 8. RNA extraction and quantitative PCR Using RNeasy Mini Kit (Qiagen), total RNA was extracted and quantitative polymerase chain reaction was performed using Taqman gene expression assays (Applied Biosystems). Genes associated with the EC phenotype were analyzed with the data normalized to ȕ-actin ȕ-aactin ctin n housekeeping gene and expressed as relative fold changes using the ǻCt method of analysis. mmu mun nofl nofl fluo u resc uo sccent en staining Immunofluorescent ECs Cs were fixed fixe xedd with with h 4% 4% paraformaldehyde, para pa rafform ra form mald aldehydee, ppermeabilized erm meabiili lize zedd with with h 00.1% .11% T rit iton on X -1 1000, bl bblocked ocke oc ked ke iECs Triton X-100, wi with ith 1% 1% normal noorm rmal al goat gooat oat serum seru se r m and ru a d stained an stai st aine ai need for for anti-human an nti ti-h -h hum man an CD31 CD311 (R&D (R R&D S Systems), ysstem stem ms)), an anti-human nti ti-hum uman um an CD144 (R&D D Systems), Sys yste tems te m ), ms ) anti-human ant n ii hu uma m n eNOS eN NOS (BD (BD Transduction Tran Tr ansdduc an ucti t on Laboratories), ti Lab a or orat ator at orie or ies) ie s), anti-human s) anti an t -h ti hum uman von Willebrand factor (vWF, Abcam) and anti-KDR (R&D Systems) overnight at 4oC. After washes with PBS, the cells were treated with Alexa Fluor-488 or -594 secondary antibodies. Functional Assays The functions of the generated iECs were characterized in angiogenic assays and compared to HMVECs and fibroblasts. Uptake of Ac-LDL: was evaluated by incubating cells with ac-LDL594 at 1:200 dilution for 5 hours before washing the cells with PBS and then measuring the mean fluorescence of the cells in 10 high power fields. Vascular tube-like formation: The ability of the cells to form tube-like structures was assessed in vitro by seeding 104 cells in wells coated with
5 Downloaded from http://circ.ahajournals.org/ at Marquette University on November 4, 2014
DOI: 10.1161/CIRCULATIONAHA.113.007394
matrigel in the presence of EGM-2 media containing 50ng/ml VEGF and incubated for 24 h. NO production: The ability of the cells to produce NO was assessed by measuring the concentration of NO in the culture medium using the NO detection kit (Molecular Probe, Carlsbad, CA) according to the manufacturer’s instructions. The amount of nitrate was determined by converting it to nitrite, followed by the colorimetric determination of the total concentration of nitrite as a colored azo dye product of the Griess reaction that absorbed visible light at 540 nm using a microplate reader. In vivo matrigel angiogenesis assay: To assess the capacity of the iECs to form functional vessels in vivo, matrigel was mixed with 5 x 105 iECs in a final volume of 200ȝl and injected subcutaneously into the lower abdominal region of SCID mice. After 2 weeks, the matrigel plugs were dissected, fixed in 4% paraformalde paraformaldehyde deehy ydee aand nd stained tained for human CD31. Assa As Assay sayy for sa for an aangiogenic g oggenic gi en cytokines H Human um man Angiogenesis Angiog ogeenesis is Proteome Prrote rote teom omee Profiler™ om Proofil Pr ofiler er™ ™ antibody antibo ant ody y arrays arrra rrays ays (R&D (R R&D D Systems) Sys ysttem tems) ms) were were we re used useed too assess asssesss the various he va vari r ou ri ouss cytokines cyto cy tokkinnes nes secreted secr se cret e ed by by the the iECs iE ECs in in hypoxic hyppox hy poxic xi conditions. co ond ndiitio ions io nss. Briefly, Brie Br iefflyy, y, iECs iEC ECss were werre grown we gro own inn hypoxic cond condition dit itio ionn (1 io (1% % O2) for fo 8 hr h and andd the the conditioned con ondi diitiionned d media medi d a pooled, poolled po ed,, filtered filt fi lter lt ered er ed d aand nd iincubated n ubated nc with the antibody cocktail (1:1000) for 1 h at RT. The nitrocellulose membrane was then blocked and the sample/detection antibody cocktail mixture added to the membrane. Following overnight incubation at 4oC, the membrane was washed 3 times before incubation with Steptavidin HRP (1:2000) for 30 min at RT. The membranes were then washed prior to incubation with ECLplus (Amersham, Buckinghamshire, UK). The array data was quantified by densitometry using Image J software. Chromatin Immunoprecipitation and ChIP-qPCR qChIP was performed as previously described (Lim et al., 2009; Peng et al., 2009). For qChIP
6 Downloaded from http://circ.ahajournals.org/ at Marquette University on November 4, 2014
DOI: 10.1161/CIRCULATIONAHA.113.007394
and qRT-PCR, error estimates are standard deviations. Recovery of genomic DNA as the percentage input was calculated as the ratio of copy numbers in the immunoprecipitate to the input control. Primers of CD31 promoter (Li et al., Arterioscler Thromb Vasc Biol. 2013;33(6):1366-75) were custom-designed and synthesized from Invitrogen. Primer Sequence (5’ to 3’) CD31 (F):CGAGACAGAGGGAGGGTCAA CD31 (R):GGCCTGATATCTCCTCAGGAA RNA-seq analysis. RNA-Seq–based expression analysis was carried out using RNA samples converted into individual ndividual cDNA libraries using Illumina (San Diego, CA). TruSeq methods employed em mpl ploy o ed single sin ingl glee gl reads eads of 50 base-lengths sequenced at 20-30 million read depths using the Illumina HiSeq 2500 instrument. nsttru rum ment ment nt.. Trimmed T im Tr mmed me sequences were generatedd as a fastq fastq outputs and and n analyzed ana naly lyzed based on the TopHat/Cufflinks based annotations Ensembl Gencode T oppHat/Cufflin pH inks k ppipeline ipel ip e in ne ba bas sed on rreference sed efeerencce ce ann notatiion ions ns pproduced roduuceed by tthe he E nsem nsem mbl G en nco code d de project. Differential and significant expression wass ca carried out using proj pr ojec oj ecct. t D ifffe fere renntia nt al an nd si sign gnnif i ica cant nt ggene en ne ex expr p es pr essi siionn aanalysis naly na lysi ly sis wa w carr r ied ou rr ut us usin in ng gen ggene-level ene--lev -leveel reads) FPKM (fragments (frag gme ment n s per nt per kilobase k lo ki oba base s of of gene genee locus loc ocuus summarized summ su mmar mm a izzed mRNA ar mRN RNA A per per million mill mi l io ll ionn re read ads) ad s) eexpression xpression levels. Genes were selected using the criteria of an absolute expression level greater than 3 fpkm in either HMVEC or iEC samples with at least two fold higher expression in iEC or HMVEC than fibroblasts. Gene lists relative enrichments for various functional associations was determined using ToppGene9. Hindlimb Ischemia Model To assess the therapeutic potential of iECs, we used a murine model of hindlimb ischemia (HLI)10, 11. Briefly, unilateral HLI was induced by ligating the femoral artery of aged-matched NOD-SCID male mice (Jackson Labs, 13 weeks old). The mice were randomized into several
7 Downloaded from http://circ.ahajournals.org/ at Marquette University on November 4, 2014
DOI: 10.1161/CIRCULATIONAHA.113.007394
groups, each receiving either EGM-2 medium (Controls) or 106 iECs or 106 HMVECs intramuscularly (IM) in the gastrocnemius muscle (n=5 each group). To test the survival and localization of iECs, a similar study was carried out with IM administration of 106 transduced VE-cadherin-expressing iECs. The ischemia score index was modified from Brenes et al. Journal of Vascular Surgery. Volume 56, Issue 6, December 2012, Pages 1669 – 1679. The criteria used were: 0 - No changes; 1 - Discoloration/Necrosis of the nails; 2 Discoloration/Necrosis of the toes; 3 - Foot Necrosis; 4 - Leg Necrosis (up to the gastrocnemius muscle); 5 - Autoamputation (Loss of Limb). There were two independent observers, blinded to the group assignment. Animal studies were approved by the hin in ndllim imbb crosscros cr ossos sAdministrative Panel on Laboratory Animal Care. Total capillary density of hindlimb sections ections was determined by staining the slides with rabbit anti-mouse CD31 (Abcam), foolllow owed ed bby y horseradish hors rsser erad a ish peroxidase-conjugated d se sec condary antibo bo ody.. Qu Quantification of followed secondary antibody. caapill l aries was waas performed perrfor rforrmeed onn four fou ourr different differentt fields dif fiieldss at at magnification magn ma gnif ific i attio ic ionn of 20x. 20x 0x.. The T e capillary Th capi p ll pi llar aryy capillaries density dennsit de nsit ityy is normalized nor orma maaliize z d to o the the total tottal number num umbe beer of of cells cel e lss in in the the field. fieeld. fi d d. Laser Doppler Dopp pleer Based Base Ba s d Tissue se T ss Ti ssue u P ue Perfusion e fu er fusiion M Measurement easu ea sure su r me re m nt Blood flow to the ischemic or normal (nonischemic) hindlimb was assessed using a PeriScan PIM3 laser Doppler system (Perimed AB, Sweden) as described previously11. Animals were prewarmed to a core temperature of 37.5°C and heart rate was constantly monitored for signs of stress from overheating. Hindlimb blood flow was measured pre- and postoperatively on selected days (0, 4, 7, 11, 14 and 18). Blood perfusion rate was measured via laser Doppler scans over a 3 minute cycle. The level of perfusion in the ischemic and normal hindlimbs was quantified using the mean pixel value within the region of interest, and the relative changes in hindlimb blood flow were expressed as the ratio of the left (ischemic) over right (normal)
8 Downloaded from http://circ.ahajournals.org/ at Marquette University on November 4, 2014
DOI: 10.1161/CIRCULATIONAHA.113.007394
LDBP. Short Hairpin RNA Design Short hairpin RNA was obtained from Invivogen. Target sequences: TLR3 shRNA, GCTTGGCTTCCACAACTAGAA. Statistical Analysis Data shown are reported as mean ± standard error of mean (s.e.m.). Differences between groups were calculated by independent t test, 1-way ANOVA corrected with Bonferroni or BenjaminiHochberg method, and also Mann-Whitney non-parametric test whether appropriate. In the RTPCR analyses using independent samples from those used for RNAseq, correlations were regression was evaluated with Spearman nonparametric correlation analysis, and multivariate re egres e sion w a as used for assessments of independence of correlations. Repeated-measures ANOVA followed by multiple Statistical mult mu ltip lt iple ip le ccomparisons o pari om riiso sonns with Bonferroni’s methodd we were used. Statist stical st al significance sig ignificance was accepted P3 3 FPKM in HMVECS HM MVE V CS and and at at least leeasst two-fold t otw o fo old greater gre reat ater at er expression expr ex p esssi pr sion on than tha hann inn fibroblasts; fibr brob obla ob l stts; or la or 2.) 2.) those genes that were expressed at a level >3 FPKM in fibroblasts and at least two-fold greater expression than in HMVECs (Fig. 3). The iECs were highly similar to HMVECs in the up- and down-regulated genes that they shared versus fibroblasts. Indeed, the odds that the overlap of HMVEC and iEC genes was due to chance alone was
The online version of this article, along with updated information and services, is located on the World Wide Web at: http://circ.ahajournals.org/content/early/2014/10/30/CIRCULATIONAHA.113.007394
Data Supplement (unedited) at: http://circ.ahajournals.org/content/suppl/2014/10/30/CIRCULATIONAHA.113.007394.DC1.html
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published in Circulation can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for which permission is being requested is located, click Request Permissions in the middle column of the Web page under Services. Further information about this process is available in the Permissions and Rights Question and Answer document. Reprints: Information about reprints can be found online at: http://www.lww.com/reprints Subscriptions: Information about subscribing to Circulation is online at: http://circ.ahajournals.org//subscriptions/
Downloaded from http://circ.ahajournals.org/ at Marquette University on November 4, 2014
DOI: 10.1161/CIRCULATIONAHA.113.007394
Transdifferentiation of Human Fibroblasts to Endothelial Cells: Role of Innate Immunity
Running title: Sayed et al.; Innate immunity pathway in transdifferentiation Nazish Sayed, MD, PhD1*; Wing Tak Wong, PhD1*; Frank Ospino, BS1, Shu Meng, PhD1; Jieun Lee, PhD2; Arshi Jha, MS2; Phillip Dexheimer, MS3; Bruce J. Aronow, PhD3, John P. Cooke, MD, PhD1
1
Dept De pt ooff Ca Cardiovascular ard rdio diovascular Sciences, Houstonn Methodist M thodist Research Me Resear arch Institute, Ins nsti titute, Houston, TX;
2
Division Divisi ion n ooff Ca Car Cardiovascular rd ova rdio vasc scul sc ular ul ar M Medicine, ed dic icin ine,, S Stanford tanfford Un Univ University, iver e si er sity ty, y St Stan Stanford, anfo f rd, CA CA;; 3Di Division Divi visi vi s on si n ooff
Biomedical B om Bi omed ed dic ical al Informatics, Infor nforma mati ticss, Cincinnati Cinc Ci ncin nc inna in naati Children’s Chi hild dre renn’ss Hospital Hoosppittal Medical Mediccal a Center, Cente enteer, r C Cincinnati, inci in cinnnaati,, O ci OH H *contributed *con *c ontr trib ibut uted ed eequally qual qu ally y
Address for Correspondence: John P. Cooke, MD, PhD Professor and Chair, Department of Cardiovascular Sciences Houston Methodist Research Institute 6670 Bertner Ave Houston TX 77030 Tel/Fax: 713-441-0601 E-mail: [email protected] Journal Subject Codes: Vascular biology:[95] Endothelium/vascular type/nitric oxide, Vascular biology:[97] Other vascular biology, Basic science research:[129] Angiogenesis, Basic science research:[130] Animal models of human disease 1 Downloaded from http://circ.ahajournals.org/ at Marquette University on November 4, 2014
DOI: 10.1161/CIRCULATIONAHA.113.007394
Abstract
Background—Cell fate is fluid, and may be altered experimentally by the forced expression of master regulators mediating cell lineage. Such reprogramming has been achieved using viral vectors encoding transcription factors. We recently discovered that the viral vectors are more than passive vehicles for transcription factors, as they participate actively in the process of nuclear reprogramming to pluripotency by increasing epigenetic plasticity. Based on this recognition, we hypothesized that small molecule activators of toll-like receptor 3 (TLR3), together with external microenvironmental cues that drive EC specification, might be sufficient to induce transdifferentiation of fibroblasts into ECs (iECs). Methods and Results—We show that TLR3 agonist Poly I:C, combined with exogenous EC growth factors, transdifferentiated human fibroblasts into ECs. These iECs were co omp m ar arab able le tto o comparable HMVEC in immunohistochemical, genetic and functional assays, including the aability bili bili l ty tto o fo form rm capillary-like structures and to incorporate acetylated-LDL. Furthermore, iECs significantly mpr prov oved ov ed llimb im mb pe erf r us u ion and neovascularizationn iin n the murine ischemi miic hi hhindlimb. ndlimb. Finally, using improved perfusion ischemic ge eneeti tic knoc ckdow kdow wn st stud udie ud iees, w find n tthat nd hat tthe he eeffective ffec ff ectiive ttransdifferentiation raans nsdi d fffer di eren enti en tiat atio io on off hhuman uman um an ffibroblasts ibro ib robl ro bllas asts ts to genetic knockdown studies, wee fi en end ndothelial do cells re equiires inna natte imm na mmuune act tivvatioon. on. endothelial requires innate immune activation. Co onc nclu lusi lu sion on ns—T —Thi hiis study sttuddy suggests suugg g es ests ts that thaat manipulation mannipu ma pula pu lattioon on of innate inn nnat atte immune im mmu munne signaling sig ignnali nali ling ng m ay y bee Conclusions—This may gene ge nera ne rall ra llyy used ll used to to modify modi mo dify di fy cell cel elll fate. fate fa te. As similar te sim imil ilaar si il sign gnal gn alin al ingg pa in path thwa th ways wa ys aare re ac acti tiva ti vate va tedd by ddamage te amag am agee ag generally signaling pathways activated asso as soci ciat ated ed molecular mol olec ecul ular ar patterns, pat atte tern rnss epigenetic epi pige gene neti ticc plasticity plas pl asti tici city ty induced ind nduc uced ed by by innate inna in nate te immunity imm mmun unit ityy may may play play a associated fundamental role in transdifferentiation during wound healing and regeneration. Finally, this study is a first step toward development of a small molecule strategy for therapeutic transdifferentiation for vascular disease.
Key words: endothelial cell, endothelial function, stem cell, transdifferentiation, immune system
2 Downloaded from http://circ.ahajournals.org/ at Marquette University on November 4, 2014
DOI: 10.1161/CIRCULATIONAHA.113.007394
Introduction Shinya Yamanaka received the Nobel Prize for Medicine or Physiology in 2012 for his discovery that the forced expression of the transcription factors Oct4, Sox2, Klf4 and cMyc (“OSKM”) can induce nuclear reprogramming of somatic cells to induced pluripotent stem cells (iPSCs)1, 2. We recently discovered that the retroviral vectors used in nuclear reprogramming are more than mere vehicles for the transcription factors. Indeed, by activating innate immune signaling (through Toll-like receptor 3; TLR3) these viral vectors cause global changes in the expression and activity of epigenetic modifiers. Specifically, viral dsRNA stimulated TLR3-activated transcriptional pathways (mediated by NF-țB and IRF3) that caused global changes in epigenetic modifiers (e.g. downregulation of the histone de-acetylase [HDAC] family; upregulation upreegu gula l tiion of la of histone acetyltransferases [HATs]). The altered expression of epigenetic enzymes favored hi istton onee modifications mod mo dificaati dif tioons on that facilitated activation ooff eendogenous ndogenous ge ene n s in n tthe he core pluripotency histone genes nnetwork etw work3. Fina Finally, nall l y, as as demonstrated deemo mons nsttrat ns tratted by by gaingain n- and and lo loss-of-function oss--of -of-fu f-fu uncti tioon on studies, stu tudi d es, innate in nnate nate immune immun mmun unee signaling ign gnal alin al ingg al in also so pparticipated arti tiici cipa pate teed in n tthe he iinduction nduc nd uccti tion on ooff ppluripotency lurrippot lu potenc tenc ncyy us using sin ingg ot othe other h r meth he m methods, eth hod ods, s iincluding s, nclu nc luddinng ng mmRNA-based mmRNA-ba aseed re reprogramming, epr prog ogra og r mm ra mmin i g, aand in nd re reprogramming epr prog ogra og ramm ra mmin mm ingg off ssomatic in omat om attic ce cell cells llss co ll cont containing n ai nt a niing tthe he ddoxoxinducible cassete encoding OKSM. Dr. Yamanaka’s discovery has stimulated others to search for sets of transcriptional factors that may induce transdifferentiation to another somatic cell type, also known as direct reprogramming. Indeed, several groups have converted fibroblasts to neurons4, cardiomyocytes5 or ECs6, 7 by overexpressing specific transcription factors. In each of these cases, transdifferentiation was induced using viral vectors encoding transcription factors. However, for clinical applications, it would be more desirable to develop strategies that avoid genetic manipulation. Accordingly, we sought to demonstrate that safe and functional ECs can be
3 Downloaded from http://circ.ahajournals.org/ at Marquette University on November 4, 2014
DOI: 10.1161/CIRCULATIONAHA.113.007394
generated from fibroblasts using small molecules alone. Cognizant of the role of innate immunity in nuclear reprogramming, and its directed manipulation to increase epigenetic plasticity, we hypothesized that activation of TLR3, together with inductive growth cues, may be sufficient to induce the transdifferentiation of fibroblasts into ECs (“iECs”).
Methods Cell Culture and iEC generation BJ human newborn foreskin fibroblast cells (Stemgent), tail-tip fibroblasts isolated from 6-week old Tie2GFP knock-in and TLR3 knock-out mice were cultured and maintained in DMEM with 10% FBS and 1% penicillin/streptomycin (5% CO2, 37°C). Human Dermal Mic Microvascular cro rova vasc va scul sc ular ul ar Endothelial Cells (HMVEC, Lonza) were cultured with endothelial cell growth medium-2MV (EGM-2, EGM GM M-2 -2,, Lonza). L nz Lo n a)). For For iEC generation, BJ fibroblasts fibrobblas asts t were seeded on ge gela gelatin-coated l tin-coated plates and la af fteer overnigh ghht cult cculture, ulturre, ccells ellss w ells eree tr er trea eate ea tedd wi with th hP oly I:C C (3 (30n 0ng/ 0n g ml) g/ ml an andd th the me medi dium di um cchanged hang ha ngged tto o after overnight were treated Poly (30ng/ml) medium DM DMEM MEM E withh 7. 77.5% 5% % FBS FBS and nd 77.5% .5% .5 % kn kno knockout ockout kout serum seerum erum m replacement rep plaace ceme ment ((KSR). me KSR). W KSR) With ith da ith dail daily ilyy ttreatments reaatm men ntss of Poly Po ly I:C I:C for for 7 days, day ayss, the the medium med ediu ium iu m was was gradually grad gr adua ad uall ua llyy transitioned ll tran tr ansi an siti si tion ti oned on ed tto o co cont contain ntai nt ainn 10 ai 10% % KS KSR KSR. R. F Following ollo ol lowi lo wing wi ng these treatments, cells were treated with transdifferentiation medium containing 20ng/ml bone morphogenetic protein-4 (BMP-4, Peprotech), 50ng/ml vascular endothelial growth factor (VEGF, Peprotech) and 20ng/ml basic fibroblast growth factor (bFGF, BD Bioscience) for another 7 days. Transdifferentiation medium was changed every 2 days. For maintenance of transdifferentiation, the cells were cultured for another 2 weeks in the presence of bFGF, VEGF and 0.1mM 8-bromoadenosine-3’:5’-cyclic monophosphate sodium salt (8-Br-cAMP, Sigma), with the medium changed every 2 days. Fluorescence Activated Cell Sorting (FACS) On day 28 of transdifferentiation, the iECs were purified using FACS. Cells were dissociated
4 Downloaded from http://circ.ahajournals.org/ at Marquette University on November 4, 2014
DOI: 10.1161/CIRCULATIONAHA.113.007394
into single cells with Accutase (Life Technologies) for 5 minutes at 37°C, washed with 1x PBS containing 5% BSA and passed through a 70-ȝm cell strainer. Cells were then incubated with either Alexa Fluor 488-conjugated CD31 antibody (eBioscience) or PE-conjugated CD144 antibody (eBioscience) for 30 mins. Isotype-matched antibody served as negative control. The purified iECs were expanded in EGM-2 media and 10uM SB431542, a specific TGFȕ receptor inhibitor that promotes ESC-derived endothelial cell growth and sheet formation6, 8. RNA extraction and quantitative PCR Using RNeasy Mini Kit (Qiagen), total RNA was extracted and quantitative polymerase chain reaction was performed using Taqman gene expression assays (Applied Biosystems). Genes associated with the EC phenotype were analyzed with the data normalized to ȕ-actin ȕ-aactin ctin n housekeeping gene and expressed as relative fold changes using the ǻCt method of analysis. mmu mun nofl nofl fluo u resc uo sccent en staining Immunofluorescent ECs Cs were fixed fixe xedd with with h 4% 4% paraformaldehyde, para pa rafform ra form mald aldehydee, ppermeabilized erm meabiili lize zedd with with h 00.1% .11% T rit iton on X -1 1000, bl bblocked ocke oc ked ke iECs Triton X-100, wi with ith 1% 1% normal noorm rmal al goat gooat oat serum seru se r m and ru a d stained an stai st aine ai need for for anti-human an nti ti-h -h hum man an CD31 CD311 (R&D (R R&D S Systems), ysstem stem ms)), an anti-human nti ti-hum uman um an CD144 (R&D D Systems), Sys yste tems te m ), ms ) anti-human ant n ii hu uma m n eNOS eN NOS (BD (BD Transduction Tran Tr ansdduc an ucti t on Laboratories), ti Lab a or orat ator at orie or ies) ie s), anti-human s) anti an t -h ti hum uman von Willebrand factor (vWF, Abcam) and anti-KDR (R&D Systems) overnight at 4oC. After washes with PBS, the cells were treated with Alexa Fluor-488 or -594 secondary antibodies. Functional Assays The functions of the generated iECs were characterized in angiogenic assays and compared to HMVECs and fibroblasts. Uptake of Ac-LDL: was evaluated by incubating cells with ac-LDL594 at 1:200 dilution for 5 hours before washing the cells with PBS and then measuring the mean fluorescence of the cells in 10 high power fields. Vascular tube-like formation: The ability of the cells to form tube-like structures was assessed in vitro by seeding 104 cells in wells coated with
5 Downloaded from http://circ.ahajournals.org/ at Marquette University on November 4, 2014
DOI: 10.1161/CIRCULATIONAHA.113.007394
matrigel in the presence of EGM-2 media containing 50ng/ml VEGF and incubated for 24 h. NO production: The ability of the cells to produce NO was assessed by measuring the concentration of NO in the culture medium using the NO detection kit (Molecular Probe, Carlsbad, CA) according to the manufacturer’s instructions. The amount of nitrate was determined by converting it to nitrite, followed by the colorimetric determination of the total concentration of nitrite as a colored azo dye product of the Griess reaction that absorbed visible light at 540 nm using a microplate reader. In vivo matrigel angiogenesis assay: To assess the capacity of the iECs to form functional vessels in vivo, matrigel was mixed with 5 x 105 iECs in a final volume of 200ȝl and injected subcutaneously into the lower abdominal region of SCID mice. After 2 weeks, the matrigel plugs were dissected, fixed in 4% paraformalde paraformaldehyde deehy ydee aand nd stained tained for human CD31. Assa As Assay sayy for sa for an aangiogenic g oggenic gi en cytokines H Human um man Angiogenesis Angiog ogeenesis is Proteome Prrote rote teom omee Profiler™ om Proofil Pr ofiler er™ ™ antibody antibo ant ody y arrays arrra rrays ays (R&D (R R&D D Systems) Sys ysttem tems) ms) were were we re used useed too assess asssesss the various he va vari r ou ri ouss cytokines cyto cy tokkinnes nes secreted secr se cret e ed by by the the iECs iE ECs in in hypoxic hyppox hy poxic xi conditions. co ond ndiitio ions io nss. Briefly, Brie Br iefflyy, y, iECs iEC ECss were werre grown we gro own inn hypoxic cond condition dit itio ionn (1 io (1% % O2) for fo 8 hr h and andd the the conditioned con ondi diitiionned d media medi d a pooled, poolled po ed,, filtered filt fi lter lt ered er ed d aand nd iincubated n ubated nc with the antibody cocktail (1:1000) for 1 h at RT. The nitrocellulose membrane was then blocked and the sample/detection antibody cocktail mixture added to the membrane. Following overnight incubation at 4oC, the membrane was washed 3 times before incubation with Steptavidin HRP (1:2000) for 30 min at RT. The membranes were then washed prior to incubation with ECLplus (Amersham, Buckinghamshire, UK). The array data was quantified by densitometry using Image J software. Chromatin Immunoprecipitation and ChIP-qPCR qChIP was performed as previously described (Lim et al., 2009; Peng et al., 2009). For qChIP
6 Downloaded from http://circ.ahajournals.org/ at Marquette University on November 4, 2014
DOI: 10.1161/CIRCULATIONAHA.113.007394
and qRT-PCR, error estimates are standard deviations. Recovery of genomic DNA as the percentage input was calculated as the ratio of copy numbers in the immunoprecipitate to the input control. Primers of CD31 promoter (Li et al., Arterioscler Thromb Vasc Biol. 2013;33(6):1366-75) were custom-designed and synthesized from Invitrogen. Primer Sequence (5’ to 3’) CD31 (F):CGAGACAGAGGGAGGGTCAA CD31 (R):GGCCTGATATCTCCTCAGGAA RNA-seq analysis. RNA-Seq–based expression analysis was carried out using RNA samples converted into individual ndividual cDNA libraries using Illumina (San Diego, CA). TruSeq methods employed em mpl ploy o ed single sin ingl glee gl reads eads of 50 base-lengths sequenced at 20-30 million read depths using the Illumina HiSeq 2500 instrument. nsttru rum ment ment nt.. Trimmed T im Tr mmed me sequences were generatedd as a fastq fastq outputs and and n analyzed ana naly lyzed based on the TopHat/Cufflinks based annotations Ensembl Gencode T oppHat/Cufflin pH inks k ppipeline ipel ip e in ne ba bas sed on rreference sed efeerencce ce ann notatiion ions ns pproduced roduuceed by tthe he E nsem nsem mbl G en nco code d de project. Differential and significant expression wass ca carried out using proj pr ojec oj ecct. t D ifffe fere renntia nt al an nd si sign gnnif i ica cant nt ggene en ne ex expr p es pr essi siionn aanalysis naly na lysi ly sis wa w carr r ied ou rr ut us usin in ng gen ggene-level ene--lev -leveel reads) FPKM (fragments (frag gme ment n s per nt per kilobase k lo ki oba base s of of gene genee locus loc ocuus summarized summ su mmar mm a izzed mRNA ar mRN RNA A per per million mill mi l io ll ionn re read ads) ad s) eexpression xpression levels. Genes were selected using the criteria of an absolute expression level greater than 3 fpkm in either HMVEC or iEC samples with at least two fold higher expression in iEC or HMVEC than fibroblasts. Gene lists relative enrichments for various functional associations was determined using ToppGene9. Hindlimb Ischemia Model To assess the therapeutic potential of iECs, we used a murine model of hindlimb ischemia (HLI)10, 11. Briefly, unilateral HLI was induced by ligating the femoral artery of aged-matched NOD-SCID male mice (Jackson Labs, 13 weeks old). The mice were randomized into several
7 Downloaded from http://circ.ahajournals.org/ at Marquette University on November 4, 2014
DOI: 10.1161/CIRCULATIONAHA.113.007394
groups, each receiving either EGM-2 medium (Controls) or 106 iECs or 106 HMVECs intramuscularly (IM) in the gastrocnemius muscle (n=5 each group). To test the survival and localization of iECs, a similar study was carried out with IM administration of 106 transduced VE-cadherin-expressing iECs. The ischemia score index was modified from Brenes et al. Journal of Vascular Surgery. Volume 56, Issue 6, December 2012, Pages 1669 – 1679. The criteria used were: 0 - No changes; 1 - Discoloration/Necrosis of the nails; 2 Discoloration/Necrosis of the toes; 3 - Foot Necrosis; 4 - Leg Necrosis (up to the gastrocnemius muscle); 5 - Autoamputation (Loss of Limb). There were two independent observers, blinded to the group assignment. Animal studies were approved by the hin in ndllim imbb crosscros cr ossos sAdministrative Panel on Laboratory Animal Care. Total capillary density of hindlimb sections ections was determined by staining the slides with rabbit anti-mouse CD31 (Abcam), foolllow owed ed bby y horseradish hors rsser erad a ish peroxidase-conjugated d se sec condary antibo bo ody.. Qu Quantification of followed secondary antibody. caapill l aries was waas performed perrfor rforrmeed onn four fou ourr different differentt fields dif fiieldss at at magnification magn ma gnif ific i attio ic ionn of 20x. 20x 0x.. The T e capillary Th capi p ll pi llar aryy capillaries density dennsit de nsit ityy is normalized nor orma maaliize z d to o the the total tottal number num umbe beer of of cells cel e lss in in the the field. fieeld. fi d d. Laser Doppler Dopp pleer Based Base Ba s d Tissue se T ss Ti ssue u P ue Perfusion e fu er fusiion M Measurement easu ea sure su r me re m nt Blood flow to the ischemic or normal (nonischemic) hindlimb was assessed using a PeriScan PIM3 laser Doppler system (Perimed AB, Sweden) as described previously11. Animals were prewarmed to a core temperature of 37.5°C and heart rate was constantly monitored for signs of stress from overheating. Hindlimb blood flow was measured pre- and postoperatively on selected days (0, 4, 7, 11, 14 and 18). Blood perfusion rate was measured via laser Doppler scans over a 3 minute cycle. The level of perfusion in the ischemic and normal hindlimbs was quantified using the mean pixel value within the region of interest, and the relative changes in hindlimb blood flow were expressed as the ratio of the left (ischemic) over right (normal)
8 Downloaded from http://circ.ahajournals.org/ at Marquette University on November 4, 2014
DOI: 10.1161/CIRCULATIONAHA.113.007394
LDBP. Short Hairpin RNA Design Short hairpin RNA was obtained from Invivogen. Target sequences: TLR3 shRNA, GCTTGGCTTCCACAACTAGAA. Statistical Analysis Data shown are reported as mean ± standard error of mean (s.e.m.). Differences between groups were calculated by independent t test, 1-way ANOVA corrected with Bonferroni or BenjaminiHochberg method, and also Mann-Whitney non-parametric test whether appropriate. In the RTPCR analyses using independent samples from those used for RNAseq, correlations were regression was evaluated with Spearman nonparametric correlation analysis, and multivariate re egres e sion w a as used for assessments of independence of correlations. Repeated-measures ANOVA followed by multiple Statistical mult mu ltip lt iple ip le ccomparisons o pari om riiso sonns with Bonferroni’s methodd we were used. Statist stical st al significance sig ignificance was accepted P3 3 FPKM in HMVECS HM MVE V CS and and at at least leeasst two-fold t otw o fo old greater gre reat ater at er expression expr ex p esssi pr sion on than tha hann inn fibroblasts; fibr brob obla ob l stts; or la or 2.) 2.) those genes that were expressed at a level >3 FPKM in fibroblasts and at least two-fold greater expression than in HMVECs (Fig. 3). The iECs were highly similar to HMVECs in the up- and down-regulated genes that they shared versus fibroblasts. Indeed, the odds that the overlap of HMVEC and iEC genes was due to chance alone was
