Vol. 66, No. 4

JOURNAL OF VIROLOGY, Apr. 1992, p. 2495-2504

0022-538X/92/042495-10$02.00/0 Copyright © 1992, American Society for Microbiology

Transformation by Hamster Polyomavirus: Identification and Functional Analysis of the Early Genes LAURENCE GOUTEBROZE AND JEAN FEUNTEUN* Laboratoire d'Oncologie Moleculaire, Centre National de la Recherche ScientifiquelUnite Associee 1158, Institut Gustave Roussy, 94805 Villejuif Cedex, France Received 23 September 1991/Accepted 17 January 1992

A strategy involving polymerase chain reaction amplification of cDNAs was designed to study the expression of the hamster polyomavirus (HaPV) early region in HaPV-transformed rat fibroblasts, productively HaPV-infected cells, and HaPV-induced lymphoma. We identified three mRNAs resulting from alternative splicing of open reading frames leading to coding capacities for three polypeptides with molecular weights similar to those of the murine polyomavirus large T, middle T (MT), and small T (ST) antigens. The corresponding intronless cDNAs direct the in vitro synthesis of polypeptides with the expected electrophoretic mobilities. The biological activities carried by the HaPV early genes were assayed by transfection of appropriate cell systems. The fragment of genomic viral DNA that encodes the three early antigens contains all of the genetic information necessary for immortalization of primary rat embryo fibroblasts and transformation of Flll rat cells. The large T antigen is sufficient for immortalization, although the MT and ST antigens stimulate the growth and modify the phenotype of immortal cell lines. A stringent cooperative effect was observed in the transformation of Flll cells, which requires the simultaneous presence of the MT and ST antigens, as opposed to the transformation by murine polyomavirus, which can be carried out by the MT antigen alone.

Hamster polyomavirus (HaPV) was originally isolated from hair follicle epithelioma arising spontaneously in animals of a horizontally infected colony of Syrian hamsters in Berlin-Buch, Germany. These tumors are keratinized and contain virus particles accumulated exclusively in the differentiated cell layer, in a fashion resembling the papillomavirus-induced tumors (17). When injected into newborn hamsters belonging to a distinct uninfected colony bred in Potsdam, Germany, the virus caused lymphomas and leukemias (16). These tumors do not contain virus particles but, instead, accumulate massive amounts of nonrandomly deleted free viral genomes (26). This tumor profile contrasts with the pattern observed in newborn mice infected with murine polyomavirus which develop a wide spectrum of epithelial tumors, with four predominantly affected targets: mammary glands, salivary glands, hair follicles, and the thymus. Sarcomas are rarely seen, and tumors of hemopoietic cells have never been observed (10, 15). The specificity of tumor profiles is controlled at at least three levels of virus infection: (i) the adsorption, virus entry, and genome uncoating that lead to accumulation of biologically competent viral genomes within the nucleus of an infected cell; (ii) the viral genome transcription and replication that are stringently controlled by cellular factors; and (iii) the specific interaction between viral oncogene products and their cellular targets. In vitro, HaPV can bypass the tissue specificity observed in vivo and, like murine polyomavirus, transforms fibroblasts as illustrated by the acquisition of an unlimited life span in vitro for transfected primary rat embryo fibroblasts and the capacity of transfected immortal rat fibroblasts to form dense foci over a cell monolayer (2). In murine polyomavirus biology it is widely accepted that immortalization is essentially specified by the large T (LT) antigen whereas *

transformation and tumorigenicity are controlled primarily by the middle T (MT) antigen (1, 24, 29). Intronless DNA constructs, representing the cDNAs that code for each of the three HaPV early antigens, were designed on the basis of the early transcript splicing pattern characterized by polymerase chain reaction (PCR). They were cloned under control of the simian virus 40 (SV40) early promoter. The respective biological activities of these cDNA products are described. MATERIALS AND METHODS RNA isolation and cDNA synthesis. Total RNAs were purified by the guanidine isothiocyanate method as previously described (2). Poly(A)+ RNAs were recovered from two passages through oligo(dT) cellulose columns. Reverse transcription of RNAs to cDNAs was accomplished on 1 p,g or less of total RNA, or 20 ng or less of poly(A)+ RNA, by using cloned murine leukemia virus reverse transcriptase Moloney murine leukemia virus (Bethesda Research Laboratories) and the primer oligonucleotide JF19 (5'-GGATCC TCGTCACAGGAGGAACTFGGAGC-3') (nucleotides [nt] 1081 to 1108). For each RNA sample, a 20-,ul reaction mixture containing RNA, 10 pmol of primer, deoxynucleoside triphosphates at 1 mM each, 50 mM Tris-HCl (pH 8.3), 3 mM MgCl2, 75 mM KCI, 10 mM dithiothreitol, 40 U of RNasin, and 200 U of Moloney murine leukemia virus was incubated at 37°C for 45 min. cDNA amplification. Amplification of cDNAs was carried out by the PCR method, in a final volume of 50 ,ul containing 10 ,ul of the cDNA-RNA hybrid solution, 50 pmol each of primer JF19 and either primer JF18 (5'-GAGCTCATGCAA CAGClTTAATACCC) (nt 338 to 362) or JF20 (5'-AGGATCC TGGAGAGTACCTTGCCTGGTGT) (nt 593 to 617), 100 pmol of each deoxynucleoside triphosphate, 10 mM TrisHCI (pH 8.3), 50 mM KCI, 1.5 mM MgCl2, 0.01% (wt/vol) gelatin, and 2 U of Taq polymerase (Amersham). Samples overlaid with 50 p.l of mineral oil were subjected to 30 cycles

Corresponding author. 2495

2496

GOUTEBROZE AND FEUNTEUN

J. VIROL. E

CM

N-

=_ 0 q X b.

J0

CC= o .

wIL

I1I I

I

Lac

UV5

v

J 11 I

cma10

0

v01

"ao 0

v c N_ 00) N

z--_=

a:

-Cmaz

LL

I1 11 Iv IT

X

O-

a

I v

SV40 PROMOTER

II

a

a

u

cj

11 I v

I

HAPV EARLY REGION

I v

I

POLYLINKER

(2986 bp)

(95 bp) (455 bp)

a.-

C X -0 X0 U o =0 _*L0. coS FIG. 1. Map of pGHa24, used as an expression vector for HaPV early genes. The SV40 early promoter directs the expression of the genomic HaPV early region, including its polyadenylation signals. The indicated restriction sites are those which were used to construct derivatives of this vector expressing the three individual intronless cDNAs.

X I .4 0

of PCR in a Perkin-Elmer Cetus DNA Thermal Cycler, each cycle including 1 min at 94°C (denaturation), 1 min at 60°C (annealing), and 2 min at 72°C (elongation). Following amplification, samples were extracted with 50 ,ul of chloroform and submitted to agarose gel analysis. The gels were blotted onto nylon filters (GeneScreen; Du Pont) which were hybridized with in vitro-labelled HaPV DNA. Sequencing of amplified cDNAs. Splice junctions were identified by cloning and sequencing of the cDNAs amplified by PCR. The purified PCR products were digested with EcoRI (nt 1024) and MboI (nt 731), for the fragment amplified with JF19 and JF20, or EcoRI and HaeIII (nt 413), for the fragment amplified with JF18 and JF19. The fragments purified on 1.7% agarose gels were cloned into M13mp18 digested with EcoRI-MboI or EcoRI-HinclI, respectively. Clones containing cDNA inserts were identified by digestion with appropriate restriction enzymes, and sequences were obtained by using the chain termination DNA-sequencing method primed with the M13mpl8 universal primer. Constructions of cDNA expression vectors. The whole genomic early region of HaPV, including the putative polyadenylation signal (nt 182 to 2998), was cloned under control of the SV40 early promoter. This expression vector (pGHa24) was used throughout these experiments to express the HaPV early genes. A pGHa24 map is presented in Fig. 1. Selected fragments of pGHa24 were substituted, with the appropriate sequences deleted for the respective introns, to yield vectors expressing individually each of the three early antigens. Constructions of respective intronless DNA derivatives, coding individually for LT or small T (ST) antigen, were carried out with the Amersham oligonucleotide-directed in vitro mutagenesis system. The 1,743-bp HincIIScal (nt 5087 to 1464) HaPV fragment containing the region to be deleted cloned into bacteriophage M13mpl8 was used as a template for mutagenesis. Deletion mutants were generated by using synthetic oligonucleotides JF1 (5'-GGAAG CATTAGGGTCCTGACTAGGCCCAAG) (nt 846 to 408) for LT cDNA and JF4 (5'-GGAAGCATTAGGGTCCTGAGGC CGGATTGT) (nt 846 to 754) for ST cDNA. The wild-type SacI-MstII fragment (nt 343 to 1399) from pGHa24 was substituted with the respective intronless fragment from the mutant phages. The MT cDNA expression vector was derived directly from pGHa24 by substitution of the wild-type 113-bp AccINciI fragment (nt 750 to 863) by a corresponding 20-bp double-stranded synthetic AccI-NciI fragment with the MT

intron deleted: JF35 (5'-CTACAATCCGGCCTCAGACC) hybridized to JF36 (5'-GGGTCTGAGGCCGGA1TGT). All of the mutants were first identified by digestion with EcoRI and DraI (located at nt 813 within the three introns) and then sequenced. The vectors expressing the LT, MT, and ST antigens are named pGHaLT, pGHaMT, and pGHaST, respectively. The murine polyomavirus MT antigen is expressed as an intronless DNA (nt 87 to 2966) under control of the SV40 early promoter in the same vector as its HaPV homologs. The SV40 LT antigen is expressed as the early region (nt 294 to 2533) deleted within the LT intron. In vitro cDNA transcription and translation. BglII-SalI fragments (nt 182 to 3000) from recombinant plasmids pGHaLT, pGHaMT, and pGHaST were cloned into the BamHI-SalI sites of the pGEM 3Zf(-) vector (Promega) in the appropriate orientation for production of the coding strand RNAs by T7 polymerase. Plasmid DNAs were linearized with SalI and transcribed as recommended by the supplier. Templates were then digested with RNase-free DNase, and RNAs were purified by phenol extraction, precipitated with ethanol, and redissolved in water. Aliquots of RNAs were translated for 2 h at 30°C in rabbit reticulocyte lysates in the presence of [35S]methionine as specified by the manufacturer (Promega). Equivalent amounts of the various reactions were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis in a 12.5% gel, and the labelled products were detected by autoradiography. Cell culture and transfections. Flll is an established rat fibroblast cell line obtained from T. L. Benjamin. Primary rat fibroblasts were prepared by trypsinization of minced 14day-old Fisher rat embryos. Both cell types were grown in Dulbecco modified Eagle medium supplemented with 10% fetal calf serum, penicillin, and streptomycin. (i) Immortalization. Fisher rat embryo cells (3 x 106/10cm-diameter dish) were exposed to a CaPO4 coprecipitate of 20 ,ug of neomycin resistance vector pSV2tkneo,B and 10 to 40 ,ug of plasmid DNA. At 20 h later, each plate was split into four plates in medium supplemented with 10% fetal calf serum, streptomycin, penicillin, and G418 (400 ,ug/ml). The medium was changed every week for 3 weeks. G418-resistant colonies were picked, recloned, and established as permanent cell lines. The presence of viral early gene products was detected in the nuclei of the immortalized cells

VOL. 66, 1992

by indirect immunofluorescence using hair follicle tumorbearing hamster sera. (ii) Transformation. Transfection of Flll cells was performed by lipofection using the BRL reagent. Briefly, DNA in 50 ,1 of water was mixed with 30 ,u of lipofectin reagent diluted in water in a total volume of 50 VI. After 15 min at room temperature, the mixture was added dropwise onto the cells which had been previously washed with Optimem medium (BRL) and covered with 3 ml of serum-free medium. At 20 h later, 3 ml of medium supplemented with 20% fetal calf serum, penicillin, and streptomycin was added. The medium was changed every week for 4 weeks. Foci were visualized after Giemsa staining. Flll cells (3 x 105 in 6-cm-diameter dishes) were transfected with 1 to 20 ,ug of DNA. RESULTS Maturation of HaPV early transcripts. The putative genetic organization of the HaPV genome deduced from the arrangements of the open reading frames led to the postulate that differential splicing of the HaPV early strand primary transcript could give rise to three mRNAs with coding capacity for the LT, MT, and ST antigens, respectively. A maturation pattern based on consensus donor-acceptor splicing sites had been proposed (12). To test this model, we studied the early transcripts accumulated in several cell lines and tissues carrying the HaPV genome. In vitro reverse transcription coupled to PCR amplification offers a rapid and sensitive assay for mRNA detection and structural analysis. Two primers have been designed for this purpose: a downstream primer that initiates reverse transcription of mRNAs across the putative splice junctions and is then used in conjunction with an upstream primer to amplify this splice junctioncontaining region of the reverse transcripts. The amplification products were cloned in M13 phage and sequenced. The genomic DNA that unavoidably contaminates the RNA preparations is also amplified in such experiments, and its contribution to the amplification pattern was evaluated in a control assay in which the reverse transcription step was omitted. Figure 2A and B shows the results of amplification reactions carried out with (+) or without (-) reverse transcription on mRNAs prepared from two HaPV-transformed rat cell lines (REA2 and F1113A), a hamster lymphoid cell line (GD36) chronically infected by HaPV (11), and two lymphomas induced by HaPV (Tul and Tu2). Primers JF18 and JF19 were first used to amplify a fragment putatively containing the three introns (Fig. 2A). In all of the samples, when the reverse transcription step was omitted, the amplification reaction yielded a 771-bp fragment also detected with the HaPV genomic DNA template and corresponding to the genomic sequence defined by the two primers. In the two transformed cell lines, the amplification performed after reverse transcription yielded a unique fragment of 362 bp, presumably representing the spliced LT mRNA species. Under these conditions, amplification of the genomic sequence was not detected in transformed-cell RNA preparations, probably because of its low abundancy. In the three other samples, the 362-bp fragment was coamplified together with the genomic sequence of 771 bp. An additional 680-bp species was detected that is likely to represent a PCR artifact because several attempts at purification failed to yield a product with reproducible electrophoretic mobility. Sequencing of the 362-bp fragment confirmed the previously hypothesized nt 422 to 832 splicing of open reading frames 3

TRANSFORMATION BY HAMSTER POLYOMAVIRUS

2497

and 1 that leads to the LT antigen mRNA. Surprisingly, this assay did not detect specific bands around 700 bp that would represent the putative splicing events leading to MT or ST mRNA, respectively. This may reflect the relative low abundancies of these mRNA species and the competition for primers that favors LT antigen mRNA reverse transcription and cDNA amplification. To circumvent this effect, an alternative upstream primer (JF20), located within the LT mRNA intron, was chosen. This oligonucleotide cannot prime the amplification of LT mRNA species and therefore should be specific for putative MT and ST mRNA species. The results of an experiment using this second set of primers are shown in Fig. 2B. A 520-bp genomic fragment was amplified in all of the samples, together with two fragments at 457 and 428 bp. The sequence of the amplified 457-bp fragment demonstrates the splicing of nt 768 to nt 832 resulting in an in-phase deletion within open reading frame 3 that leads to ST antigen mRNA. The sequence of the 428-bp fragment demonstrates the splicing of nt 768 to nt 861 of open reading frames 3 and 2 leading to MT antigen mRNA. Although quantitative conclusions about the respective amounts of spliced mRNAs are difficult to draw from these experiments, they demonstrate at least qualitatively that the same three species were accumulated in five samples originating from tumors, transformed cells, or lytically infected cells. The pattern proposed for the maturation of HaPV early mRNA is summarized in Fig. 2C. Three intronless DNA derivatives representing the three cDNAs were constructed by in vitro mutagenesis (rather than cloned from the PCR products). For LT and ST cDNAs, the respective introns were deleted by using oligonucleotide-directed mutagenesis. The fragments carrying the deletion were excised from the M13 phage DNAs and substituted for the appropriate genomic fragment within the early region of a vector expressing the HaPV early region under control of the SV40 early promoter (pGHa24; Fig. 1). For the MT intronless derivative, an intronless double-stranded oligonucleotide was directly substituted for the corresponding genomic fragment within the pGHa24 vector. Coding capacity of the HaPV early mRNAs. The experiments described above have established the existence of three mRNA species with potential coding capacities postulated from their respective open reading frames. To validate these coding capacities, the intronless cDNAs were cloned under control of the phage T7 polymerase promoter into a vector that permits coupled in vitro transcription and translation. These templates were transcribed by T7 RNA polymerase, and the transcripts were translated in a reticulocyte translation system in the presence of [35S]methionine. The results of these experiments are shown in Fig. 3. In the absence of an exogenous template, a 42-kDa polypeptide was labelled and gave a nonspecific background. Translation of the HaPV early RNAs directed the synthesis of major polypeptide species with molecular masses compatible with the theoretical molecular masses deduced from the open reading frames: 90 kDa for the LT, 45 kDa for the MT, and 23 kDa for the ST antigens. Biological activities. We used vectors expressing either the genomic early region or the individual ST, MT, or LT cDNA to assess the role of each early gene. The HaPV early promoter carries a weak transcriptional activity in transient assays in all of the cell types tested, including Syrian hamster, rat, and mouse fibroblasts (13). Therefore, to ensure an elevated level of expression of HaPV early polypeptides in fibroblasts, the respective cDNAs were cloned in a vector under control of the SV40 early gene transcription

2498

GOUTEBROZE AND FEUNTEUN

J. VIROL. U

A

Markers

Poly(A) Poly(A)Y Poly(A)' Total REA2

-

7 65 7 1 7

+

F1113A GD36

-

+

Tu 1

Total Tu2

-

0 i+

'r

E

8

C

O

_

_

* .....,,... , ....A.;E I«4~~~~~~. l... -.4

422

I"r

A "N'iIlk

U

B

Poly(A)Y Poly(A)* Poly(A)Y Total Markers

REA2 -

+

F113A GD36 -

+

-

+

Tu I -

+

Total Tu2 -

0 c +

I

E 0 C

765 825 7 1 7S

-.4 -.4

-12 2_

FIG. 2. Reverse transcription and PCR amplification of mature HaPV early mRNAs. (A and B) Reverse transcription and PCR amplification of mature HaPV early mRNA segments containing the splice junctions. The amplification reactions were carried out with (+) or without (-) reverse transcription on mRNAs prepared from two HaPV-transformed rat cell lines (REA2 and F1113A), a hamster lymphoid cell line (GD36) chronically infected with HaPV (11), and two lymphomas induced by HaPV (Tul and Tu2). Primers JF18 and JF19 were used for panel A; primers JF20 and JF19 were used for panel B (the positions of these primers are indicated in panel C). The amplification reaction performed on the cloned genomic sequence provided a size marker. The H20 sample was run in the absence of RNA and DNA. The PCR products were fractionated on 2% agarose gels which were blotted onto nylon filters probed with 32P in vitro-labelled HaPV DNA. Markers are HaPV fragments (sizes are given in base pairs) resulting from digestion of HaPV-containing plasmids. The arrowheads indicate the products which were further analyzed. (C) Organization of coding sequences (top) and splice signals (bottom) in the HaPV early region that gives rise to the three early proteins (LT, MT, and ST antigens). The map on the top gives the locations of the restriction sites used for cloning and sequencing of the amplified DNA segments (R, EcoRI; M, MboI; H, HaeIII). All three antigens have a common N-terminal sequence (open reading frame 3; filled bars) and differ in their C-terminal domains by virtue of differential splicing. The C-terminal regions are encoded in three different frames: frame 1 for the LT antigen (open bar), frame 2 for the MT antigen (hatched bar), and frame 3 for the ST antigen. At the bottom, exonic sequences are represented in large capital letters and intronic sequences are in small capitals.

regulatory sequences in pGHa24 (Fig. 1). pGHaLT, pGHaMT, and pGHaST are the vectors that individually express each of the three early antigens. pGHaHindIII contains a truncated version of the early region (nt 182 to 1892) carrying coding capacities for the ST and MT antigens, as well as the N-terminal half of the LT antigen. (i) Immortalization. The immortalization capacity of the

pGHa24 vector that expresses the three early antigens was assayed on primary rat embryo fibroblasts by calcium phosphate-mediated cotransfection with a neomycin resistance gene. The neomycin-resistant colonies that grow in this assay represent clonal cell lines that have coacquired an unlimited growth capacity induced by pGHa24-coded activities together with the antibiotic resistance (Fig. 4, early

TRANSFORMATION BY HAMSTER POLYOMAVIRUS

VOL. 66, 1992 R

C

I

r

LARGE T

.,.Ol I

.

.

.

.II

1500

I

I

A

I

w-

2000

I

I

I

I

I

I

I

m

2500

I

I|

I

Ig

I

I

v T

I II 30(U0

I

I

0

Nucleotide number

11

.'.11

(A)n

MIDDLE T

SMALL T

H

M I

JF19

JF20

I

-

1000

500

1.

VT

V

.

JF18

MR

R

H MH v Ty

HM TV -I

2499

_I

IC-

(A)n

AGT.CA ,G.G T A A G A-(LARtGE)--------T T T C A G GACCCTAAT.GCT.TCCACC.TCCACCAGCAGA-CCC.GGX 4,22

GCC.TCA-GG TA T GT- -----MIDLE)-

GCC.TCAGG TAT G T768

---TT TC AG GA CC CT AA TG C TT CC AC CT CC AC CA GC A

GAC.CCGGA 861

--(SMALL.--.-..... - --T T T CA GGACCCTAATGCTTCCACCTCCACCAGCAGACCCGGA 832

FIG. 2-Continued.

region). It should be pointed out that the emergence of colonies which involves single-step selection and does not require serial passages is strictly dependent upon transfection of the cells with an immortalizing activity (absence of colonies in the mock-transfected plate in Fig. 4). A role for the LT antigen as a determining factor in this assay is suggested by the reduced activity displayed by the pGHa HindIII vector that expresses the MT and ST antigens but a truncated version of the LT antigen lacking 345 C-terminal residues (Fig. 4, truncated early region). We attempted to reconstitute the activity of the viral genomic sequence by assessing the role of each individual early gene. The results presented in Fig. 4 confirm that the LT antigen is the instrumental factor in the immortalization assay. Indeed, only those plates which were transfected with the LT antigen expression vector pGHaLT gave rise to neomycin-resistant colonies (Fig. 4, rows 3 and 4), although this vector is much less efficient than vector pGHa24, which expresses the genomic sequence (Fig. 4, early region). Furthermore, the growth properties of the cells immortalized by LT antigen differ drastically from those that express the three polypeptides (doubling time of 60 versus 24 h). The ST and MT antigens, alone or in combination, were incapable of

inducing immortalization (Fig. 4, row 2). Mixed-transfection experiments also support the conclusion that the LT antigen is the only limiting factor. Adding pGHaMT or pGHaST over pGHaLT did not significantly increase the number of colonies, although each of them induced a clear morphological transformation (data not shown). The combination of the three vectors did not reach the colony-forming capacity of the genomic vector (Fig. 4, row 3). This may be due to differential expression efficiencies. The nuclear localization of LT antigen was demonstrated by immunofluorescence in all of the cell lines established in this set of experiments. These results imply that the immortalization capacity of pGHa24 is carried out by the LT antigen, with the ST and MT antigens acting as growth-stimulatory factors for the immortal cells. (ii) Transformation. The transforming activities of the HaPV early gene products were assayed by focus formation on rat Flll cell monolayers. The plasmid DNAs were introduced into exponentially growing cells by lipofectinmediated transfection. The results presented in Fig. 5 show that plasmid pGHa24, which expresses the genomic HaPV early region, with coding capacities for the three antigens, displayed a strong transforming activity, indicating that the

2500

GOUTEBROZE AND FEUNTEUN

9 2.5

_

69

46

30

21.5-

ST - RNA LT MT FIG. 3. Coding capacity of the HaPV early mRNAs. The intronless cDNAs were transcribed by T7 RNA polymerase, and the RNAs were translated in a reticulocyte translation system in the presence of [35S]methionine. The reaction products were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and labelled products were detected by autoradiography. The numbers on the left are molecular masses in kilodaltons. The expected molecular masses of the LT, MT, and ST antigens were 90, 45, and 23 kDa, respectively.

early region contains all of the genetic information required for focus formation (Fig. 5, early region). Deletion of the C-terminal 345 residues of the LT antigen, which did not alter ST or MT antigen coding capacity, had no significant effect on transforming activity (Fig. 5, truncated early region). The contribution of each early gene was investigated by transfection of individual cDNAs cloned in the same vector. Despite minor morphological alteration of the monolayer observed in plates transfected with pGHaST or pGHaMT alone, neither of these vectors nor the pGHaLT expression vector could reproduce by itself the induction of foci obtained by transfection of the genomic region (over a range of plasmid concentrations from 1 to 20 ,ug/3 x 105 cells). This observation suggests that the transforming information carried by the genomic DNA is the result of cooperation between at least two of the three early polypeptides. This hypothesis was investigated by cotransfection experiments. Transfection with a constant amount of vector pGHaMT together with increasing amounts of either vector pGHaST or pGHaLT demonstrated that the ST antigen, but not the LT antigen, cooperates with the MT antigen in inducing transformed foci (Fig. 5, row 2). The symmetry of the cooperation was demonstrated by keeping a constant amount of vector pGHaST together with increasing amounts of vector pGHaMT (Fig. 5, row 3). Again, the LT antigen had no effect. Foci induced by the MT and ST antigens displayed a morphology undistinguishable from that induced by the genomic early region (data not shown). From these observations, it was concluded that the ST and MT antigens are sufficient to account for the capacity of HaPV to transform Fill rat fibroblasts. This observation contrasts with the concept widely accepted in murine polyomavirus research that the MT antigen carries the capacity to induce focus formation.

J. VIROL.

(iii) HaPV ST antigen stimulatory effect is ubiquitous. To investigate the specificity of HaPV ST-MT antigen cooperation for transformation, we examined whether the HaPV MT antigen could be substituted with another polyomavirus oncogene. In SV40 transformation of rodent cells, the viral early region that encodes the LT and ST antigens induces anchorage-independent growth of various established but not otherwise transformed rodent cell lines. The LT antigen alone does not induce this transformation (5, 14, 22, 27). As shown in Fig. 6, the SV40 LT antigen is also defective in the focus formation assay on Flll cells. It is complemented by coexpression of the HaPV ST antigen and therefore behaves similarly to the HaPV MT antigen. A stimulatory effect is observed with the murine polyomavirus MT antigen as well which, as expected, displays transforming activity by itself. These results demonstrated that the HaPV ST antigen cooperates with heterologous polyomavirus oncogenes to bring about the transformed phenotype of Flll cells.

DISCUSSION A strategy involving PCR amplification of cDNAs was designed to study expression of the HaPV early region. Selection of the primers utilized in these experiments was dictated by the organization of the open reading frames (12) pointing to a region of the genome (nt 340 to 1100) where the splicing events were more likely to occur and where sequence motives displaying distinctive characteristics of donor and acceptor splice sites could be recognized. This strategy was applied to identify the virus-specific early transcripts in HaPV-transformed rat fibroblasts. Three splice junctions reflecting the accumulation of three distinct mature mRNAs were identified. These mRNAs result from alternative splicing of open reading frames leading to coding capacities for three polypeptides with molecular weights similar to those of the LT, MT, and ST antigens of murine polyomavirus (28). A splicing event involving alternative sites not included in the region between nt 340 and 1100 would not be identified in these experiments. The same strategy applied to the early mRNAs accumulated in productively infected cells (GD36) or in HaPV-induced lymphoma identified, at least qualitatively, the same splicing pattern, although in these cases the structures of the junctions were not firmly established by sequencing. The fact that the same mRNA species were observed in in vitro-transformed fibroblasts and in vivo tumors justified the subsequent studies, carried out exclusively with fibroblasts. The data presented here confirm the splicing patterns previously proposed (9) for ST and LT mRNA maturation. By contrast, neither the donor nor the acceptor sites hypothetically proposed for MT mRNA maturation are those which are actually used. The best possible acceptor site, identified at nt 832 by computer-derived values of consensus sequences, had to be spliced with a weak donor site at nt 772 to generate an mRNA species with coding capacity for the MT antigens. In fact, the acceptor site which was actually used (nt 860) scores much lower on the consensus scale but is spliced to a good donor site at nt 768 that is also used for ST mRNA maturation. The consequence of this observation is twofold. (i) The actual size of the MT antigen is 10 amino acid residues shorter than the previously predicted species, and (ii) the strategies of donor and acceptor site utilization in early mRNA maturation are remarkably similar in HaPV and murine polyomavirus. The coding capacities of the three putative mRNAs were assessed by introduction of reconstructed intronless cDNAs

TRANSFORMATION BY HAMSTER POLYOMAVIRUS

VOL. 66, 1992

MOCK t Opg

EARLY REGION lopg

2501

TRUNCATED

EARLY REGION 1 Opg

MT+ST 1 1 Opg

Oug

MT

ST

1 Opg

LT

LT+MT

1 Opg

1 Opg

LT

LT+MT

1 Opg

1 Opg

LT+MT+ ST 1 Opg

1 Opg

1 Opg

LT+ST

20pg 20pg lopg 20pg I opg FIG. 4. Immortalization of rat embryo fibroblasts by HaPV early genes. The nature and amount of each transfecting vector are indicated below each plate, which is representative of at least three independent experiments.

2502

GOUTEBROZE AND FEUNTEUN

J. VIROL.

MOCK

EARLY REGION

1 Opg

1 Opg

MT

MT+ST

5pg

5pg lpg

MT+ST 5pg 5pg

TRUNCATED EARLY REGION 1O pg

LT

lOpg

.._.

MT+ ST

5pg lOpg

MT+LT

5p9g lOpg

ST+MT ST+MT ST+MT ST+LT 5pg lpg 5pg 1l0pg 5pg 5pg 5pg 1OIg FIG. 5. Transformation of Flll rat fibroblasts by HaPV early genes. The nature and amount of each transfecting vector are indicated below each plate, which is representative of at least three independent experiments.

ST

5ipg

in an in vitro coupled transcription-translation assay. They actually direct the synthesis of polypeptides with the electrophoretic mobilities expected on the basis of the theoretical translation of the three intronless cDNAs. This result validated the proposed splicing pattern and the open reading frame organization deduced from the cDNA nucleotide sequence. Taken together, these observations indicate that the murine and hamster polyomaviruses share the same genetic organization of their early region. As predicted on the basis of the open reading frames, the respective early gene products share large regions of homologous sequences. However, the two MT antigens are highly divergent over a stretch of 190 amino acids which may determine the specificity of binding to cellular tyrosine kinases. The murine polyomavirus MT antigen associates with pp6ocsrc (9), pp62c-Yes (18), and to a lesser extent pp59C-fyf (6, 19), whereas the HaPV MT antigen associates exclusively with pp59c-frv (8). It is tempting to speculate that the specificity of association with cellular tyrosine kinases contributes to the specificity of the tumor profile displayed by each virus. The biological activities carried out by each of the early genes were assayed by transfection of appropriate cell systems. Because it had been shown in this laboratory that the HaPV early promoter displays weak constitutive activity in rodent fibroblasts (13), the experiments presented here

were performed with vectors expressing the cDNAs under control of the SV40 early promoter. The first conclusion which can be drawn from these experiments is that the fragment of genomic viral DNA carrying the coding capacities for the three early antigens (nt 182 to 2998) contains all of the genetic information necessary for immortalization of primary rat embryo fibroblasts and transformation of Flll rat cells. Similar observations have been reported for murine polyomavirus (24, 29). Attempts to assign biological activities to each individual cDNA have demonstrated first that immortalization is essentially carried out by the LT antigen. Although the MT and ST antigens are not strictly required to promote unlimited proliferation of primary cells, they stimulate the growth and modify the phenotype of immortal cell lines. Similar activities are classically associated with murine polyomavirus MT and ST antigen expression (7, 24). A more stringent cooperative effect is observed in the transformation of Flll cells, which requires the simultaneous presence of the MT and ST antigens. None of the T antigens alone is capable of inducing foci. This observation represents a clear discrepancy with the pathway of transformation by murine polyomavirus that can be carried out by the MT antigen alone (29). If transformation by HaPV is at least partly mediated by MT antigen binding to pp59C-fyf, it may be not surprising that rodent fibroblasts which express low

TRANSFORMATION BY HAMSTER POLYOMAVIRUS

VOL. 66, 1992

MOCK

HaPV ST

HaPV MT

Py MT

SV40 LT

HaPV ST

HaPV ST Py MT

HaPV ST SV40 LT

HaPV MT

2503

FIG. 6. HaPV ST antigen cooperates with murine polyomavirus (Py) MT antigen and SV40 LT antigen to transform Flll rat fibroblasts. The nature of each transfecting vector is indicated below each plate, which is representative of two independent experiments.

levels of this tyrosine kinase are resistant to transformation by the HaPV MT antigen. This hypothesis would predict that cotransfection of a c-tfn-expressing vector should complement the HaPV MT antigen. The strict requirement for both the MT and ST antigens formally defines two complementation groups and resembles the SV40 LT and ST antigen cooperation necessary to bring about anchorage-independent growth of various fibroblasts (5, 14, 22, 27). In this case, it has been proposed that ST antigen activity enhances the transforming function of the LT antigen and becomes necessary when the LT antigen concentration is limiting (3). The possibility that the HaPV MT antigen is produced in a limiting amount in Flll cells cannot be excluded; however, since the murine polyomavirus MT antigen expressed in the same vector induces foci, it is suggested that Flll cells are differentially responsive to each of the MT antigens. Interestingly, the HaPV ST antigen complemented the SV40 LT antigen efficiently in the transformation of Flll cells assayed by focus formation, demonstrating that this complementation is not species specific. Although no precise biochemical activity has been defined for polyomavirus ST antigens, they interfere with a number of cellular processes. Perturbations of the actin skeleton are induced by the SV40 ST antigen (4), although not by the polyomavirus ST antigen (20); phosphatase 2A activity, which controls the phosphorylation status of the LT antigen, p53, and probably other targets, is regulated by the binding of SV40 and the polyomavirus ST antigen (23, 25, 30). Some RNA polymerase IIand III-requiring promoters are transactivated by the SV40 ST antigen, probably via modification of the activity of a selected transcription factor (21). One interesting possibility

is that the HaPV ST antigen transactivates the expression of cellular genes which participate in the MT antigen-mediated transformation pathway; among those, p59c-fyn is an attractive candidate. In conclusion, this report presents the identification and a crude functional characterization of the HaPV early gene products. These results represent preliminary approaches to a comprehensive study of HaPV-induced tumor pathologies. ACKNOWLEDGMENTS This work was supported by l'Association pour la Recherche sur le Cancer (ARC contract 1224). M.-C. Dokhelar and C. Lavialle are gratefully acknowledged for critical reading of the manuscript. REFERENCES 1. Asselin, C., C. Gelinas, and M. Bastin. 1983. Role of the three polyoma virus early proteins in tumorigenesis. Mol. Cell. Biol. 3:1451-1459. 2. Bastien, C., and J. Feunteun. 1988. The hamster polyomavirus transforming properties. Oncogene 2:129-135. 3. Bikel, I., X. Montano, M. E. Agha, M. Brown, M. McCormack, J. Boltax, and D. M. Livingston. 1987. SV40 small t antigen enhances the transformation activity of limiting concentrations of SV40 LT antigen. Cell 48:321-330. 4. Bikel, I., T. M. Roberts, M. T. Bladon, R. Green, E. Amann, and D. M. Livingston. 1983. Purification of biologically active simian virus 40 small tumor antigen. Proc. Natl. Acad. Sci. USA 80:906-910. 5. Bouck, N., N. Beals, T. Shenk, P. Berg, and G. di Mayorca. 1978. New region of simian virus 40 genome required for efficient viral transformation. Proc. Natl. Acad. Sci. USA 75:2473-2477.

2504

GOUTEBROZE AND FEUNTEUN

6. Cheng, S. H., R. Harvey, P. C. Espino, K. Semba, T. Yamamoto, K. Toyoshima, and A. E. Smith. 1988. Peptide antibodies to the human c-fn gene product demonstrate that pp59c-fln is capable of complex formation with the middle-T antigen of polyomavirus. EMBO J. 7:3845-3855. 7. Cherington, V., B. Morgan, B. M. Spiegelman, and T. M. Roberts. 1986. Recombinant retroviruses that transduce individual polyoma tumor antigens: effects on growth and differentiation. Proc. Natl. Acad. Sci. USA 83:4307-4311. 8. Courtneidge, S. A., L. Goutebroze, A. Cartwright, A. Heber, and J. Feunteun. 1991. Identification and characterization of the hamster polyomavirus middle T antigen. J. Virol. 65:3301-3308. 9. Courtneidge, S. A., and A. E. Smith. 1984. Polyomavirus transforming protein associates with the product of the c-src cellular gene. Nature (London) 303:435-439. 10. Dawe, C. J., R. Freund, G. Mandel, K. Balmer-Hofer, D. Talmage, and T. L. Benjamin. 1987. Variations in polyomavirus genotype in relation to tumor induction in mice: characterization of wild type strains with widely differing tumor profiles. Am. J. Pathol. 127:243-261. 11. de La Roche Saint Andre, C., F. Harper, and J. Feunteun. 1990. Analysis of the hamster polyomavirus infection: host-restricted productive cycle. Virology 177:532-540. 12. Delmas, V., C. Bastien, S. Scherneck, and J. Feunteun. 1985. A new member of the polyomavirus family: the hamster papovavirus. Complete nucleotide sequence and transformation properties. EMBO J. 4:1279-1286. 13. Delmas, V., C. de La Roche Saint Andre, M. Gardes, L. Goutebroze, and J. Feunteun. Early gene expression in lymphoma-associated hamster polyomavirus viral genomes. Oncogene, in press. 14. Feunteun, J., M. Kress, M. Gardes, and R. Monier. 1978. Viable deletion mutants in the simian virus 40 early region. Proc. Natl. Acad. Sci. USA 75:4455-4459. 15. Freund, R., T. W. Dubensky, D. A. Talmage, C. J. Dawe, and T. L. Benjamin. 1988. Molecular aspects of pathogenesis in the polyomavirus-mouse system, p. 50-57. In A. L. Notkins and M. B. A. Oldstone (ed.), Concepts in viral pathogenesis III. Springer Verlag, New York. 16. Graffi, A., E. Bender, T. Schramm, W. Kuhn, and F. Schneiders. 1969. Induction of transmissible lymphoma in Syrian hamster by application of DNA from viral hamster papovavirus induced tumors and by cell-free filtrates from human tumors. Proc. Natl. Acad. Sci. USA 64:1172-1175. 17. Graffi, A., T. Schramm, E. Bender, D. Bierwolf, and I. Graffi. 1968. Virus associated skin tumors in the Syrian hamster: preliminary note. J. Natl. Cancer Inst. 40:867-887.

J. VIROL. 18. Kornbluth, S., M. Sudol, and H. Hanafusa. 1987. Association of the polyomavirus middle T antigen with c-yes protein. Nature (London) 325:171-173. 19. Kypta, R. M., A. Hemming, and S. A. Courtneidge. 1988. Identification and characterization of p59"fl (a src-like protein tyrosine kinase) in normal and polyomavirus transformed cells. EMBO J. 7:3837-3844. 20. Liang, T. J., G. Carmichael, and T. L. Benjamin. 1984. A polyoma mutant that encodes small T antigen but not middle T antigen demonstrates uncoupling of cell surface and cytoskeletal changes associated with cell transformation. Mol. Cell. Biol. 4:2774-2783. 21. Loeken, M., I. Bikel, D. M. Livingston, and J. Brady. 1988. trans-Activation of RNA polymerase II and III promoters by small t antigen. Cell 55:1171-1177. 22. Martin, R. G., V. P. Setlow, C. A. F. Edwards, and D. Vembu. 1979. The roles of the simian virus 40 tumor antigens in transformation of Chinese hamster lung cells. Cell 17:635-643. 23. Pallas, D., L. K. Sharik, B. L. Martin, S. Jaspers, T. B. Miller, D. L. Brautigan, and T. M. Roberts. 1990. Polyoma small t and middle t antigens and SV40 small t antigen form stable complex with protein phosphatase 2A. Cell 60:167-176. 24. Rassoulzadegan, M., A. Cowie, A. Carr, N. Glaichenhaus, R. Kamen, and F. Cuzin. 1982. The role of individual polyomavirus early proteins in oncogenic transformation. Nature (London) 300:713-716. 25. Scheidtmann, K. H., M. C. Mumby, K. Rundell, and G. Walter. 1991. Dephosphorylation of simian virus 40 large T antigen and p53 protein by protein phosphatase 2A: inhibition by small t antigen. Mol. Cell. Biol. 11:1196-2003. 26. Scherneck, S., V. Delmas, F. Vogel, and J. Feunteun. 1987. Induction of lymphomas by the hamster papovavirus correlates with massive replication of nonrandomly deleted extrachromosomal viral genomes. J. Virol. 61:3992-3998. 27. Sleigh, M. J., W. C. Topp, R. Harich, and J. F. Sambrook. 1978. Mutants of SV40 with an altered small t protein are reduced in their ability to transform cells. Cell 14:79-88. 28. Tooze, J. 1981. DNA tumor viruses: molecular biology of tumor viruses, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 29. Treisman, R., U. Novak, J. Favaloro, and R. Kamen. 1981. Transformation of rat cells by an altered polyomavirus genome expressing only the middle T protein. Nature (London) 292:595600. 30. Yang, S. I., R. L. Lickteig, R. Estes, K. Rundell, G. Walter, and M. C. Mumby. 1991. Control of protein phosphatase 2A by simian virus 40 small-t antigen. Mol. Cell. Biol. 11:1988-1995.