Horm Mol Biol Clin Invest 2012;10(1):227–239 © 2012 by Walter de Gruyter • Berlin • Boston. DOI 10.1515/hmbci-2012-0016

Transforming growth factor β signaling regulates the invasiveness of normal mammary epithelial cells and the metastasis formation of tumor cells

Vida Vafaizadeh*, Ulrike Graab, Tahmineh Darvishi, Rita Machado and Bernd Groner* Georg-Speyer-Haus, Institute for Biomedical Research, Frankfurt am Main, Germany

Abstract Breast cancer patients with disseminated metastatic disease still have a very unfavorable prognosis. Investigations into the molecular mechanisms that underlie metastasis formation have a high priority and can possibly result in improved therapeutic interventions. The process of oncogenic epithelial to mesenchymal transition (EMT) has recently become a focus in cancer research because it encompasses many of the phenotypic traits characteristic of metastatic cells, e.g., increased motility, invasion, anoikis resistance, immunosuppression, and cancer stem cell potential. A number of central cellular signaling pathways and transcription factors have been implied in the control of EMT and metastasis formation, among them signal originating from the activation of the transforming growth factor β (TGFβ), epithelial growth factor, Wnt, Notch, and Hedgehog pathways. We have investigated the contribution of TGFβ signaling to metastasis-related cellular properties. TGFβ signaling can have tumor-suppressive and -promoting effects depending on the tumor type and the stage of tumor progression. TGFβ can inhibit the proliferation of mammary epithelial cells (MECs), but it can also induce EMT, invasion, and metastasis, possibly through Smad-independent signaling events. We investigated the effects of TGFβ pathway inhibition on the proliferation, differentiation, and invasion of both normal and malignant MECs. shRNA-mediated downregulation of the Smad4 protein in non-tumorigenic HC11 and tumorigenic 4T1 cells promotes the invasiveness of both cell lines. Mammary gland reconstitution studies, with primary MECs expressing shSmad4, resulted only in subtle effects on the glandular morphogenesis. Orthotopic transplantation of shSmad4-transduced 4T1 tumor cells caused the accelerated growth of mammary tumors and enhanced colonization and macroscopic lung metastases when compared to control cells. Surprisingly, the expression of Smad4 was restored, *Corresponding authors: Vida Vafaizadeh and Bernd Groner, Georg-Speyer-Haus, Institute for Biomedical Research, Paul Ehrlich Str. 42, D-60596 Frankfurt am Main, Germany Phone: +49-69-63395-180, E-mail: [email protected]; [email protected] Received March 5, 2012; accepted March 6, 2012; previously published online March 30, 2012

and a strong activation of Stat3 was found in the metastatic lesions present in the lungs. These lesions express metastatic factors, such as angiopoietin-like-4 and the inhibitor of DNA binding/differentiation 1. We suggest that the downregulation of Smad4 inhibits the tumor-suppressive effects of TGFβ signaling and enhances tumor growth. The downregulation, however, was only transient, and the reactivation of Smad4 expression caused the reversal of EMT, mesenchymal to epithelial transition, and thereby promoted metastasis formation in the lungs. Keywords: lung metastasis; mammary tumors; Smad4; transforming growth factor β (TGFβ) signaling.

Introduction The detection of distant metastasis is a very unfavorable prognostic parameter for breast cancer patients and severely limits the therapeutic prospects. The molecular mechanisms that underlie the formation of metastasis have therefore become a most important aspect of cancer research. Epithelial to mesenchymal transition (EMT) of cells has received special attention because it describes the partial acquisition of mesenchymal characteristics of epithelial cells. Cells undergoing this transition exhibit increased migratory and invasive capabilities and are such prone to metastatic dissemination. The cells are of intermediate phenotype – expressing epithelial and mesenchymal markers. It is conceivable that they first undergo EMT to escape from a primary tumor mass, but that they later revert to a more epithelial phenotype again [mesenchymal to epithelial transition (MET)] before they form metastatic lesions at a distant site [1]. These transitions may also be associated with their increased drug resistance, tumor initiation, and self-renewal capacities [2, 3]. Multiple regulators of EMT have been discovered (e.g., transcription factors, signaling molecules, and miRNAs) and phenotypic characteristics have been defined (e.g., the loss of epithelial proteins that form junctional complexes). The emergence of a mesenchymal phenotype is accompanied by the upregulation of, e.g., fibronectin and vimentin, and the suppression of epithelial E-cadherin. This suppression is mediated by transcription factors, such as Snail2, Zeb1, Zeb2, and Twist1, which are linked to signaling pathways that induce EMT, e.g., transforming growth factor β (TGFβ) [4], epithelial growth factor (EGF), Wnt, Notch, and Hedgehog. We have investigated the role of TGFβ in the regulation of invasive and metastatic behavior of normal and transformed mouse mammary epithelial cells (MECs). The TGFβ cytokines (TGFβ1, TGFβ2, and TGFβ3) regulate many cellular

228

Vafaizadeh et al.: TGFβ signaling in normal and malignant mammary epithelial cells

processes, including cell proliferation, differentiation, mobility, survival, senescence, and apoptosis, via autocrine and paracrine mechanisms of action. They also affect immune cell populations and can suppress their antitumor activity [5]. Latent TGFβ ligands can be sequestered by extracellular matrix and become activated by, e.g., proteolysis [4]. Activated TGFβ1 and TGFβ3 bind to TGFβ type II receptor (TGFβRII), which transphosphorylates and activates TGFβ type I receptor – a serine/threonine kinase receptor. The activated TGFβRI interacts and phosphorylates a subset of Smad proteins (Smad2 and Smad3). P-Smad2/3 proteins bind to Smad4 and translocate to the nucleus, where they form transcription complexes with DNA-binding factors and coactivators/corepressors. Many different transcription factors can interact with Smad2/3 proteins [6], and cell type-specific effects of TGFβ signaling seem to be mediated by the interaction of Smad2/3 proteins with master transcription factors that specify and maintain cell identity [7]. In normal epithelial cells and at early stages of oncogenesis, the “canonical” or “Smad-dependent” TGFβ signaling has mainly antiproliferative effects and a tumor-suppressive influence. The growth inhibitory effect of TGFβ is mediated by (i) the induction of target genes, such as p15Ink4b, p16Ink4A, p19ARF, p21Cip1/Waf1, p27Kip1, and p57Kip2 cyclin-dependent kinase inhibitors [8, 9], (ii) the downregulation of the proto-oncogene c-Myc, (iii) the downregulation of inhibitor of DNA binding/differentiation 1 (Id1) proteins, which inhibit cell differentiation, (iv) the repression of CBP/p300binding nuclear protein CITED-1 – a coactivator required for the estrogen receptor (ER)-dependent amphiregulin (AREG) gene expression, and (v) the upregulation of Wnt5a expression, which suppresses the ductal extension, terminal end bud proliferation, and lateral branching [10, 11]. Wnt5a is a noncanonical signaling member of the Wnt family and shows a tumor-suppressive role on the initiation of breast cancer. It inhibits tumor cell migration and metastasis and its loss was associated with early relapse in invasive ductal breast carcinomas [12]. Wnt5a can act as a tumor suppressor by antagonizing the Wnt/β-catenin signaling and limiting the stem cell population [11, 13]. TGFβ signaling can also activate a variety of “non-canonical” effectors, such as Par6, NF-κB, ILK, FAK, Src, ShcA, GTPases, Cdc42/Rac1-PAK2, IL1R-TRAF6-TAK1, JNK, p38 MAPK, DAXX, Rho-Rock1, RAS, ERK, PP2A, and the PI3K-AKT-mTOR signaling axes [4, 5], possibly in a Smadindependent fashion. These molecules have effects on the tumor microenvironment and can stimulate angiogenesis and inhibit the antitumor immune responses [5]. The imbalance between canonical and non-canonical TGFβ signaling induces EMT and benefits metastatic progression. Transcription factors, such as Snail, Slug, HMGA2, Δ-EF1/ZEB1, and SIP1/ZEB2 mediate TGFβ-induced EMT and repress expression of E-cadherin [1, 14]. Besides, TGFβ signaling regulates the differential expression of several miRNAs, such as miR21, miR155, and the miR200 family, which have significant roles in modulating EMT [15–18]. In normal mammary gland, TGFβ acts mainly by the suppression of the ER-dependent proliferation of ducts [19]

and also by upregulating the synthesis of collagen in MECs and the matrix metallopeptidase 9 (MMP-9) in fibroblasts. MMP-9 has a high collagenase activity and activates latent TGFβ in the mammary stroma. Recently, we could show that the miR-212/132 family negatively regulates MMP-9 expression. The loss of function of the 212/132 miRNAs impaired the ductal elongation during puberty due to the accumulation of MMP-9 and hyperactivation of TGFβ signaling around the ducts in the mammary stroma [20, 21]. TGFβ is a hormonally regulated growth factor [22], and ovarian hormones regulate the activation of TGFβ signaling. ERα and TGFβ have opposing roles in mammary epithelial proliferation and differentiation and can interact directly [23]. The proliferating cells in the mature glands are ERα− cells [24], and their proliferation is controlled by paracrine growth factors, such as AREG, Igf-2, wnt4, and RANKL produced by ERα+ cells (25%–30% of ductal luminal cells) [25]. These paracrine mechanisms can switch to an autocrine loop in early breast cancer progression. This allows the ERα+ tumor cells to proliferate, possibly through the downregulation of canonical TGFβ signaling [26]. Loss of canonical TGFβ signaling and its components including TGFβRI, TGFβRII, Smad2, and Smad4 have been shown in several human carcinomas [27]. Smad4 mutation, deletion, and loss of expression due to the genetic or epigenetic alterations [28] have been reported in many cancers including breast cancer. The tumor suppressor activity of Smad4 protein is observed in ERα+ breast tumors; however, its expression was much higher in surrounding breast epithelium [29]. Several studies show that ERα can directly interact with Smad proteins and modify TGFβ signaling. The loss of TGFβ responsiveness in ERα+ and enhanced TGFβ signaling in ERα− breast tumors correlated with poor prognosis in patients [9, 23]. Based on clinical and molecular studies, different groups could show that overexpression of distinct genes in tumor cells confers a selective advantage for the colonization of lungs [30, 31]. Angiopoietin-like-4 (Angptl4) and Id1 belong to the lung metastasis signatures [32] and are regulated by canonical TGFβ signaling [30]. Many breast tumors display altered canonical TGFβ signaling with consequences for tumor progression. We gained additional insights into the role of this pathway by interference with TGFβ signaling in MECs and mammary tumor cells. Smad4 downregulation, through a shSmad4 encoding lentivirus, promotes the invasiveness of both non-tumorigenic HC11 and tumorigenic 4T1 cell lines. Orthotopic transplantation of 4T1 tumor cells, in which Smad4 expression was suppressed, resulted in enhanced tumor growth and progression due to the loss of tumor-suppressive effects of canonical TGFβ signaling. Metastasis formed by these tumor cells showed a re-expression of Smad4, possibly through epigenetic silencing of the gene transfer vector. We suggest that this process favors the reversal of EMT, and the MET could possibly enhance the formation of metastasis at distant sites. We also detected the expression of lung metastatic factors, e.g., Angptl4 and Id1, which can promote colonization and macroscopic metastases.

Vafaizadeh et al.: TGFβ signaling in normal and malignant mammary epithelial cells

Materials and methods Cell culture 4T1 cells were grown in complete medium – Dulbecco’s modified eagle medium (DMEM) containing 10% fetal bovine serum (FBS) supplemented with 2 mM L-glutamine, 100 U/mL–100 μg/mL penicillin-streptomycin penicillin/streptomycin (PAA Laboratories, Parsching, Austria). HC11 cells were cultured in RPMI-1640 medium supplemented with 10% FBS, 5 μg/mL insulin, and 10 ng/mL EGF (growth medium). In order to differentiate HC11 cells in vitro, cells were grown to confluence in growth medium to induce differentiation; EGF was removed from the medium for 2 days before addition of the lactogenic hormone mix [dexamethasone, insulin, and prolactin (DIP): 10−7 M dexamethasone, 5 μg/mL insulin].

Cell Proliferation Kit II (XTT) assay Cell proliferation was measured using the Cell Proliferation Kit II (Roche, Mannheim, Germany) according to the manufacturer’s protocol. Briefly, HC11 cells (500 cells/well) were seeded in 96-well plates. Cells were grown for 24, 48, or 72 h in triplicate. The metabolic activity of cells was determined by adding 50 μL of the yellow activatedXTT solution into each well, 4 h before measurement. The metabolism of XTT to the orange water-soluble formazan salt by viable cells was then measured using an enzyme-linked immunosorbent assay (ELISA) reader at 490 nm with a reference wavelength at 650 nm.

Isolation and culturing of primary MECs MECs were isolated from 8- to 10-week-old virgin female BALB/c mice as previously described [33]. Briefly, glands were digested in collagenase solution [10 mL/g tissue, DMEM/F-12 containing 5% FBS, 2 mg/mL collagenase A (Roche, Mannheim, Germany), 0.1 mg/mL hyaluronidase (Sigma-Aldrich, Steinheim, Germany), and antibiotics at 37°C for 60 min with gentle shaking]. The cell suspension was centrifuged at 300 for 10 min to pelletize the digested ducts as organoids. DNase I solution (Roche, Mannheim, Germany) was used to remove clumps (0.1 mg/mL, 5 min at room temperature). Fibroblast and blood cells were removed using several pulse centrifugations, reaching 300 g. Refined organoids from 1 g of isolated glands were cultured on a 10 cm2 plate precoated with a thin gel of collagen type I (BD Biosciences, Heidelberg, Germany) in plating medium (Ham’s F-12 supplemented with 10% FBS, 0.5 mg/mL fetuin, 5 μg/mL insulin, 1 μg/mL hydrocortisone, 5 ng/mL EGF, 100 units/mL-100 μg/mL penicillin-streptomycin, and 100 μg/mL gentamicin). MECs spread out from the organoids during the next days. The plating medium was replaced with MEC growing medium (same as plating medium but only 5% FBS) after 2–3 days. Primary cells were passaged once 3–4 days after plating prior to virus transduction.

229

Lentiviruses were prepared by cotransfecting pCMVΔR8.91 (GAG-POL DNA), the vesicular stomatitis virus envelope plasmid pMD2.VSVG, and a gene transfer plasmid LeGO vector or pLKO vector for shRNA expression into the packaging cell line HEK293T. The lentiviral supernatants were collected 48, 72, and 96 h after transfection, concentrated using ultracentrifugation at 51,610 g/4°C for 2 h, and stored in aliquots at –80°C. The relative virus concentration was determined in HEK293T cells transduced by serially diluted viruses.

Lentiviral gene transduction The MECs were washed with phosphate-buffered saline (without Ca and Mg) and then incubated with 0.2% ethylenediaminetetraacetic acid in Hank’s buffered salt solution pH 7.4 for 5 min to loosen cellcell contacts followed by trypsinization for 5 min at 37°C. Remaining multicellular tissue pieces were removed by passing through a 40 μm cell strainer (BD Biosciences, Heidelberg, Germany), and the single cell suspensions obtained were plated at low cell density 4–6 × 105/ well on 6-well plates. After 1 day of culturing, the cell density reached about 50%; cells were transduced with the various lentiviral vectors in the presence of 8 μg/mL polybrene (Sigma-Aldrich, Steinheim, Germany). We used a multiplicity of transduction of 10–15 for HC11 and 4T1 cells and 30 for MECs, and centrifuged the cells with the virus at 2000 rpm/32°C for 30 min. The medium was changed the next day, and the expression of fluorescent marker proteins was analyzed by FACS 72 h after transduction. Cells transduced with pLKO vectors could be selected with puromycin.

Matrigel invasion assay Transduced cells were starved for 1 day in serum-free medium. Cells were then trypsinized, and 500 μL of cell suspension (1 × 105 cells/mL) was added to the upper chambers of inserts in a 12-well plate. One milliliter of growing medium with 10% FBS (as a chemoattractant) was placed in the lower wells. The polycarbonate membrane (with 8 μm pores) in each insert was coated before with 75 μg growth factor reduced Matrigel (BD Biosciences, Heidelberg, Germany). The cells were allowed to migrate through the Matrigel at 37°C, 5% CO2 for 20 h (HC11 cells) or 16 h (4T1 cells). After the formalin fixation and the removal of non-migrated cells on the upper surface of the filter with a cotton swab, the cells that migrated through the Matrigel to the underside of the filter were stained with crystal violet. The absorbance of dissolved crystal violet was measured at 570 nm with an ELISA plate reader.

Mammosphere assay Lentiviral gene transfer constructs and virus production Three different Smad4 hairpin oligos in pLKO.1-puro lentiviral vector (Sigma-Aldrich, Steinheim, Germany) were tested for their efficient downregulation of mouse Smad4 protein:

shSmad4.1 shSmad4.2 shSmad4.3 scramble shRNA

Mammosphere culture was performed as previously described [34]. Cells were harvested, passed through a 40-μm cell strainer resuspended in mammosphere media at a concentration of 10,000 cells/well in ultra-low-attachment 6-well plates. After 3–7 days, mammospheres were imaged and quantified.

CCGGGCTTACTTTGAAATGGACGTTCTCGAGAACGTCCATTTCAAAGTAAGCTTTTT CCGGGCGATTGTGCATTCTCAGGATCTCGAGATCCTGAGAATGCACAATCGCTTTTT CCGGGCCAGCTACTTACCATCATAACTCGAGTTATGATGGTAAGTAGCTGGCTTTTT CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTT

230

Vafaizadeh et al.: TGFβ signaling in normal and malignant mammary epithelial cells

Western blot analyses Whole-cell extracts of HC11 and 4T1 cells in lysis buffer (1% Nonidet P-40, 0.2% sodium dodecyl sulfate (SDS), 0.5% sodium deoxycholate, 150 mM sodium chloride, 50 mM Tris-HCl, pH 7.4) supplemented with protease and phosphatase inhibitors (1 mM sodium fluoride, 1 mM sodium orthovanadate, 1 μg/mL pepstatin, 5 μg/mL apoprotinin, 5 μg/mL leupeptin, and 1 mM Pefabloc) were prepared, and 30 μg protein was fractionated on 8% or 15% SDS polyacrylamide gels. Proteins were transferred to nitrocellulose membranes, and blots were probed with the primary antibody overnight at 4°C. The sources of primary antibodies used in this study: mouse anti-β-tubulin (T0198; Sigma-Aldrich, Steinheim, Germany), mouse anti-Smad4 (sc-7966; Santa Cruz Biotechnology, Heidelberg, Germany), mouse anti-β-casein (sc-166520; Santa Cruz), rabbit anti-Id1 (sc-488; Santa Cruz), goat anti-Angptl4 (sc34113; Santa Cruz), mouse anti-cytokeratin 18 (ProGen Biotechnik, Heidelberg, Germany), rabbit anti-Vimentin (ab45939; Abcam), rabbit anti-actin (A2066; Sigma-Aldrich) and rabbit anti-P-Stat3 (Tyr705) (9131; Cell Signaling Technology, through New England Biolabs, Frankfurt, Germany), and anti-P-Smad2 (Ser465/467) (3101; Cell Signaling Technology through New England Biolabs, Frankfurt, Germany).

Mice BALB/c mice from Harlan Laboratories (Germany) and RAG2 KO mice (Balb/cA-RAG2KO, IL-2RγKO) from Central Institute for Experimental Animals (CIEA, Kawasaki, Japan) were maintained in a pathogen-free facility, and all mouse procedures were approved by the German Animal Welfare office in Darmstadt.

Mammary gland clearing and transplantation of MECs Three-week-old Rag2−/– recipient mice were anesthetized, and incisions were made in the lower abdomen and along the hind legs to expose both number 4 inguinal mammary glands. The connection between gland numbers 4 and 5 was disrupted by cauterization, and the endogenous epithelium was removed by cutting from the nipple to the lymph node area. MECs (105) were resuspended in 10 μL cold Matrigel and injected with a 25-μL Hamilton syringe attached to a 27-gauge needle into the remaining gland-free fat pad. The hosts were sacrificed, and mammary gland whole mounts were analyzed in virgin (8 weeks after transplantation) or in late pregnant recipient mice.

Orthotopic transplantation of 4T1 tumor cells Lentivirally transduced and with puromycin selected 4T1 tumor cells were injected into the inguinal fat pads of Rag2−/–γc−/– recipient mice (105 cells/fat pad) with a 25-μL Hamilton syringe attached to a 27-gauge needle. Tumors were analyzed 2–3 weeks after transplantation by a fluorescence stereomicroscope.

Imaging of mammary gland whole mounts and 4T1 tumors with metastasis The transplanted glands were dissected at the indicated ages and were spread on a glass slide. The ductal outgrowths expressing a fluorescent marker protein were visualized using a Leica MZ16F stereomicroscope and LAS version 2.6 (Leica Microsystems, Wetzlar, Germany). Immunohistochemical analysis was performed on formalin-fixed paraffin sections (5 μm) cleared in xylene and

rehydrated through an alcohol series. Slides were stained with hematoxylin, dehydrated, and mounted. Staining was assessed using a Leica DMLS microscope (Leica Microsystems), and LAS version 2.6. Leica MZ16F stereomicroscope was also used for imaging of primary 4T1 tumors and distant metastases in recipient mice.

Results Expression of Smad4 and P-Smad2/3 proteins in mammary gland tissues and the mammary epithelial cell line HC11

We are studying the role of TGFβ signaling in mammary gland development and neoplasia. In a first step, we analyzed the presence of TGFβ signaling components in mammary tissue and in a derived cell line. Smad4 protein levels and the phosphorylation state of the Smad2/3 proteins in mammary gland tissue and in a non-tumorigenic cell line (HC11 cells) (Figure 1) were determined. Smad4 protein was consistently detected in cells obtained from subsequent developmental stages of mammary glands of BALB/c mice (upper bands, 70 kDa). The activation of the TGFβ signaling pathway is reflected by the phosphorylation state of the Smad2/3 proteins (P-Smad2/3) in whole-cell and nuclear extracts from mammary tissues (Figure 1A). The antibody used in the Western blot experiments recognizes P-Smad2 and P-Smad3. Higher levels of P-Smad2/3 proteins were expressed in nuclear extracts of mammary tissues obtained from pregnant and involuting mice (Figure 1A). We conclude that Smad4 is constitutively expressed in MECs throughout all stages of organ differentiation; however, the canonical TGFβ signaling was mainly active during pregnancy and involution. The expression of the Smad4 and P-Smad2/3 proteins was also studied in HC11 cells – a cell line isolated from the mammary gland of a midpregnant BALB/c mouse [35, 36]. Both growing and lactogenic hormone-induced (DIP) HC11 cells expressed Smad4 protein. Lower levels of P-Smad2/3 proteins were observed in growing cells when compared to DIP-induced HC11 cells (Figures 1B and 3B), consistent with the growth inhibitory function of this pathway in mammary cells. Downregulation of Smad4 in mammary epithelial cell lines and in primary MECs

The binding of TGFβ1 to its receptor II (TβRII) activates the TGFβ receptor type I (TβRI) kinase, which catalyzes the phosphorylation of Smad2 and Smad3. P-Smad2 and P-Smad3 form a trimeric complex with Smad4, which translocates to the nucleus and induces target gene transcription. Smad4 is therefore an essential component of TGFβ-dependent transcriptional regulation and a suitable target for interference. In order to inhibit canonical TGFβ signaling, we tested three different shSmad4 constructs expressed in the pLKO.1puro lentiviral vector in growing HC11 cells (Figure 2). The shSmad4.3 construct strongly suppressed Smad4 expression

Vafaizadeh et al.: TGFβ signaling in normal and malignant mammary epithelial cells

h 96 Inv h 24 Inv d 5 ct La 0d ct La 20 eg Pr 0 d 1 eg d Pr 5 eg gin Vir Pr

eg

eg

5d in

g Vir

eg

h 96 Inv h 24 Inv d 10 ct La t 5 d c La 0d ct La d 19 eg d 5 Pr 1 d 10 Pr

Pr

Pr

A

231

- P-Smad2/3 60 kDa - Smad4 70 kDa - Actin 42 kDa Nucleus extracts - P-Smad2/3 60 kDa

B

HC11 epithelial cells

n io ct du In n tio va ar St g in w

G

ro

HC11 epithelial cells

ro

n io ct du In n tio va ar St g in w

G

- β-Casein 28 kDa

- P-Smad2/3 60 kDa

- Smad4 70 kDa

- Actin 42 kDa

- Actin 42 kDa

Figure 1 Analysis of Smad4 and P-Smad2/3 protein expression in different developmental stages of mammary gland tissues and in HC11 cell line. (A) Whole mammary tissue lysates were isolated from mice at different developmental stages (virgin, pregnancy, lactation, and involution). The Smad4 protein levels (upper bands) and the phosphorylation state of the Smad2/3 proteins were determined by Western blot analysis in whole tissue lysates. The used antibody was specific for P-Smad2 protein and could also recognize P-Smad3 protein. P-Smad2/3 was then monitored in nucleus extracts of mammary tissues. (B) Whole cell lysates were isolated from HC11 cells – a non-tumorigenic mammary epithelial cell line – cultured under growing, starvation (growing medium without insulin), and hormone-induced condition (DIP). β-Casein expression served as a marker for cell differentiation. The Smad4 protein levels and the phosphorylation state of P-Smad2/3 proteins were determined in growing, starvation, and DIP-induced HC11 cells by Western blot analysis. d, Day; h, hour; Inv, involution; Lact, lactation; non td, non-transduced; Preg, pregnancy.

No

shS n td

ma

d4.

shS 1

ma

d4.

shS 2

ma

4T1 tumor cells

MECs

HC11 epitherlial cells (growing)

d4.

3

No

shS n td

ma

d4.

3

No

n td

shS

ma

d4.

3 - Smad4 70 kDa - Actin 42 kDa

Figure 2 Knockdown of Smad4 in non-tumorigenic MECs and in tumorigenic 4T1 cells. Three different specific shRNAs were tested in growing HC11 cells. Cells were transduced with shSmad4 constructs in the pLKO.1-puro lentiviral vector. The extent of Smad4 downregulation was analyzed by Western blotting 3 days after viral infection. The best shSmad4 construct (shSmad4.3) was then used for the efficient downregulation of this protein in primary MECs isolated from virgin female mice and in 4T1 cells – a tumorigenic mouse tumor cell line.

in HC11 cells. This construct was used in subsequent experiments to downregulate Smad4 protein in MECs, isolated from BALB/c virgin mice, and in the 4T1 tumorigenic cell line. This tumor cell line was originally isolated from a spontaneous mammary tumor in a BALB/c mouse [37]. Downregulation of Smad4 expression does not affect the in vitro growth characteristics, but enhances the invasiveness of HC11 and 4T1 cells

We investigated the consequences of Smad4 downregulation on proliferation and the invasion capacity of HC11 and 4T1

cells (Figure 3). HC11 cells were transduced with shSmad4 or with the pLKO control vector. The downregulation of Smad4 had no significant effect on the proliferation of HC11 cells, when non- and pLKO-transduced cells were compared in XTT assays (Figure 3A). The downregulation of Smad4 did also not affect the functional differentiation of HC11 cells. Upon induction with the lactogenic hormones, both Smad4 expressing and non-expressing HC11 cells respond with the expression of β-casein (Figure 3B). The analysis of the Smad4 protein levels showed that the downregulation of Smad4 was stable in growing HC11 cells, but that it resumed in DIP-induced cells. These results were also confirmed in

Vafaizadeh et al.: TGFβ signaling in normal and malignant mammary epithelial cells

XTT (absorbance A490 nm –A650 nm)

232

C

A 4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0

HC11 cells growing condition

B HC11

pLKO

HC11 cells differentation condition cS Si E 5 Si w/s cS F/s No Ew/ hSm 5F/p hSm p n LK ad LK ad td O 4 O 4

cS Si Si Ew/ cS 5F/s E s No w/p hSm5F/ hSm p n LK td O ad4 LKO ad4

shSmad4

β-Casein 28 kDa

- β-Casein 28 kDa

Smad4 70 kDa

- Smad4 70 kDa

P-Smad2/3 60 kDa

0

24

48

72

Time, h

- P-Smad2/3 60 kDa - Actin 42 kDa

- Actin 42 kDa

D Absorbacne A570 nm

6 5 4 3 2 1

ad

4

KO

Sm

pL 1

1

sh

4T

4T

H

C

H

11

C

sh

11

Sm

pL

ad

KO

4

0

Figure 3 Effects of Smad4 knockdown on HC11 cell proliferation, differentiation, and invasion. (A) The proliferation (viability) of non-, pLKO-, and shSmad4-transduced HC11 cells was determined using XTT assay. Five hundred cells per well were grown for 24, 48, or 72 h in a 96-well microtiter plate in triplicate. The metabolic activity of cells was determined by adding 50 μL of the yellow activated-XTT solution into each well, 4 h before measurement. The metabolism of XTT to the orange water-soluble formazan salt by viable cells was then measured using an ELISA reader at 490 nm with a reference wavelength at 650 nm. Non- and pLKO-transduced cells were used as controls. (B) Effect of Smad4 downregulation on HC11 cell differentiation was determined by Western blot analysis. Non-, ctrl-, and shSmad4-transduced HC11 cells cultured under growing and hormone-induced (DIP) conditions. β-Casein expression served as a marker for cell differentiation. The effect of Smad4 downregulation on HC11 cell differentiation was also verified in cells expressing a constitutively activated mutant form of mouse Stat5a (cS5F, S711F), which strongly increased β-casein expression. (C) Downregulation of Smad4 expression promoted invasiveness of HC11 and 4T1 cells in a Matrigel invasion assay. The membranes (8 μm pores) were coated with 75 μg Matrigel. pLKO- or shSmad4-transduced cells (5 × 104) were added to the upper chambers of inserts in a 12-well plate. One milliliter of growing medium with 10% serum (as chemoattractant) was placed in the lower wells. The cells were allowed to migrate through the Matrigel at 37°C, 5% CO2 for 20 h (HC11 cells) or 16 h (4T1 cells). After the formalin fixation and the removal of non-migrated cells on the upper surface of the filter, the cells that migrated through the Matrigel to the underside of the filter were stained with crystal violet. Representative photomicrographs show invasive HC11 (b) or 4T1 (f) cells attached to the lower membrane of transwells. pLKO-transduced control cells show much less invasiveness (a and e). Higher magnifications are shown in c, d, g, and h. (D) Absorbance of dissolved crystal violet was measured at 570 nm with ELISA plate reader. cS5F, constitutively activated mouse Stat5a mutant (S711F); d, day; h, hour; non td, non-transduced; SiEW, the lentiviral vector pSIN.cPPT-SFFV/ EGFPWPRE contains an IRES for the expression of a cDNA in addition to EGFP.

HC11 cells expressing a constitutively activated variant of Stat5 (cS5F) (Figure 3B) and indicate that the lentiviral gene expression vector encoding shSmad4 might become silenced under induction conditions. The downregulation of Smad4 can possibly shift the balance between canonical, Smad-dependent and non-canonical, Smad-independent TGFβ signaling and thus promote EMT. We tested the consequences of Smad4 knockdown on the invasiveness of growing HC11 cells (Figure 3C). Invasiveness was measured by letting the cells traverse a Matrigel-coated membrane. Invasive cells were visualized by crystal violet staining and quantified by measuring the absorbance of dissolved crystal violet at 570 nm with an ELISA plate reader (Figure 3D). The downregulation of Smad4 expression in HC11 cells enhanced their invasion capacity. The downregulation of Smad4 expression also

promoted the invasiveness of shSmad4-transduced 4T1 cells in comparison to the parental tumor cells (Figure 3C and D). Downregulation of Smad4 expression in transplanted MECs causes subtle effects on glandular morphogenesis in vivo

Targeted disruption of components of canonical TGFβ signaling in mice has revealed multiple essential roles of this signaling pathway in mammary gland development and neoplasia. We investigated the effects of Smad4 downregulation in vivo with an alternative approach that allows us circumvent germ line modifications and tissue-specific promoter constructs [33]. This approach is based on the genetic manipulation of mammary stem cells (MaSCs) ex vivo and the reconstitution

Vafaizadeh et al.: TGFβ signaling in normal and malignant mammary epithelial cells

of functional epithelium upon transplantation of these stem cells into cleared fat pads. In order to analyze the consequences of Smad4 downregulation in vivo, primary MECs were isolated from adult virgin BALB/c mice and transduced either with pLKO or shSmad4 lentiviral vectors. To visualize transgenic grafts in vivo, cells were simultaneously transduced with LeGO-V vector expressing a fluorescent marker protein (Venus). pLKO/LeGO-V- or shSmad4/LeGO-V-transduced primary cells (105) were transplanted into contralateral fat pads of inguinal mammary glands of 3-week-old Rag2−/–γc−/– recipient mice. Transgenic grafts were analyzed in virgin recipients 8 weeks after transplantation (Figure 4A) or in late pregnant mice (Figure 4B) by fluorescence stereomicroscopy. Different magnifications of the pLKO/ LeGO-V (A and B) or shSmad4/LeGO-V (C and D) whole mounts are shown. Whole mounts were fixed and stained with carmine alum for morphological studies (E–H, two different magnifications for each graft). Paraffin sections from pLKO/ LeGO-V grafts (I and J) or shSmad4/LeGO-V grafts (K and L) of virgin or pregnant recipient mice were stained with hematoxylin in order to compare the morphological differences. All transgenic grafts grew out and fill the entire fat pad. Only small differences between the ductal structures originating from Smad4 expressing and non-expressing MaSCs were observed. Smad4 downregulated MaSCs give rise to ducts with slightly abnormal branching morphogenesis when compared to control glands. Subtle differences in branching and alveologenesis were still observed during pregnancy.

A

233

The Western blot analysis of tissue extracts isolated from shSmad4 transgenic grafts show that Smad4 was restored upon glandular outgrowth and expressed at the same levels as in control grafts or glands isolated from the thoracic mammary gland #3 without transplantation (Figure 4C). This is a surprising result and indicates that silencing of the viral gene transfer vector has occurred. Orthotopic transplantation of shSmad4-transduced 4T1 tumor cells results in enhanced colonization and lung macrometastases

In vitro invasion assays revealed that downregulation of Smad4 protein enhances the invasiveness of 4T1 cells. 4T1 cells in which Smad4 has been downregulated expressed significantly lower levels of phosphorylated Smad2/3 proteins and target genes of canonical TGFβ signaling, e.g., Angptl4 and Id1 (Figure 5A). In contrast, the expression level of P-Stat3 was not affected. The effect of Smad4 knockdown on the ability of 4T1 cells to form tumor spheres was investigated. The sphere culture with shSmad4-transduced 4T1 tumor cells was enriched in sphere-initiating cells when compared to cultures with non-transduced 4T1 cells (Figure 5B). The property of tumor cells to form spheres in nonadherent cultures has been associated with the characteristics of cancer stem cells and tumor-initiating cells. The suppression of Smad4 expression might cause an enrichment of such cells.

B

Virgin recipients

C

Pregnant recipients

1

C

#3 gl trl C 4 KO M pL trl o-V C 4 eG M L d4 a Sm -V sh o 4 eG M L #3 gl trl C 3 KO M pL trl -V C O 3 G M Le d4 a Sm -V sh o 3 eG M L d4 a Sm -V sh O 2 G M Le d4 a Sm -V sh O 1 eG M L l #3 g trl

M

- Smad4 70 kDa - Actin 42 kDa

Figure 4 Transgenic grafts with initial expression of shSmad4 show effects on ductal branching and alveologenesis. Primary MECs were transduced with shSmad4 or control vector pLKO.1-puro. In order to visualize the cells in vivo, MECs were also transduced with LeGO-V vector expressing green fluorescent protein Venus. pLKO- or shSmad4-transduced MECs (1 × 105) were transplanted into the contralateral fat pads of 3-week-old Rag2−/–γc−/– recipient mice. Transgenic grafts were analyzed in virgin recipients 8 weeks after transplantation (A) or were analyzed in late pregnant recipients (B) by fluorescence microscopy (A–D). Whole mounts were then fixed and stained with carmine alum for morphological studies (E–H). Paraffin sections (5 μm) from pLKO- or shSmad4-expressing grafts in virgin recipient mice were stained with hematoxylin (I–L). (C) Whole mammary tissue lysates were isolated from transgenic grafts expressing either shSmad4/LeGO-V or control vectors ctrl-pLKO/LeGo-V. The protein expression levels of Smad4 are shown in transplanted glands and control glands (#3) isolated from four virgin or pregnant recipients.

234

Vafaizadeh et al.: TGFβ signaling in normal and malignant mammary epithelial cells

B

Le

V oG Le ) 4 + -C a d GO S m ( Le - C O sh trl G C Le t d sh on N

(L

V oG Le 4 + -C) ad O eG - C O G

trl

Sm

C sh

sh

A

Smad4 70 kDa

Sphere culture

- P-Stat3 79, 86 kDa

P-Smad2/3 60 kDa

- Angptl4 50 kDa

Actin 42 kDa

- Actin 42 kDa

Figure 5 Knockdown of Smad4 in vitro negatively influences expression of Angptl4 and P-Smad2/3 proteins but has no effect on P-Stat3 expression. (A) Cell lysates were isolated from 4T1 cells 4 days after viral transduction. Cells expressing shSmad4/LeGoV constructs show loss of Smad4 protein expression and significantly lower levels of phosphorylated Smad2/3 proteins in comparison to control cells transduced with LeGO-C or ctrl-shRNA/LeGO-C vector. The expression of the lung metastasis factor Angptl4 was strongly reduced in shSmad4-transduced 4T1 cells but not in non- and mock-transduced 4T1 cells. No difference in the expression levels of P-Stat3 (Stat3α 86 kDa and Stat3β 79 kDa) was observed in cells with and without knockdown. (B) Outcome of Smad4 knockdown on ability of 4T1 cells to form tumorspheres was investigated in sphere culture system. Non- and shSmad4-transduced 4T1 cells were plated as single cells in ultra-low attachment plates to form spheres. The sphere culture with 4T1 tumor cells expressing shSmad4 were enriched in sphere-initiating cell in comparison to cultures with non-transduced 4T1 cells.

We also analyzed the consequences of Smad4 downregulation in vivo. 4T1 cells were transduced with shSmad4/LeGO-C or control vectors pLKO/LeGO-V. The expression of fluorescent marker proteins encoded by the LeGO vectors was used to visualize distant metastases in vivo and to trace their origin to the transduced cell population. After puromycin selection, 1 × 105 transduced 4T1 cells were transplanted into the fat pads of recipient mice (Figure 6). Representative photomicrographs are shown for two of the analyzed primary tumors (Figure 6A–D) and the corresponding metastatic lesions to the lungs, liver (Figure 6G and H), spleen, and bone marrow (Figure 6E and F). Higher magnifications are shown for lung and liver metastasis (Figure 6I and J). We prepared tissue extracts from primary tumors derived from shSmad4/LeGO-C- or ctrl-pLKO/LeGO-Vtransduced 4T1 cells and determined the expression levels of Smad4 and P-Smad2/3 (Figure 6K). The protein extracts were isolated from three recipient mice (M1–M3) and compared with extracts isolated from cultured, adherent 4T1 tumor cells and from healthy mammary glands and lung tissues. Previous studies have shown that transplanted 4T1 tumor cells are dependent on Stat3 activation for tumor formation and metastasis [38]. We observed no effect on the phosphorylation status of Stat3 in primary tumors; however, P-Stat3 was more highly expressed in the lungs with metastatic lesions than in primary tumors. The influence of the extent of Stat3 activity on the establishment of metastasis and its role in the formation of premetastatic niches remain interesting questions. We also analyzed the effects of Smad4 downregulation on the ability of 4T1 cells to metastasize at distant sites in comparison to tumor cells transduced with a scrambled

shRNA (ctrl-shRNA). 4T1 cells were transduced with shSmad4/LeGO-V or with ctrl-shRNA/LeGO-C and injected into the contralateral fat pads of recipient mice. Two to three weeks after transplantation, we analyzed the mice and compared the primary tumors (Figure 7A–C) and their metastasis potential (Figure 7D–I). Although the primary tumors expressing shSmad4 or ctrl-shRNA construct show no significant difference in tumor growth, we observed more macroscopic metastases in the lungs (Figure 7D–F) and in distant mammary glands (Figure 7G–I) derived from shSmad4/LeGO-V-transduced 4T1 cells. This result suggests that downregulation of Smad4 increases the metastatic potential of 4T1 cells. The expression of Smad4 was analyzed by Western blotting in tissue lysates isolated from two recipient mice (M1 and M2). Both shSmad4 primary tumors showed similar levels of Smad4 and P-Smad2/3 proteins when compared to tumors expressing the scrambled shRNA (Figure 7J). Again, we assume that upon prolonged periods of growth, and tumor formation and metastasis, the gene transfer vector has been silenced in these cells. The reactivation of TGFβ signaling induces the expression of Angptl4 and Id1 proteins in the tumors (Figure 7K) and tumor cells isolated from the lungs (Figure 7M). Angptl4 was specific for lung metastases and was not expressed in tumor cells isolated from the brain (Figure 7M). For the isolation of metastatic 4T1 cells, lung and brain tissues were digested with a collagenase solution. The isolated cells were then cultured and selected with 6-thioguanine. 4T1 tumor cells are resistant to 6-thioguanine [37]. We observed upregulation of vimentin, a mesenchymal marker, in shSmad4-transduced tumor cells in comparison to non-transduced cells. Vimentin was also strongly expressed in 4T1 tumor cells isolated from the lungs and brain metastatic lesions (Figure 7L).

Vafaizadeh et al.: TGFβ signaling in normal and malignant mammary epithelial cells

C trl w o

o

M TS

h

TS

M

ad

C

TS

o-

M

G

TS

TS

M

lls

w

ce

G

ng

M

lu

trl

ith

Le

o

TS

M

M

-V

O

-C

TS

O

G

o

w

w

ith

Le

w

4

1

ng

4T

Lu

ad

G

w

trl

ng

M

lu

Sm

trl

C

sh

C

trl

ng

C G

M

V

-C

h

o-

O

G

Le

ith

Le

w

4

ng

ad

Lu

Sm

Lu trl

ad

G

lls

Le

ce

4

C

1

ad

4T

Sm

C

sh

sh

K

235

Smad4 70 kDa

- Smad4 70 kDa

P-Smad2/3 60 kDa

- P-Smad2/3 60 kDa

P-Stat3 79, 86 kDa

- P-Stat3 79, 86 kDa

β-tubulin 56 kDa

- β-tubulin 56 kDa 4T1

4T1 tumors in M1

4T1 tumors in M2

Ctrl tissues

4T1 tumors in M3

4T1

Ctrl tissues

Figure 6 4T1 tumor cells transduced with shSmad4 construct show enhanced tumor growth and progression. (A–D) 4T1 tumor cells were transduced with shSmad4 or control vector pLKO. To visualize the tumor cells in vivo, they were additionally transduced with LeGO-C or LeGO-V vectors expressing mCherry or Venus fluorescent protein, respectively. Double transduced cells were selected with puromycin and FACS sorter. shSmad4/LeGO-C- or pLKO/LeGO-V-transduced cells (1 × 105) were then injected into the contralateral inguinal fat pads of Rag2−/–γc−/– recipient mice. Tumors were analyzed 2–3 weeks after orthotopic transplantation by a fluorescence stereomicroscope. (E–H) Distant micrometastatic lesions for shSmad4- and pLKO-transduced 4T1 cells are shown in bone marrow (E and F) and in lungs and liver (G and H). (I and J) Higher magnifications of lungs (I) and liver (J) metastasis are shown. (K) Protein expression levels of Smad4, P-Smad2/3, and P-Stat3 are shown in three examples of shSmad4 and control 4T1 tumors isolated from three recipient mice (M1–M3). These data are compared to some control tissues (wild-type lungs and mammary glands) and cultured 4T1 cell line (4T1). BM, bone marrow; Ctrl, control; M, mouse; MTS, metastasis.

Discussion The role of TGFβ signaling in tumorigenesis is not perfectly unambiguous and can result in tumor suppression or tumor promotion, depending on the context of cell types and signaling outputs. Clinical and molecular studies have shown that TGFβ signaling in tumor cells and their microenvironment primes metastases formation in specific organs, e.g., lungs and bone. On the one hand, a mechanism involved could involve cytokines, such as TGFβ secreted from tumor cells, the activation of adjacent stromal fibroblasts, and the recruitment of immune cells into the tumor. On the other hand, secreted TGFβ from stromal cells and immune cells can also induce

a transient and reversible EMT in tumor cells and enhance metastasis [39]. These TGFβ-dependent host-tumor cell interactions play important roles in the regulation of tumor initiation, progression, and metastasis. Previous studies showed that both gain and loss of canonical TGFβ signaling in carcinoma cells can promote metastasis in different cellular contexts through different mechanisms [9]. Due to the ambiguity of TGFβ-induced cell responses, we explored the consequences of the inactivation of canonical TGFβ signaling on both normal and malignant development of mammary glands, especially on the growth and colonization of tumor cells at distant sites. In the mammary gland, TGFβ signaling regulates different phases of postnatal mammary gland development. It has a

236

Vafaizadeh et al.: TGFβ signaling in normal and malignant mammary epithelial cells

K

-V O G Le -C O 4 ad LeG -V O Sm trl G sh hC Le -C s 4 O ad eG -V Sm rl L sh t GO C sh Le -C O 4 ad LeG -V Sm trl GO sh hC Le -C s d4 O a eG L Sm trl sh hC s Smad4 70 kDa

TS M ith -C w O ng eG -V Lu trl L O C eG sh 4 L TS ad t h M C S m w i Osh ng eG V Lu trl L O C eG sh 4 L ad Sm sh

J

- Angptl4 50 kDa

- P-Smad2/3 60 kDa

Actin 42 kDa

- ld1 16 kDa

- Actin 42 kDa M1 M2 4T1 tumors

- Actin 42 kDa

M1 M2 4T1 tumors M1 M2 4T1 tumors 4T1 tumors

4T

1

1

4T

4T

TS br n

1

2

ai

ng

ng

lu

lu

- CK18 45 kDa - Vim 54 kDa - Actin 42 kDa

M

TS

TS

M

M

sh

1

M

n ai br 3 TS g M lun 1 2 4T TS ng M lu 1 1 4T TS ng M lu 1 4T TS 4T1 M 4 1 ad T1 4T 4 Sm td on N

L

- Angptl4 50 kDa - ld1 16 kDa - Actin 42 kDa 4T1 tumor cells isolated from MTS

Figure 7 Changes in canonical TGFβ signaling and expression of Angptl4, Id1, and vimentin in tumor cells promoted their distant colonization and macrometastases abilities. (A–C) 4T1 tumor cells were double transduced with shSmad4/LeGO-V or ctrl-shRNA/LeGO-C vectors. After the selection for transduced 4T1 cells, 1×105 shSmad4/LeGO-V- or ctrl-shRNA/LeGO-C-transduced cells were injected into the contralateral inguinal fat pads of Rag2−/–γc−/– recipient mice. Tumors were analyzed 2–3 weeks after orthotopic transplantation by a fluorescence stereomicroscope. Two representative primary tumors in a recipient mouse are shown (A). They expressed marker proteins Venus (B) and mCherry (C). (D–F) Distant micrometastatic lesions for shSmad4- and ctrl-shRNA-transduced cells are shown in lungs. (G–I) Representative photomicrograph is shown for distant mammary gland metastases of shSmad4/LeGO-V-transduced 4T1 cells. (J) Tissue lysates were isolated from primary tumors and lungs with metastasis from two representative recipient mice (M1 and M2). The analysis of Smad4 and P-Smad2/3 protein levels show that primary tumors arising from shSmad4-transduced 4T1 cells lose the knockdown of Smad4 during tumor progression. (K) According to the reactivation of canonical TGFβ signaling in these primary tumors, they expressed again Angptl4 and Id1 proteins, which are crucial for seeding and colonization of tumor cells in lungs. (L) Extent of cytokeratin 18 (epithelial marker) and vimentin (mesenchymal marker) expression was analyzed in shSmad4-transduced and non-transduced 4T1 cells under adherent conditions. The expression of vimentin was increased in 4T1 cells with stable shSmad4 knockdown. This upregulation was much higher in 4T1 tumor cells isolated from the lungs and the brain of transplanted recipients. For the isolation of metastatic 4T1 cells, lung and brain tissues were digested with a collagenase solution. The isolated cells were then cultured and selected with 6-thioguanine. 4T1 tumor cells are resistant to 6-thioguanine. (M) Angptl4 and Id1 proteins were also expressed in tumor cells isolated from lungs but not from the brain of transplanted recipients.

central role in ductal growth and patterning of the mammary gland by acting as a negative regulator of ductal cell proliferation and of branching morphogenesis [10, 40]. The contribution of TGFβ signaling in mammary gland development has been investigated in transgenic mouse models. Its inhibition by expression of truncated, dominant-negative TGFβRII resulted in alveolar hyperplasia and precocious synthesis of β-casein milk protein in virgin mice [41]. In contrast, ectopic expression of TGFβ1 or activated TGFβRII resulted in a lactation-deficient phenotype with decreased alveologenesis and increased apoptosis [42, 43]. These findings suggest that TGFβ signaling regulates side branching and prevents premature alveologenesis and milk secretion [44, 45]. We show that Smad4 is constitutively expressed during different stages of mammary gland development. Canonical TGFβ signaling was, however, mainly active during pregnancy and early involution, indicated by the phosphorylation state of the Smad2/3 proteins. Persistent Smad4 expression was also observed in growing and hormone-induced HC11 cells. Interestingly, the stable knockdown of Smad4 in vitro enhanced the invasive potential of non-tumorigenic HC11. However, this knockdown was only stable in growing cells but not in DIP-induced HC11 cells. It appears that

these cells require canonical TGFβ signaling for functional differentiation. In order to investigate the effects of Smad4 downregulation in vivo, we used an alternative approach to the Smad4 conditional transgenic mouse models. In this approach, primary MECs were transduced ex vivo with lentiviral vectors expressing the shSmad4 construct. Cleared fat pad transplantation was then used for the selection of gene-modified MaSCs, which could reconstitute the whole ductal system in vivo [33]. Whole-mount analyses of transgenic grafts show that ducts could grow and fill the entire fat pad. However, they show an abnormal branching morphogenesis compared to control glands. Subtle effects on branching and alveologenesis could also be observed during pregnancy. Analysis of Smad4 protein levels in tissue extracts isolated from transplanted and control glands showed the loss of Smad4 knockdown in grafts that originated from shSmad4-transduced cells. In previous studies, we observed that shRNA constructs regulated by the U6 promoter in pLKO.1-puro vector system are not stably expressed in long-term in vivo studies. The knockdown of the target genes was more persistent if the shRNA constructs were present in lentiviral vector systems, such as SEW or LeGO. We suggest that the expression

Vafaizadeh et al.: TGFβ signaling in normal and malignant mammary epithelial cells

of shRNA under the H1 promoter in the LTR region of SEW vector or under the U6 promoter close to a strong promoter like spleen focus forming virus promoter (SSFV) in LeGO vector system can improve and prolong the knockdown effect in vivo. Although the expression of the shSmad4 construct in pLKO.1-puro vector resulted in a temporary knockdown of Smad4 in vivo, similar phenotypes were observed as in Smad4 conditional knockout mouse models. Due to the early lethality of Smad4 knockout mice at embryonic days 6–7, Smad4Co/CoWAP-Cre and Smad4Co/Co MMTV-Cre mice were generated. Using these conditional knockout mouse models, it has been shown that the loss of Smad4 in mammary epithelium does not disrupt mammary development during the first few pregnancies. However, it resulted in gradually induced cell proliferation, alveolar hyperplasia, and transdifferentiation of MECs into squamous epithelial cells [46]. There is growing evidence that tumor-initiating cells with stem cell properties are responsible for the initiation of the primary tumor and distant metastases. Metastasis is a non-random process. The metastatic cascade requires the acquisition of genetic or epigenetic changes and contains at least four stages: (i) the dissociation of cells from the primary tumor and their invasion through the basement membrane, (ii) the intravasation and survival in the circulatory system, (iii) the extravasation and survival in distant tissues, and (iv) the growth and colonization at the metastatic sites. Recent studies investigate molecular mechanisms regulating different stages of the metastatic cascade. These investigations show that the TGFβ signaling pathway is a major regulator of EMT-associated emergence of tumor-initiating cells [14, 47, 48]. It also modulates epithelial plasticity by promoting EMT and the reverse process MET [1]. TGFβ functions in the regulation of pathophysiological EMT, stemness, and cancer cell plasticity have strong impacts on tumor metastasis and drug resistance [3]. In addition, the effects of TGFβ signaling on the tumor microenvironment and inhibition of immune cell function make the components of this signaling pathway attractive as drug targets. However, this targeting may carry a substantial risk as this pathway has tumor suppressor functions and regulates tissue homeostasis in epithelial tissues, such as the mammary gland [31]. Due to the diversity of TGFβ-induced cell responses, we explored the consequences of canonical TGFβ signaling inactivation on malignant development of the mammary gland, and especially on the growth and colonization of tumor cells at distant metastatic sites, such as the lungs. 4T1 mammary carcinoma cell line, as a model for the study of late-stage breast cancer, was used to investigate the effects of Smad4 downregulation in tumor progression. This mouse tumor cell line has the capacity to metastasize efficiently to sites affected in human breast cancer, i.e., lungs, liver, bone, and brain [49]. Stable downregulation of Smad4 in vitro promoted the invasiveness of 4T1 cells and increased mesenchymal markers, such as vimentin in these cells. In order to test the effects of this knockdown in vivo and to visualize the metastatic lesions, we simultaneously transduced 4T1 cells with two different vector systems: pLKO.1-puro and LeGO vectors for the expression of the shSmad4 construct and a fluorescent marker protein, respectively. Because of immune

237

reaction, the application of Rag2−/–γc−/– recipient mice provides a significant advantage for the engraftment of cells or tissues, which express fluorescent marker proteins. Rag2/γc double-deficient mice have essentially no T, B, and NK cells. Orthotopic transplantation of 4T1 tumor cells expressing shSmad4 results in the formation of more pulmonary metastatic lesions in comparison to parental 4T1 tumor cells in the same recipient mice. No effect of the phosphorylation status of Stat3 was observed in these tumors; however, Stat3 activation was much stronger in lungs with metastatic lesions than in primary tumors. Although we observed only a temporary downregulation of the Smad4 protein in vivo, it was sufficient to promote more metastatic lesions in the lungs. We suppose that Smad4 knockdown could inhibit the tumor-suppressive effects of the Smaddependent cytostatic functions of TGFβ signaling and cause a shift toward non-canonical TGFβ signaling, which promotes EMT. Recent studies show that EMT is required to accomplish the first steps of metastasis; however, in some tumor models, such as 4T1 tumors, the reverse process MET is crucial for the final step of colonization and the formation of macroscopic metastases at distant metastatic sites [50]. It has been shown that the reversion of the mesenchymal phenotype of malignant cells can facilitate the establishment of macroscopic metastases [51–53]. We suggest that the reactivation of canonical TGFβ signaling during tumor progression can induce more epithelial characteristics in 4T1 tumor cells, which can enhance their colonization and metastasis in the lungs. Investigations of the final step of metastasis and colonization of distant tissues show that the miR-200 family is highly upregulated in 4T1 tumor cells compared to 4TO7 tumor cell line, which can disseminate into the lungs but do not form visible lung nodules [50]. Surprisingly, the miR-200 family (miR-429, miR-200b, and miR-200c) negatively regulates the transcriptional repressor Zeb2 (SIP1), which suppresses the epithelial phenotype by inhibiting E-cadherin expression. This inhibition promotes MET and seems to be required for the colonization of 4T1 tumor cells at metastatic sites and the formation of macroscopic metastases in the lungs [50]. Due to the fact that the miR-200 family is regulated by TGFβ signaling, its expression and effects on Zeb2 (SIP1) should be investigated in our tumor model. Besides, there is some evidence that a cooperation between both EMT and non-EMT cells is required to complete the spontaneous metastasis process [1]. Based on clinical and molecular evidence, several studies identified sets of genes in which their overexpression in tumor cells confers a selective advantage for the colonization of lungs [30, 31] or bones [54, 55]. For lung metastasis, factors, such as Angptl4 and Id1 were identified, which are regulated by canonical TGFβ signaling. It has been shown that tumor cells with enhanced Angptl4 expression can enter the circulation and disrupt lung capillary endothelial junctions to selectively seed lung metastasis [30]. Id1, another target gene of TGFβ signaling, can enhance tumor reinitiation after tumor cells enter the lung parenchyma [56]. Our analysis of the expression levels of both Angptl4 and Id1 proteins showed that they are downregulated in 4T1 cells with provable Smad4 knockdown. However, the reactivation of canonical TGFβ signaling in vivo could restore their expression in tumor cells with initial Smad4 knockdown. We isolated the tumor cells

238

Vafaizadeh et al.: TGFβ signaling in normal and malignant mammary epithelial cells

from the metastatic lesions in the lungs and brain. 4T1 tumor cells are resistant to 6-thioguanine and can be efficiently isolated and selected from metastatic tissues in vitro [37]. Due to the fact that the isolated metastatic 4T1 cells from the lungs, but not from the brain, showed the expression of both Angptl4 and Id1 proteins, we assumed that a stable downregulation of canonical TGFβ signaling in vivo can enhance the early metastatic events, but it may block the final step of colonization and the formation of macroscopic metastases into the lungs. Due to the importance of the investigation of transient effects of TGFβ signaling, we are now studying the effects of inducible shSmad4 expression in different cellular contexts and different stages of mammary tumorigenesis.

Acknowledgments This work was supported by grants from the LOEWE Schwerpunkt Onkogene Signaltransduktion Frankfurt and the LOEWE Center for Cell and Gene Therapy funded by the Hessian Ministry of Higher Education, Research and the Arts. We thank the Central Institute for Experimental Animals in Japan for the RAG2 KO mice (Balb/cARAG2KO, IL-2RγKO) used in this study as recipient mice.

References 1. Micalizzi DS, Farabaugh SM, Ford HL. Epithelial-mesenchymal transition in cancer: parallels between normal development and tumor progression. J Mammary Gland Biol Neoplasia 2010;15:117–34. 2. Drasin DJ, Robin TP, Ford HL. Breast cancer epithelial-to-mesenchymal transition: examining the functional consequences of plasticity. Breast Cancer Res 2011;13:226. 3. Dave B, Mittal V, Tan NM, Chang JC. Epithelial-mesenchymal transition, cancer stem cells and treatment resistance. Breast Cancer Res 2012;14:202. 4. Parvani JG, Taylor MA, Schiemann WP. Noncanonical TGF-β signaling during mammary tumorigenesis. J Mammary Gland Biol Neoplasia 2011;16:127–46. 5. Bierie B, Moses HL. Transforming growth factor β (TGF-β) and inflammation in cancer. Cytokine Growth Factor Rev 2010;21:49–59. 6. Massagué J, Seoane J, Wotton D. Smad transcription factors. Genes Dev 2005;19:2783–810. 7. Mullen AC, Orlando DA, Newman JJ, Lovén J, Kumar RM, Bilodeau S, Reddy J, Guenther MG, DeKoter RP, Young RA. Master transcription factors determine cell-type-specific responses to TGF-β signaling. Cell 2011;147:565–76. 8. Massagué J. TGFβ in cancer. Cell 2008;134:215–30. 9. Bierie B, Moses HL. Gain or loss of TGFβ signaling in mammary carcinoma cells can promote metastasis. Cell Cycle 2009;8:3319–27. 10. Roarty K, Serra R. Wnt5a is required for proper mammary gland development and TGF-β-mediated inhibition of ductal growth. Development (Cambridge, England) 2007;134:3929–39. 11. Serra R, Easter SL, Jiang W, Baxley SE. Wnt5a as an effector of TGFβ in mammary development and cancer. J Mammary Gland Biol Neoplasia 2011;16:157–67. 12. Jönsson M, Dejmek J, Bendahl PO, Andersson T. Loss of Wnt-5a protein is associated with early relapse in invasive ductal breast carcinomas. Cancer Res 2002;62:409 –16.

13. Ying J, Li H, Yu J, Ng KM, Poon FF, Wong SC, Chan AT, Sung JJ, Tao Q. WNT5A exhibits tumor-suppressive activity through antagonizing the Wnt/β-catenin signaling, and is frequently methylated in colorectal cancer. Clin Cancer Res 2008;14:55–61. 14. Mani SA, Guo W, Liao MJ, Eaton EN, Ayyanan A, Zhou AY, Brooks M, Reinhard F, Zhang CC, Shipitsin M, Campbell LL, Polyak K, Brisken C, Yang J, Weinberg RA. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell 2008;133:704–15. 15. Qian B, Katsaros D, Lu L, Preti M, Durando A, Arisio R, Mu L, Yu H. High miR-21 expression in breast cancer associated with poor disease-free survival in early stage disease and high TGF-β1. Breast Cancer Res Treat 2009;117:131–40. 16. Kong W, Yang H, He L, Zhao JJ, Coppola D, Dalton WS, Cheng JQ. MicroRNA-155 is regulated by the transforming growth factor β/Smad pathway and contributes to epithelial cell plasticity by targeting RhoA. Mol Cell Biol 2008;28:6773–84. 17. Gregory PA, Bert AG, Paterson EL, Barry SC, Tsykin A, Farshid G, Vadas MA, Khew-Goodall Y, Goodall GJ. The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nat Cell Biol 2008;10:593–601. 18. Gregory PA, Bracken CP, Bert AG, Goodall GJ. MicroRNAs as regulators of epithelial-mesenchymal transition. Cell Cycle 2008;7:3112–8. 19. Ewan KB, Oketch-Rabah HA, Ravani SA, Shyamala G, Moses HL, Barcellos-Hoff MH. Proliferation of estrogen receptor-αpositive mammary epithelial cells is restrained by transforming growth factor-β1 in adult mice. Am J Pathol 2005;167: 409–17. 20. Ucar A, Vafaizadeh V, Jarry H, Fiedler J, Klemmt PA, Thum T, Groner B, Chowdhury K. miR-212 and miR-132 are required for epithelial stromal interactions necessary for mouse mammary gland development. Nat Genet 2010;42:1101–8. 21. Ucar A, Vafaizadeh V, Chowdhury K, Groner B. MicroRNAdependent regulation of the microenvironment and the epithelial stromal cell interactions in the mouse mammary gland. Cell Cycle 2011;10:563–5. 22. Buck MB, Knabbe C. TGF-β signaling in breast cancer. Ann NY Acad Sci 2006;1089:119–26. 23. Band AM, Laiho M. Crosstalk of TGF-β and estrogen receptor signaling in breast cancer. J Mammary Gland Biol Neoplasia 2011;16:109–15. 24. Russo J, Ao X, Grill C, Russo IH. Pattern of distribution of cells positive for estrogen receptor α and progesterone receptor in relation to proliferating cells in the mammary gland. Breast Cancer Res Treat 1999;53:217–27. 25. Mallepell S, Krust A, Chambon P, Brisken C. Paracrine signaling through the epithelial estrogen receptor α is required for proliferation and morphogenesis in the mammary gland. Proc Natl Acad Sci USA 2006;103:2196–201. 26. Grimm SL, Rosen JM. Stop! In the name of transforming growth factor-β: keeping estrogen receptor-α-positive mammary epithelial cells from proliferating. Breast Cancer Res 2006;8:106. 27. Levy L, Hill CS. Alterations in components of the TGF-β superfamily signaling pathways in human cancer. Cytokine Growth Factor Rev 2006;17:41–58. 28. Aitchison AA, Veerakumarasivam A, Vias M, Kumar R, Hamdy FC, Neal DE, Mills IG. Promoter methylation correlates with reduced Smad4 expression in advanced prostate cancer. Prostate 2008;68:661–74. 29. Stuelten CH, Buck MB, Dippon J, Roberts AB, Fritz P, Knabbe C. Smad4-expression is decreased in breast cancer tissues: a retrospective study. BMC Cancer 2006;6:25.

Vafaizadeh et al.: TGFβ signaling in normal and malignant mammary epithelial cells

30. Padua D, Zhang XH, Wang Q, Nadal C, Gerald WL, Gomis RR, Massagué J. TGFβ primes breast tumors for lung metastasis seeding through angiopoietin-like 4. Cell 2008;133:66–77. 31. Padua D, Massagué J. Roles of TGFβ in metastasis. Cell Res 2009;19:89–102. 32. Minn AJ, Gupta GP, Siegel PM, Bos PD, Shu W, Giri DD, Viale A, Olshen AB, Gerald WL, Massagué J. Genes that mediate breast cancer metastasis to lung. Nature 2005;436:518–24. 33. Vafaizadeh V, Klemmt P, Brendel C, Weber K, Doebele C, Britt K, Grez M, Fehse B, Desriviéres S, Groner B. Mammary epithelial reconstitution with gene-modified stem cells assigns roles to Stat5 in luminal alveolar cell fate decisions, differentiation, involution, and mammary tumor formation. Stem Cells 2010;28:928–38. 34. Dontu G, Abdallah WM, Foley JM, Jackson KW, Clarke MF, Kawamura MJ, Wicha MS. In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells. Genes Dev 2003;17:1253–70. 35. Danielson KG, Oborn CJ, Durban EM, Butel JS, Medina D. Epithelial mouse mammary cell line exhibiting normal morphogenesis in vivo and functional differentiation in vitro. Proc Natl Acad Sci USA 1984;81:3756–60. 36. Ball RK, Friis RR, Schoenenberger CA, Doppler W, Groner B. Prolactin regulation of β-casein gene expression and of a cytosolic 120-kd protein in a cloned mouse mammary epithelial cell line. EMBO J 1988;7:2089–95. 37. Pulaski BA, Ostrand-Rosenberg S. Mouse 4T1 breast tumor model. Curr Protoc Immunol 2001;Chapter 20:Unit 20.2. 38. Ling X, Arlinghaus RB. Knockdown of STAT3 expression by RNA interference inhibits the induction of breast tumors in immunocompetent mice. Cancer Res 2005;65:2532–6. 39. Labelle M, Begum S, Hynes RO. Direct signaling between platelets and cancer cells induces an epithelial-mesenchymal-like transition and promotes metastasis. Cancer Cell 2011;20:576–90. 40. Lee WC, Davies JA. Epithelial branching: the power of selfloathing. BioEssays 2007;29:205–7. 41. Gorska AE, Joseph H, Derynck R, Moses HL, Serra R. Dominantnegative interference of the transforming growth factor β type II receptor in mammary gland epithelium results in alveolar hyperplasia and differentiation in virgin mice. Cell Growth Differ 1998;9:229–38. 42. Jhappan C, Geiser AG, Kordon EC, Bagheri D, Hennighausen L, Roberts AB, Smith GH, Merlino G. Targeting expression of a transforming growth factor β 1 transgene to the pregnant mammary gland inhibits alveolar development and lactation. EMBO J 1993;12:1835–45. 43. Kordon EC, McKnight RA, Jhappan C, Hennighausen L, Merlino G, Smith GH. Ectopic TGFβ1 expression in the secretory mammary epithelium induces early senescence of the epithelial stem cell population. Dev Biol 1995;168:47–61.

239

44. Robinson SD, Roberts AB, Daniel CW. TGFβ suppresses casein synthesis in mouse mammary explants and may play a role in controlling milk levels during pregnancy. J Cell Biol 1993;120:245–51. 45. Wu WJ, Lee CF, Hsin CH, Du JY, Hsu TC, Lin TH, Yao TY, Huang CH, Lee YJ. TGF-β inhibits prolactin-induced expression of β-casein by a Smad3-dependent mechanism. J Cell Biochem 2008;104:1647–59. 46. Li W, Qiao W, Chen L, Xu X, Yang X, Li D, Li C, Brodie SG, Meguid MM, Hennighausen L, Deng CX. Squamous cell carcinoma and mammary abscess formation through squamous metaplasia in Smad4/Dpc4 conditional knockout mice. Development (Cambridge, England) 2003;130:6143–53. 47. Singh A, Greninger P, Rhodes D, Koopman L, Violette S, Bardeesy N, Settleman J. A gene expression signature associated with “K-Ras addiction” reveals regulators of EMT and tumor cell survival. Cancer Cell 2009;15:489–500. 48. Singh A, Settleman J. EMT, cancer stem cells and drug resistance: an emerging axis of evil in the war on cancer. Oncogene 2010;29:4741–51. 49. Tao K, Fang M, Alroy J, Sahagian GG. Imagable 4T1 model for the study of late stage breast cancer. BMC Cancer 2008;8: 228. 50. Dykxhoorn DM, Wu Y, Xie H, Yu F, Lal A, Petrocca F, Martinvalet D, Song E, Lim B, Lieberman J. miR-200 enhances mouse breast cancer cell colonization to form distant metastases. PLoS One 2009;4:e7181. 51. Berx G, Raspe E, Christofori G, Thiery JP, Sleeman JP. Pre-EMTing metastasis? Recapitulation of morphogenetic processes in cancer. Clin Exp Metastasis 2007;24:587–97. 52. Baum B, Settleman J, Quinlan MP. Transitions between epithelial and mesenchymal states in development and disease. Semin Cell Dev Biol 2008;19:294–308. 53. Wells A, Yates C, Shepard CR. E-cadherin as an indicator of mesenchymal to epithelial reverting transitions during the metastatic seeding of disseminated carcinomas. Clin Exp Metastasis 2008;25:621–8. 54. Kang Y, He W, Tulley S, Gupta GP, Serganova I, Chen CR, Manova-Todorova K, Blasberg R, Gerald WL, Massagué J. Breast cancer bone metastasis mediated by the Smad tumor suppressor pathway. Proc Natl Acad Sci USA 2005;102: 13909–14. 55. Yin JJ, Selander K, Chirgwin JM, Dallas M, Grubbs BG, Wieser R, Massagué J, Mundy GR, Guise TA. TGF-β signaling blockade inhibits PTHrP secretion by breast cancer cells and bone metastases development. J Clin Invest 1999;103:197–206. 56. Gupta GP, Nguyen DX, Chiang AC, Bos PD, Kim JY, Nadal C, Gomis RR, Manova-Todorova K, Massagué J. Mediators of vascular remodelling co-opted for sequential steps in lung metastasis. Nature 2007;446:765–70.

Copyright of Hormone Molecular Biology & Clinical Investigation is the property of De Gruyter and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.