Cancer Research

Therapeutics, Targets, and Chemical Biology

Translesion Polymerase h Is Upregulated by Cancer Therapeutics and Confers Anticancer Drug Resistance Maja T. Tomicic, Dorthe Aasland, Steffen C. Naumann, Ruth Meise, Christina Barckhausen, Bernd Kaina, and Markus Christmann

Abstract DNA repair processes are a key determinant of the sensitivity of cancer cells to DNA-damaging chemotherapeutics, which may induce certain repair genes as a mechanism to promote resistance. Here, we report the results of a screen for repair genes induced in cancer cells treated with DNA crosslinking agents, which identified the translesion polymerase h (PolH) as a p53-regulated target acting as one defense against interstrand crosslink (ICL)-inducing agents. PolH was induced by fotemustine, mafosfamide, and lomustine in breast cancer, glioma, and melanoma cells in vitro and in vivo, with similar inductions observed in normal cells such as lymphocytes and diploid fibroblasts. PolH contributions to the protection against ICL-inducing agents were evaluated by its siRNAmediated attenuation in cells, which elevated sensitivity to these drugs in all tumor cell models. Conversely, PolH overexpression protected cancer cells against these drugs. PolH attenuation reduced repair of ICL lesions as measured by host cell reactivation assays and enhanced persistence of gH2AX foci. Moreover, we observed a strong accumulation of PolH in the nucleus of drug-treated cells along with direct binding to damaged DNA. Taken together, our findings implicated PolH in ICL repair as a mechanism of cancer drug resistance and normal tissue protection. Cancer Res; 74(19); 5585–96. 2014 AACR.

Introduction Because of the high toxicity in replicating cells, genotoxic agents are being used as anticancer drugs. Most important are drugs that induce DNA interstrand crosslinks (ICL), which are potent killing lesions (1). The ICL-inducing drugs include derivatives of nitrogen mustards and chloroethyl nitrosoureas. One of the most often used nitrogen mustard is cyclophosphamide, whose active metabolite alkylates the N7 position of guanine yielding cytotoxic ICL (2). Chloroethyl nitrosoureas used in cancer therapy are carmustine (BCNU), lomustine (CCNU), nimustine (ACNU), and fotemustine (Muphoran). Upon formation of a nucleophilic chloroethylenium ion, the O6-position of guanine becomes alkylated, leading to the formation of O6-chloroethylguanine (O6-ClG; ref. 3). O6-ClG can be repaired by the DNA repair protein O6-methylguanine-DNA methyltransferase (MGMT; ref. 4). If not repaired, O6ClG undergoes intramolecular rearrangement to form N1-O6-ethenoguanine and finally N1-guanine-N3-cytosine ICLs (5, 6). O6-chloroethylating

Department of Toxicology, University Medical Center Mainz, Mainz, Germany. Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/). Corresponding Author: Markus Christmann, Department of Toxicology, University Medical Center Mainz, Obere Zahlbacher Str. 67, D-55131 Mainz, Germany. Phone: 0049-6131-179066; Fax: 0049-6131-178499; E-mail: [email protected] doi: 10.1158/0008-5472.CAN-14-0953 2014 American Association for Cancer Research.

www.aacrjournals.org

agents are being used for the treatment of glioblastoma, astrocytoma, and, albeit to a lesser extent, malignant melanoma, gastrointestinal, and pancreatic cancer, Hodgkin and non-Hodgkin lymphoma (7). Fotemustine is approved for the treatment of metastasizing melanoma and shows improved response rates and an increased survival over dacarbazine in the treatment of disseminated cutaneous melanoma (8). Also, it showed promising results in combination with ipilimumab (9), bevacizumab (10), and temozolomide (11). Tumor cells are able of counteracting the killing effects of these anticancer drugs, using various strategies including DNA repair (12, 13). Activation of DNA repair by anticancer drugs occurs on various levels, which includes the transcriptional activation of repair genes (14). An important factor involved in transcriptional regulation of DNA repair genes is p53, which becomes activated via the ATM/ATR pathway by DNA-damaging agents and ionizing radiation that cause DNA replication arrest and DNA double-strand breaks (DSB; for review, see ref. 15). As a consequence, the cellular amount of p53, its nuclear translocation, and its DNA-binding activity are enhanced and target genes become transcriptionally activated (16). Activation of p53 results in cell-cycle arrest, which occurs either in the G1 or G2–M phase (17) and upregulation of repair genes (14), thereby causing resistance to anticancer drugs. In glioblastoma cells, p53 mediates resistance against the topoisomerase I inhibitors, topotecan and irinotecan (18–21) and the chloroethylating agent ACNU (22). In case of ACNU, the protective effect was shown to be the result of p53-driven induction of the nucleotide excision repair genes xpc and ddb2 (22). Protection by p53 against chloroethylating agents was

5585

Tomicic et al.

also observed in melanoma cells, where it was shown to trigger resistance against the anticancer drug fotemustine (23). In contrast, p53 sensitizes melanoma cells to cisplatin by activation of apoptosis (24). To identify p53 target genes involved in DNA repair that contribute to protection of melanoma cells against chloroethylating agents, qRT-PCR arrays were performed, analyzing the expression of all known DNA repair genes upon fotemustine treatment of D05 melanoma cells wild-type for p53. Besides the well-characterized p53 targets ddb2 and xpc (25), a strong and robust induction of the translesion polymerase h (PolH) was observed. PolH plays an important role in tolerating replication blocking DNA lesions by translesion synthesis (TLS; ref. 26) and is also involved in the replication at fragile sites in the absence of exogenous stress (27, 28). Here, we show induction of PolH following treatment with ICL-inducing drugs, which occurs in p53 wt but not p53-mutated tumor cells. It was also observed in nontransformed cells and in a mouse xenograft model in vivo. Furthermore, we show the induction contributes to resistance against all tested ICL drugs: fotemustine, lomustine (CCNU), and the cyclophosphamide analogon mafosfamide. The protective effect results from involvement of PolH in the repair of DNA damage induced by these drugs. The data provide an example of acquired drug resistance by upregulation of a TLS polymerase. As upregulation of PolH was found in normal and cancer cells, the data have implications both for cancer cell resistance and protection of the normal tissue.

Materials and Methods Cell lines and anticancer drug treatment The cell lines used (A375, D03, D05, MCF7, TK6, U87, LN229, U138, T98G, LN18, LN308, LN319, VH10tert) were described previously (23, 25, 29, 30) and grown in RPMI or DMEM medium containing 10% FBS, in 7% CO2 at 37
C. Fresh blood was obtained from healthy donors obtained from the blood bank of the University Medical Center Mainz (Mainz, Germany). Peripheral blood lymphocytes (PBLC) were isolated using density centrifugation and Lymphoprep (PROGEN Biotechnik GmbH) as described (29). For growth stimulation, lymphocytes were incubated for 24 hours in 24-well tissue culture plates containing plastic-bound anti-CD3 (BD PharMingen) plus anti-CD28 antibodies (BD PharMingen). If not differentially stated, cells were pre-exposed to 10 mmol/L O6-benzylguanine (O6BG) and one hour later exposed to fotemustine (diethyl1-[3-(2–chloroethyl)3-nitrosoureido]ethylphosphate; Muphoran, Servier Research International), CCNU (Sigma Aldrich), or mafosfamide (ASTA Medica). The drugs remained in the medium until cell harvest. Xenograft experiments A375 cells (8  106) were injected in the left and the right flank of immunodeficient mice (NOD.CB17-Prkdcscid/J). When tumors reached a suitable size, all animals were injected with O6BG (30 mg/kg i.p., dissolved in 1/3 PEG 400 and 2/3 PBS). Two hours later, vehicle or fotemustine (70 mg/kg i.p., dissolved in 1/4 ethanol and 3/4 PBS) was administered. Forty hours later, the mice were sacrificed and tumors were isolated, immediately frozen in liquid nitrogen, and stored at 80
C. For expression analysis, the tissue was

5586

Cancer Res; 74(19) October 1, 2014

disintegrated using a tissue lyser (Retsch) and RNA or protein was isolated as stated below. Preparation of cell extracts and Western blot analysis Whole-cell extracts and nuclear cell extracts were prepared as described (31). Antibodies used were: anti-PolH (ab17725, Abcam), anti-p53 (sc100, Santa Cruz Biotechnology), antiphospho-p53Ser15 (9284, Cell Signaling Technology), antib-Actin (sc-47778, Santa Cruz Biotechnology), and anti-ERK2 (sc-154, Santa Cruz Biotechnology). Preparation of RNA, end point PCR, and qRT-PCR Total RNA was isolated using the RNA II Isolation Kit (Machery and Nagel) and cDNA synthesis was performed using the Verso cDNA Kit (Thermo Scientific). Endpoint PCR was performed using Red-Taq Ready Mix (Sigma-Aldrich) and quantitative real-time PCR (qRT-PCR) using the SensiMix SYBR Green & Fluorescein Kit (Bioline). The specific primers are depicted in Supplementary Table S1. Chromatin immunoprecipitation assay Chromatin immunoprecipitation (ChIP) was performed as described (32). PCR was performed using specific primers flanking the p53-binding site of polH [hPolH-CHIP-up: GAGCTCGAGAAATCAAGGCT, hPolH-CHIP low: AAATCTGGAACCATCACGCT; (33) and as negative control, b-actin– specific primers (hActin-up: TCCGCTGCCCTGAGGCACTC, hActin-low: GAGCCGCCGATCCACACGGA]. Overexpression and knockdown of PolH For transient transfection, 1  106 cells were seeded per 10-cm dish. One day later, cells were transfected with 2 mg of pcDNA3.1 or pcDNA3.1-polH vector, by use of Effectene reagent (Qiagen). Knockdown of PolH was performed using the siRNA from Santa Cruz Biotechnology (sc36289) and the Lipofectamine RNAiMAX Transfection Kit (Invitrogen). Determination of apoptosis For monitoring drug-induced apoptosis, ethanol-fixed cells were stained with propidium iodide as described (34). The subG1 fraction was determined by flow cytometry. Experiments were repeated at least three times, mean values  SD are shown, and data were statistically analyzed using Student t test. Immunofluorescence Cells were seeded on coverslips. Following genotoxin exposure, cells were washed with PBS and fixed with 4% paraformaldehyde. After washing with PBS/0.2% Tween, a second fixation step was performed using 100% methanol, followed by additional washing steps with PBS/0.2% Tween. The antibodies used were anti-PolH (Abcam, ab 17725), antigH2AX (#05-164, Upstate), and as secondary antibody Alexa Fluor 488 F(ab0 ) fragment of goat anti-rabbit IgG (Invitrogen, A11070). Nuclear staining was performed using TO-PRO3 iodide (Invitrogen). Slides were mounted in Vectashield medium (Vector Laboratories Inc.) and analyzed using a

Cancer Research

Involvement of Polymerase h in Anticancer Drug Resistance

confocal laser scanning microscope (LSM 710, Zeiss) or the Metafer Scanning System (Metasystems). For removing non–DNA-bound PolH, cells were washed with cold PBS and then treated with 0.1% NP40 in PBS for 40 seconds on ice. After a quick PBS washing step, the cells were fixed and treated as described above. For EdU (5-ethynyl-20 -deoxyuridine) costaining, cells were washed with PBS and then treated with 10 mmol/L EdU (Click it EdU Imaging Kit, C10338 Alexa Fluor 555, Invitrogen) for 1 hour. After a quick PBS washing step, the cells were fixed as described above. Before the nuclear staining, the "Click it" reaction was performed as proposed in the manufacturers' instructions. MTT assay The metabolic activity of fotemustine-treated cells in comparison with untreated cells was determined by MTT assay. Seventy-two hours after exposure to the given anticancer drug, the medium was removed and 50 mL MTT solution (5 mg/mL in PBS) and 100 mL noncolored DMEM medium were added. After 3 to 4 hours of incubation, the medium was aspirated. The cells were lysed and the blue redox product was dissolved by adding 100 mL 0.04 mol/L HCl in isopropanol. The absorption at 570 nm was determined; the 650 nm background absorption was subtracted. Host cell reactivation assay To induce DNA damage, the firefly luciferase expression vector pGL2-con (Promega) was ex vivo exposed to different doses of fotemustine in Tris-EDTA buffer at room temperature for 12 hours. Thereafter, the plasmid was purified by phenol/ chloroform extraction. Two-hundred nanograms of plasmids (180 ng of modified pGL2-con and 20 ng of the Renilla luciferase expression vector pRLEF-1a) were used for transfection (Effectene Transfection Kit, Qiagen). Twenty-four hours after DNA transfection, the luciferase activities were measured using Dual-Glo luciferase assay. Reactivation of the pGL2-con plasmid was measured as activity of the firefly luciferase. Activity of the Renilla luciferase expressed by the cotransfected plasmid pRLEF-1a was used as control for transfection efficiency and subtracted. BrdUrd incorporation Cells were cultured in RPMI (10% FBS) and after exposure to fotemustine, bromodeoxyuridine (BrdUrd; 10 mmol/L) was added to the medium. One-hour later, the incorporation was analyzed by the BrdU Incorporation Kit (Roche Diagnostics). Experiments were repeated at least three times, mean values  SD are shown, and data were statistically analyzed using Student t test. ICL repair measured by single-cell gel electrophoresis For the modified comet assay (35), cells were treated with 10 mg/mL fotemustine and, after the indicated time periods, trypsinized and washed with ice-cold PBS. Thereafter, cells were irradiated by 8 Gy. Alkaline cell lysis and electrophoresis was performed as described (36). The results are expressed as relative tail moment (%) ¼ fluorescence intensity tail (%)  distance head center to tail end.

www.aacrjournals.org

Results Expression of PolH upon fotemustine exposure In melanoma cells, toxicity induced by chloroethylating anticancer drugs like fotemustine depends on the p53 and MGMT status (23, 37). The melanoma cell line D05 is p53 wildtype (wt) and expresses MGMT, whereas the melanoma cell line D03 is deficient for both proteins (23). Therefore, D05 cells are highly resistant against fotemustine as compared with the melanoma cell line D03. Treatment with the p53 inhibitor pifithrin a (Ptha) or the MGMT inhibitor O6-benzylguanine (O6-BG) enhanced the cytotoxic potential of fotemustine in D05 cells (Fig. 1A). Combined treatment with the inhibitors further sensitized D05 cells to fotemustine nearly to the level observed in D03 cells (Fig. 1A). Similar results were observed using siRNA (data not shown). To further investigate the molecular mechanism underlying the protective effect of p53 on D05 cells upon treatment with fotemustine, MGMT was inhibited by O6-BG in all experiments to avoid repair of fotemustine-induced O6-ClG adducts. To identify DNA repair genes that contribute to p53-mediated protection against chloroethylating agents, qRT-PCR arrays were conducted, analyzing the expression of 180 DNA repair and DNA repair–associated genes. In this screening, we observed the induction of the PolH in the p53 wt melanoma cell line D05 after fotemustine treatment (data not shown). To verify the induction of PolH upon fotemustine, the timedependent expression of polH mRNA was examined by end point PCR (Fig. 1B) and qRT-PCR (Fig. 1C). An enhanced expression of polH mRNA was detectable 8 hours after treatment and was constantly increasing during the 24-hour postincubation period. Induction of polH mRNA was accompanied by an increase in the level of PolH protein (Fig. 1D). The increased expression of PolH was observed between 16 and 32 hours after exposure and was preceded by nuclear accumulation of p53 (Fig. 1D). To clarify whether the induction of polH mRNA and protein is the result of promoter activation, cells were treated with the transcription-blocking agent actinomycin D (ActD). Treatment with the inhibitor only slightly reduced the basal level of polH mRNA, but completely prevented the increase of polH mRNA upon fotemustine, suggesting the induction of polH mRNA to be dependent on RNA de novo synthesis (Fig. 1E). Impact of p53 and replication arrest on fotemustineinduced PolH induction Upregulation of polH was previously reported for human fibroblasts upon treatment with ionizing radiation, with p53 being involved (33). Therefore, we analyzed the fotemustinemediated induction of polH in melanoma cell lines proficient and deficient for p53 (Supplementary Fig. S1A). Induction of polH mRNA was only observed in p53-proficient melanoma cell lines (Supplementary Fig. S1B). We also observed induction of the canonical p53 targets p21, gadd45a, and fasR, substantiating the p53 wt status of the melanoma lines (Supplementary Fig. S1B). To further investigate the impact of p53 on polH induction, p53 was inhibited by Ptha, which has been shown to inhibit p53-dependent gene transcription (38). Pretreatment of D05 cells with 10 mg/mL Ptha completely abrogated the

Cancer Res; 74(19) October 1, 2014

5587

Tomicic et al.

A

120

D05

D05+O6BG

D05+Ptha

D05+O6BG+PTHa

D03

Cell viability (%)

100 80 60 40 20 0 Con

2

5

10

25

50

FM (mg/mL)

B

4

Con

8

16

D

24 Time (h)

Con

8

16

24

32

b-Actin

gapdh

Induction (x-fold)

C

p53 5 b-Actin

4 3

E

2

ActD Con

8

16

1

FM 8

16

ActD + FM 8

16

Time (h) polH

0 0

4

8 16 Time (h)

24

induction of PolH upon fotemustine exposure, both on mRNA (Fig. 2A) and on protein level (Fig. 2B), supporting the notion that PolH is transcriptionally regulated by p53. Finally, ChIP experiments showed in vivo binding of p53 protein to the p53binding site of the polH promoter in D05 cells exposed to fotemustine (Fig. 2C). An intriguing question is whether induction of PolH is triggered by fotemustine-induced ICL, by the formation of DNA repair intermediates like DSBs, or DNA replication arrest. To clarify this, the activation of p53 was analyzed via immunodetection of p53Ser15 (Fig. 2D), the induction of PolH by qRTPCR (Fig. 2E), replication blockage by BrdUrd assay (Fig. 2F) and the formation of DSBs via gH2AX foci (Fig. 2G). To inhibit replication, we used hydroxyurea (HU), a typical DNA replication blocking agent. Upon exposure of D05 cells to fotemustine or HU, activation of p53 and induction of polH mRNA was observed. At early time points, p53 activation and polH induction was more pronounced in the HU-exposed cells, reaching its maximum already 2 hours after treatment (Fig. 2D and E). Upon fotemustine, p53 activation and polH induction was observed starting 8 hours postexposure. Measurement of cell proliferation showed a strong replication arrest between 2 and 16 hours after HU exposure, whereas upon fotemustine exposure, replication decreased at late times, i.e., between 12 and 16 hours (Fig. 2F). Concomitant with the activation of p53,

5588

Time (h) PolH

polH

Cancer Res; 74(19) October 1, 2014

gapdh

Figure 1. Fotemustine-triggered induction of PolH in melanoma cells. A, sensitivity of D05 cells to fotemustine (FM) was analyzed by MTT assay upon inhibition of 6 MGMT by O -BG, inhibition of p53 by Ptha, or combined inhibition of MGMT and p53. MGMT and p53-deficient D03 cells were included for comparison. B and C, D05 cells were exposed to 10 mg/mL fotemustine for different times. B, end point PCR was performed using polH or, as loading control, gapdh-specific primers. C, qRT-PCR was performed and the expression of polH was normalized to gapdh and b-actin; the untreated control was set to one. Data are the mean of three independent experiments SD. D, D05 cells were exposed to 10 mg/mL fotemustine. Expression of PolH and p53 protein was analyzed by specific antibodies in whole-cell and nuclear extracts, respectively. b-Actin was used as loading control. E, D05 cells were exposed to 10 mg/mL fotemustine in the presence or absence of 1 mmol/L actinomycin D (ActD) and expression of polH mRNA was analyzed by end point PCR.

formation of DSBs was detected following fotemustine treatment (Fig. 2G and Supplementary Fig. S1D and S1E). Upon HU exposure, no DSBs were observed 2 to 8 hours after treatment although a strong pan-staining of gH2AX was detected (data not shown), indicating the replication arrest triggered activation of the DNA damage response (DDR) and, concomitantly, induced polH. However, following fotemustine, which only modestly induced replication arrest in the dose range used, the formation of DSBs seems to play a predominant role in activating the DDR and thereby the induction of polH. As neither p53 activation nor polH induction was observed at early time points following fotemustine, we conclude that the monoadducts formed by the agent do not activate the DDR and do not induce polH. Induction of PolH in tumor cells, melanoma xenografts, and nontransformed cells To analyze whether the induction of PolH is restricted to melanoma cells or is a common response of tumor cells to crosslinking anticancer drugs, different cell systems were analyzed concerning the inducibility of PolH. In U87 glioma cells, a time-dependent induction of polH mRNA (Fig. 3A and B) and PolH protein (Fig. 3C) was observed following treatment with CCNU (used for glioma therapy). Similar to melanoma cells, the induction of PolH was abrogated when cells were

Cancer Research

Involvement of Polymerase h in Anticancer Drug Resistance

FM - Ptha

FM + Ptha

A 4

0

8

16

24

Time (h)

0

4

8

16

24

polH gapdh

B

FM + Ptha 0

8

16

C

FM - Ptha

24

8

0

16

24

IP-DNA Genomic DNA no Ab ERK2-Ab p53-Ab Con FM Con FM Con FM Con FM

Time (h) PolH

polH promoter

b-Actin

b-Actin cds

FM

D

HU

Con 2h Con 4h Con 8h Con 12h Con 16h

Con 2h Con 4h Con 8h Con 12h Con 16h p-p53 Ser15 b-Actin

FM

F

HU

3

2

1 0

FM

120

G

HU

Cells >3 gH2AX foci (%)

4

BrdU incorporation

polH induction (x-fold)

E

100 80 60 40 20

4

8

12

16

FM

HU

25 20 15 10 5 0

0 Con 2

30

Con

2

Time (h)

4 8 Time (h)

12

16

Con 2

4

8

12 16

Time (h)

Figure 2. p53-dependent and fotemustine-triggered induction of PolH in melanoma cells. A and B, D05 cells were exposed to 10 mg/mL fotemustine (FM) in the presence or absence of 10 mmol/L Ptha. Expression of polH mRNA was analyzed by end point PCR (A) and expression of PolH protein was analyzed by Western blot analysis using nuclear protein extracts (B). C, ChIP analysis was performed in untreated D05 cells and cells exposed to 10 mg/mL fotemustine for 16 hours. One percent of cell extracts from each of the samples was taken as input. Protein-DNA complexes were immunoprecipitated with anti-p53, anti-ERK1/2, or without antibody and end point PCR was performed using primers flanking the p53-responsive element within the polH promoter or primers specific for the b-actin coding sequence. D–G, D05 cells were exposed to 10 mg/mL fotemustine or 1 mmol/L HU for indicated times. D and E, phosphorylation Ser15 of p53 was analyzed by Western blot analysis (D) and expression of polH mRNA by qRT-PCR (E). F, DNA replication was measured by BrdUrd incorporation. G, formation of gH2AX foci was analyzed by microscopy. Eight-hundred cells were scored for each time point and the percentage of cells showing >3 gH2AX foci are presented.

pretreated with Ptha (Fig. 3D). To further analyze the p53 dependency of polH induction in glioma cells, we used a panel of glioma cell lines well characterized to the p53 status (30). By using these lines, induction of polH mRNA was only observed in the p53-proficient glioma cell line LN229, but not the p53deficient (LN308) or p53-mutated (T98G, LN18, LN319, U138) cells (Fig. 3E), indicating that p53 mutations impairing p53 activity prevent polH upregulation following ICL drug treatment.

www.aacrjournals.org

Induction of polH mRNA was also observed in breast cancer cells (MCF7) and lymphoblastoid cells (TK6) upon treatment with mafosfamide (Fig. 3F). As fotemustine, CCNU, and MAF all induce ICLs, the data support the view that induction of PolH is a common response to ICL-inducing anticancer drugs. To study whether PolH becomes upregulated in cells grown in a host in vivo, A375 melanoma cells wt for p53 were injected into immunodeficient mice. Upon tumor formation, mice were either mock-treated or treated with fotemustine (70 mg/kg,

Cancer Res; 74(19) October 1, 2014

5589

Tomicic et al.

U87, CCNU

4

8

16

24

32

48

Time (h) polH gapdh

0

2

4

8

16

24

32

48

Time (h)

8 6 4 2 0 0

PolH

– Ptha 0

8

b-Actin

E

Time (h)

+ Ptha

16 24

8

0

16

24

U87, CCNU

D

2

Induction (x-fold)

C

B 0

Induction (x-fold)

U87, CCNU

A

PolH b-Actin

8

16 24 Time (h)

4

48 Con 8 24

3 2 1 0

LN229 T98G LN18 LN308 LN319 U138

4

6

MCF7, MAF

Induction (x-fold)

Induction (x-fold)

F

3 2 1 0

TK6, MAF

4 2 0

0

8

16 24 Time (h)

48

0

i.p.). Tumors were removed 40 hours thereafter and the expression of PolH was measured on mRNA and protein level. As indicated by end point PCR (Supplementary Fig. S1C) and qRT-PCR (Fig. 4A), the expression of polH mRNA was higher in all samples obtained from fotemustine-treated animals compared with samples obtained from untreated mice, which were randomly crosspaired. An enhanced expression of PolH and p53 was also observed on protein level in the melanoma xenografts following treatment of mice with fotemustine (Fig. 4B). PolH induction is not a tumor-specific trait; it was also found in nontransformed cells like human diploid fibroblasts (VH10tert; Fig. 4C) and in replicating (CD3/CD28 stimulated) PBLCs obtained from healthy donors (Fig. 4D and E) following exposure to fotemustine. Of note, polH induction was not observed in nonstimulated PBLCs, which are in G0 (>95%; Fig. 4E). The lack of induction of polH in nonproliferating PBLCs, along with lack of p53 activation (Fig. 4F), supports the view that not the primary DNA damage, but replicationassociated lesions (DSB) trigger the response. Impact of PolH on the sensitivity to chloroethylating anticancer drugs PolH was related to both, resistance and sensitivity to genotoxic stress. Thus, PolH deficiency renders human fibroblasts sensitive to UV light, but resistant to ionizing radiation

5590

Figure 3. Induction of PolH by chloroethylating drugs in tumor cells. A–C, U87 glioma cells were exposed to 20 mg/mL CCNU. Expression of polH mRNA was analyzed by end point PCR (A) and qRT-PCR (B); expression of PolH protein was analyzed by Western blot analysis (C). D, U87 cells were exposed to 20 mg/mL CCNU in the presence or absence of 10 mmol/L Ptha and expression of PolH protein was analyzed by Western blot analysis. E, a panel of glioma cell lines were exposed to 20 mg/mL CCNU for 8 or 24 hours and the expression of polH mRNA was analyzed by qRT-PCR. F, exponentially growing MCF7 breast cancer cells and TK6 lymphoblastoid cells were exposed to 5 mg/mL MAF and the expression of polH mRNA was analyzed by qRT-PCR.

Cancer Res; 74(19) October 1, 2014

8

16 24 Time (h)

48

(33). To analyze the impact of PolH on chloroethylating anticancer drug-induced toxicity, PolH was downregulated via siRNA or ectopically overexpressed. The determination of cell viability via the MTT assay showed a protective effect of PolH against several crosslink inducing anticancer drugs. In detail, PolH knockdown sensitized melanoma cells to fotemustine, glioma cells to CCNU, and breast cancer cells to MAF (Fig. 5A), drugs used in the treatment of the corresponding types of tumors. To further analyze the impact of PolH on cell death, the sub-G1 fraction was determined. Also in this assay, knockdown of PolH had a strong impact on fotemustine-induced toxicity in D05 cells and clearly enhanced cell death (Fig. 5B). The efficiency of PolH knockdown was verified in parallel experiments by Western blot analysis (Fig. 5B, left). To assess the impact of PolH induction on fotemustine resistance, p53deficient D03 melanoma cells, showing no induction of PolH upon fotemustine exposure (Supplementary Fig. S1B), were transfected with a PolH expression vector (Fig. 5C, left plot for efficiency of PolH expression) and exposed to fotemustine. Overexpression of PolH clearly protected the cells against fotemustine-induced cytotoxicity (Fig. 5C, right panel). Impact of PolH on the repair of fotemustine-induced DNA damage Next, we analyzed whether PolH is involved in the repair of fotemustine-induced DNA damage. Therefore, host

Cancer Research

Involvement of Polymerase h in Anticancer Drug Resistance

A Induction (x-fold)

4

_

+ PolH

2

p53

1

b-Actin

0 T1

T2

T3

mean 5

8

0

16

24

48

Induction (x-fold)

C Time (h) polH gapdh VH10tert, FM

4 3 2 1 0 0

0

24

48

72

96

Time (h) polH gapdh PolH ERK2

24

PBLCs

0

48

8

16 24 Time (h) 24

0

48

48

Time (h) polH gapdh polH gapdh

Nonstimulated

Stimulated

F

E

Non stimulated Stimulated

D

reactivation assays were performed, transfecting ex vivo fotemustine-exposed pGL2-con plasmids into D05 cells. After dose-finding experiments (Supplementary Fig. S1F), pGL2-con plasmids alkylated with 5 and 25 mg/mL fotemustine were transfected either in polH siRNA-transfected, nonsilencing (ns) siRNA-transfected or nontransfected cells and reactivation of the plasmid was determined 24 hours later. The data clearly show that knockdown of PolH negatively affects the ability of cells to reactivate the plasmid (Fig. 6A), indicating its involvement in the repair of chloroethylating agent-induced DNA damage. Besides performing host cell reactivation assays, we also analyzed the formation and repair of fotemustine-induced DNA damage in vivo. Therefore, the modified alkaline comet assay was used to monitor the repair of DNA crosslinks. The data show that PolH is not involved in the early step of ICL repair as its knockdown does not affect ICL formation or its resolution (Fig. 6B).

www.aacrjournals.org

T4

3

Stimulated PBLCs

Figure 4. Fotemustine-triggered induction of PolH in the melanoma xenograft model and nontransformed cells. A and B, A375 cells were injected into immunodeficient (NOD.CB17Prkdcscid/J) mice. Upon tumor formation, the mice were either mock-treated or treated with fotemustine (70 mg/kg, i.p.). Forty hours later, the expression of polH was analyzed using qRT-PCR in three paired animals (T1-T3; A) and the expression of PolH and p53 was analyzed by Western blot analysis (B) in an additional animal pair (T4). C, human fibroblasts were exposed to 10 mg/mL fotemustine and the expression of polH mRNA was analyzed by end point PCR (left) and qRT-PCR (right). D–F, PBLCs were isolated from different buffy coats obtained from healthy donors and either not stimulated or stimulated to proliferate by anti-CD3 and antiCD28 antibodies and exposed to fotemustine. D, expression of PolH was analyzed by end point PCR (top) and Western blot analysis (bottom) in stimulated PBLCs. E, expression of polH was analyzed by end point PCR in stimulated (top) and nonstimulated (bottom) PBLCs. F, expression of p53 was analyzed by Western blot analysis using nuclear extracts in stimulated (left) and nonstimulated (right) PBLCs.

B

5

72

96 Time (h) 0

24

48

72

96

p53 ERK2

ICLs represent a severe block of DNA replication, causing DSB at blocked replication forks. To analyze the impact of PolH on replication and DSB formation, replication was analyzed by BrdUrd assay and DSB formation by gH2AX foci. Knockdown of PolH clearly extended the fotemustine-induced block to replication (Fig. 6C) and, in parallel, increased the amount of gH2AX foci (Fig. 6D). Whereas the amount of gH2AX foci per cell was 3 foci per cell were included in the quantification. Also, the percentage of cells showing >3 gH2AX foci upon fotemustine exposure was higher in PolH siRNA-transfected cells (Supplementary Fig. S1G). The finding that only a subpopulation of cells showed

Cancer Res; 74(19) October 1, 2014

5591

Tomicic et al.

100

*

100

*

100

** *

80

80

60

60

* **

40

**

40

20 Con

20 5 10 25 50 100 Con CCNU (mmol/L)

MCF7-ns-si MCF7-polH-si

2

5 10 25 MAF (mg/mL)

**

35 30

PolH

D05

* 60

U87-ns-si U87-polH-si

b-Actin

SubG1 (%)

50

ns-siRNA

5 10 25 FM (mg/mL) polH-siRNA

ns-siRNA

B

2

ns-siRNA

20 Con

D05-ns-si D05-polH-si

polH-siRNA

40

*

80

*

polH-siRNA

Cell viability (%)

A

**

25 20 15 10 5 0 con ns-si polH-si Fote Con FM ns-si polH-si FM FM

PolH b-Actin

Induced subG1 (%)

vec-polH

vec-polH

vec-con

vec-con

D03

C

vec-polH

vec-con

40

vec-con

vec-polH

30

* 20

*

**

50

Figure 5. Impact of PolH on cell death triggered by chloroethylating agents. A, U87, D05, and MCF7 cells were transiently transfected with polH-specific siRNA (polH-si) or ns-si and 24 hours later, exposed to different doses of CCNU, fotemustine (FM), or MAF, respectively. Cytotoxicity was measured using MTT assay. B and C, D05 cells were transiently transfected with polH-specific siRNA (polH-si) or ns-si (B) or transiently transfected using a PolH expression vector (vec-polH) or mock-transfected (vec-con; C). Twenty-four hours later, the expression of PolH was analyzed by Western blot analysis (left) or the cells were exposed to 10 mg/mL fotemustine (B) or different doses of fotemustine (C) for 72 hours and the cytotoxicity was measured as sub-G1 fraction (right). A–C, data are the mean of three independent experiments SD.  , P < 0.05;   , P < 0.01.

10 0 5

10

25

50

FM (mg/mL)

gH2AX foci indicates that its formation is associated with replication. This is supported by EdU labeling experiments. Formation of gH2AX foci was observed predominantly in replicating cells (Supplementary Fig. S2A); 24 hours after fotemustine exposure, more than 85% of cells positive for EdU showed gH2AX foci (Supplementary Fig. S2B), indicating that DSB formation following fotemustine is restricted to S-phase cells. To further prove that PolH is involved in the replicationassociated repair of chloroethylating agent-induced DNA damage, notably ICL, the cellular localization of PolH was analyzed. Enhanced nuclear expression of PolH was observed in fotemustine-exposed cells (Supplementary Fig. S2C). In experiments, in which strong washing conditions were applied to remove non DNA-bound proteins (39), PolH was not detectable in untreated cells (Fig. 6E). In fotemustine-treated cells, however, a strong staining of PolH was observed in 20% to 30% of the cells. Parallel detection of EdU incorporation showed that binding of PolH to the DNA in fotemustine-treated cells occurs predominantly (>80%) in replicating (S-phase) cells (Fig. 6E and Supplementary Fig. S2B).

5592

Cancer Res; 74(19) October 1, 2014

Discussion In glioblastoma and melanoma cells, p53 is one of the major factors influencing toxicity of anticancer drugs. In case of the chloroethylating agents, ACNU (22) and fotemustine (25), this protective effect was related to the induction of the nucleotide excision repair genes xpc and ddb2, which are robustly regulated by p53. To identify additional factors involved in p53-mediated resistance to ICL-inducing agents, we analyzed the p53-mediated regulation of all known DNA repair genes and identified the PolH as an important p53-regulated factor involved in the cellular protection against fotemustine and other ICLinducing anticancer drugs. Induction of PolH by fotemustine was found in melanoma cell lines, normal fibroblasts, and proliferating PBLCs on the level of mRNA and protein. Furthermore, induction of PolH was observed in glioma cells upon exposure to CCNU used in glioma therapy and in breast cancer cells upon exposure to MAF, a derivative of the crosslink inducing anticancer drug cyclophosphamide used in breast cancer therapy. PolH induction was mediated by p53 as substantiated by ChIP

Cancer Research

Involvement of Polymerase h in Anticancer Drug Resistance

80 60

**

40 20

*

100

0

60 40 20

25

Con

D

ns-si polH-si

80

**

60

*

40 20 0

24 Time (h)

48

50 ns-si polH-si

40

*

30 20

** 10 0

0

24 48 Time (h)

72

24

48 Time (h)

72

EdU

PolH TO-PRO3

FM

Overlay

Control

PolH

E

polH-si

EdU

BrdU incorporation (%)

100

5 FM (mg/mL)

gH2AX foci /cell

C

ns-si

80

0 0

experiments and experiments using the p53 inhibitor Ptha. This notion is in line with a previous report showing p53dependent induction of PolH by IR and camptothecin (33). The observation of PolH induction in tumor cell lines grown in vitro and as xenografts, and in PBLCs upon exposure to various crosslink-inducing agents clearly hints to an important and widely spread biologic function of PolH upregulation. PolH seems to play different roles in cellular toxicity according to the type of DNA damage. Thus, knockdown of PolH on the one hand enhanced the sensitivity to UV light and, on the other, enhanced cellular resistance to IR (33). To analyze the impact of PolH on anticancer drug–induced cytotoxicity, PolH was downregulated using siRNA. Downregulation of PolH clearly sensitized melanoma cells to fotemustine, glioma cells to CCNU, and MCF7 cells to MAF, indicating that PolH is a general player involved in the protection of cancer cells against crosslink-inducing agents. Furthermore, ectopic expression of PolH in D03 melanoma cells rendered them more resistant to

www.aacrjournals.org

B

nt ns-si polH-si

Overlay

Luciferase activity

100

Relative tail moment (%)

A

TO-PRO3

Figure 6. Impact of PolH on the repair of fotemustine-triggered DNA damage. A–D, D05 cells were either nontransfected (nt) or transfected with ns-siRNA or polH-specific siRNA. A, host cell reactivation assay. Cells were transfected 24 hours later with the plasmid pGL2-con, which was ex vivo exposed to 5 or 25 mg/mL fotemustine (FM) and with the plasmid pRLEF-1a. Sixteen hours later, the cells were harvested, protein extracts isolated, and subjected to the dual luciferase assay. B, ICL repair was measured by modified comet assay at 24 and 48 hours after fotemustine (10 mg/mL) treatment. C, DNA replication was measured by BrdUrd incorporation assay 24, 48, and 72 hours after fotemustine (10 mg/mL) treatment. D, formation of gH2AX foci was analyzed by confocal laser scanning microscopy at 24, 48, and 72 hours after fotemustine (10 mg/mL) treatment. Fifty cells (showing >3 foci) were scored for each time point. A–D, data are the mean of three independent experiments SD.  , P < 0.05;  , P < 0.01. E, binding of PolH to fotemustinedamaged DNA was determined using immunofluorescence and confocal laser scanning microscopy 16 hours after exposure to 10 mg/mL fotemustine. Nuclear staining was performed using TO-PRO3 and detection of replicating cells was analyzed by EdU incorporation.

fotemustine, supporting the notion that PolH induction contributes to ICL drug resistance. Our data suggest that PolH represents a potential marker of cancer cell resistance. How is PolH expressed in tumors? As data are scarce, we initially analyzed the expression of PolH in malignant glioma cell lines (Supplementary Fig. S3A) and in human breast cancer and corresponding normal tissue (Supplementary Fig. S3B and S3C). The results showed clear variations in the PolH expression, which was overall slightly higher in cancer than in the normal tissue, indicating that PolH might be upregulated during tumor development. However, more studies concerning the expression of PolH in tumors are needed to clarify this point. We also analyzed whether PolH is directly involved in the repair of chloroethylating agent–derived DNA adducts. Fotemustine chloroethylates the O6-position of guanine, forming O6-ClG, which thereafter undergoes intramolecular rearrangement to form an ICL (5). Whereas O6-ClG is repaired by MGMT

Cancer Res; 74(19) October 1, 2014

5593

Tomicic et al.

(40) the repair of ICL is complex, involving multiple repair mechanisms (1). Also to consider, ICL repair differs between replicating and nonreplicating cells. In nonreplicating cells, the repair depends on nucleotide excision repair (NER)-mediated recognition of the crosslink and dual NER-mediated incision at positions flanking the crosslinked DNA. After flipping the excised DNA fragment out of the helix, resynthesis of DNA occurs and a second cycle of NER finally removes the flippedout crosslink (1). Whether resynthesis of DNA is accomplished by replicative or translesion polymerases is unclear. In replicating cells, when the crosslink encounters the replication fork, NER, TLS, and HR are implicated in the repair (1). To analyze the role of PolH in the repair of fotemustineinduced DNA adducts, host reactivation assays were performed. Upon knockdown of PolH, a clear decrease in plasmid reactivation was observed, indicating that PolH is involved in the repair of fotemustine-induced DNA damage. An intriguing question is whether PolH is involved in the repair of the monoadducts or ICL. In vitro, conversion of a monoadduct to a crosslink occurs within a period of 3 hours (5). In cells upon exposure to chloroethylating drugs, the formation of ICL was finished within 8 hours (41). As ex vivo modification of the plasmid was performed in our experiments for 12 hours, O6-ClG adducts should not be present anymore, supporting the notion that PolH is involved in the repair of ICL. This is in line with data showing repair of mitomycin C-induced ICL using in vivo reactivation assays. In these experiments, using xeroderma pigmentosum patient–derived XPV cells, partial requirement for PolH was observed (42). Moreover, XPV cells are hypersensitive to cisplatin (43, 44), and PolH was associated with processing of psoralen-induced crosslinks (45). We also performed modified alkaline comet assays to measure the repair of ICL in vivo. No difference was observed in the formation and initial cleavage of ICL, indicating that PolH is not involved in the first steps of ICL repair, namely recognition and incision. However, a prolonged replication block and an enhanced persistence of gH2AX foci were observed, indicating that the efficient execution of later steps of ICL repair is reduced in PolH-compromised cells. Besides its role in TLS, PolH displays an important function in mitotic gene conversion and homologous recombination (46). Furthermore, PolH possesses a dual role at stalled replication forks, promoting TLS and reinitiating DNA synthesis during HR by primer extension of D-loop structures (47). More recently it was shown that PolH provides a supportive role for PolD during normal replication (48). Therefore, the question arises whether the function of PolH in ICL repair following anticancer drugs is associated with replication events. To address this, we analyzed whether PolH can directly interact with fotemustinedamaged DNA in vivo and whether this reaction is associated with replication. Upon removal of non-DNA–bound PolH, the remaining DNA-bound PolH was only detected in fotemustinetreated, but not in unexposed cells. Parallel detection of EdU incorporation showed that binding of PolH to the DNA of fotemustine-exposed cells occurs predominantly in replicating cells (>80% of PolH-positive cells were at the same time positive for EdU incorporation), indicating a role for PolH in

5594

Cancer Res; 74(19) October 1, 2014

replication-associated repair of ICL. This finding is in contrast to data showing that DNA damage–induced PolH recruitment takes place independently of the cell-cycle phase (49). This, however, was observed after treatment with UV light, which induces intrastrand crosslinks that are repaired independently of replication, whereas ICL are more severe lesions that are repaired predominantly within the S-phase, which is supported by a large fraction of the cells showing gH2AX foci in the Sphase upon fotemustine treatment. Upregulation of PolH following anticancer drug treatment was not only observed in malignant cells, but also in fibroblasts and PBLCs isolated from healthy individuals. As PolH plays a protective role, the data suggest that PolH may also protect the normal tissue from the therapeutic side effects of ICL-inducing anticancer drugs. We should also note another interesting side effect. As PolH, a low fidelity TLS polymerase, is able to insert wrong nucleotides opposite to the lesion in the DNA (26), its activity is error-prone, leading to the formation of mutations. These might be a source of therapy-induced secondary tumors, which is indeed a serious deleterious side effect of ICL-inducing drugs such as nitrogen mustards and nitrosoureas (50). In summary, we show for the first time upregulation of PolH upon exposure of cells to crosslink-inducing anticancer drugs. The process is dependent on p53 and was observed in melanoma, glioma, and breast cancer cell lines. It was also observed in a mouse melanoma xenograft model in the absence of systemic toxicity, indicating that it occurs in a relevant dose range. Furthermore, we show that the elevated expression of PolH enhances the resistance of cancer cells to crosslinking anticancer drugs, including chloroethylating agents and cyclophosphamide derivatives, resulting from a participation of PolH in the repair of DNA crosslinks. Disclosure of Potential Conflicts of Interest No potential conflicts of interest were disclosed.

Authors' Contributions Conception and design: M.T. Tomicic, B. Kaina, M. Christmann Development of methodology: D. Aasland Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): R. Meise, C. Barckhausen, M. Christmann Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): M.T. Tomicic, R. Meise, B. Kaina, M. Christmann Writing, review, and/or revision of the manuscript: M.T. Tomicic, B. Kaina, M. Christmann Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): S.C. Naumann, B. Kaina Study supervision: M. Christmann

Acknowledgments The authors thank Birgit Rasenberger for excellent technical assistance.

Grant Support The work was supported by a grant from the Deutsche Forschungsgemeinschaft (DFG CH 665/2-2). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Received April 4, 2014; revised June 7, 2014; accepted June 30, 2014; published OnlineFirst August 14, 2014.

Cancer Research

Involvement of Polymerase h in Anticancer Drug Resistance

References 1.

2. 3.

4. 5.

6.

7.

8.

9.

10.

11.

12. 13. 14.

15. 16. 17.

18.

19.

20.

21.

22.

Muniandy PA, Liu J, Majumdar A, Liu ST, Seidman MM. DNA interstrand crosslink repair in mammalian cells: step by step. Crit Rev Biochem Mol Biol 2010;45:23–49. Emadi A, Jones RJ, Brodsky RA. Cyclophosphamide and cancer: golden anniversary. Nat Rev Clin Oncol 2009;6:638–47. Ludlum DB. The chloroethylnitrosoureas: sensitivity and resistance to cancer chemotherapy at the molecular level. Cancer Invest 1997;15: 588–98. Pegg AE. Repair of O(6)-alkylguanine by alkyltransferases. Mutat Res 2000;462:83–100. Tong WP, Kirk MC, Ludlum DB. Formation of the cross-link 1-[N3deoxycytidyl),2-[N1-deoxyguanosinyl]ethane in DNA treated with N, N0 -bis(2-chloroethyl)-N-nitrosourea. Cancer Res 1982;42:3102–5. Fischhaber PL, Gall AS, Duncan JA, Hopkins PB. Direct demonstration in synthetic oligonucleotides that N,N0 -bis(2-chloroethyl)-nitrosourea cross links N1 of deoxyguanosine to N3 of deoxycytidine on opposite strands of duplex DNA. Cancer Res 1999;59:4363–8. Brulikova L, Hlavac J, Hradil P. DNA interstrand cross-linking agents and their chemotherapeutic potential. Curr Med Chem 2012;19: 364–85. Avril MF, Aamdal S, Grob JJ, Hauschild A, Mohr P, Bonerandi JJ, et al. Fotemustine compared with dacarbazine in patients with disseminated malignant melanoma: a phase III study. J Clin Oncol 2004;22: 1118–25. Di Giacomo AM, Ascierto PA, Pilla L, Santinami M, Ferrucci PF, Giannarelli D, et al. Ipilimumab and fotemustine in patients with advanced melanoma (NIBIT-M1): an open-label, single-arm phase 2 trial. Lancet Oncol 2012;13:879–86. Del Vecchio M, Mortarini R, Canova S, Di Guardo L, Pimpinelli N, Sertoli MR, et al. Bevacizumab plus fotemustine as first-line treatment in metastatic melanoma patients: clinical activity and modulation of angiogenesis and lymphangiogenesis factors. Clin Cancer Res 2010;16:5862–72. Guida M, Cramarossa A, Fistola E, Porcelli M, Giudice G, Lubello K, et al. High activity of sequential low dose chemo-modulating Temozolomide in combination with Fotemustine in metastatic melanoma. A feasibility study. J Transl Med 2010;8:115. Hoeijmakers JH. DNA damage, aging, and cancer. N Engl J Med 2009;361:1475–85. Christmann M, Tomicic MT, Roos WP, Kaina B. Mechanisms of human DNA repair: an update. Toxicology 2003;193:3–34. Christmann M, Kaina B. Transcriptional regulation of human DNA repair genes following genotoxic stress: trigger mechanisms, inducible responses and genotoxic adaptation. Nucleic Acids Res 2013;41: 8403–20. Harper JW, Elledge SJ. The DNA damage response: ten years after. Mol Cell 2007;28:739–45. Lakin ND, Jackson SP. Regulation of p53 in response to DNA damage. Oncogene 1999;18:7644–55. Kastan MB, Onyekwere O, Sidransky D, Vogelstein B, Craig RW. Participation of p53 protein in the cellular response to DNA damage. Cancer Res 1991;51:6304–11. Tomicic MT, Christmann M, Kaina B. Topotecan-triggered degradation of topoisomerase I is p53-dependent and impacts cell survival. Cancer Res 2005;65:8920–6. Tomicic MT, Christmann M, Kaina B. Topotecan triggers apoptosis in p53-deficient cells by forcing degradation of XIAP and survivin thereby activating caspase-3-mediated Bid cleavage. J Pharmacol Exp Ther 2010;332:316–25. Tomicic MT, Kaina B. Topoisomerase degradation, DSB repair, p53 and IAPs in cancer cell resistance to camptothecin-like topoisomerase I inhibitors. Biochim Biophys Acta 2013;1835:11–27. Wang Y, Zhu S, Cloughesy TF, Liau LM, Mischel PS. p53 disruption profoundly alters the response of human glioblastoma cells to DNA topoisomerase I inhibition. Oncogene 2004;23:1283–90. Batista LF, Roos WP, Christmann M, Menck CF, Kaina B. Differential sensitivity of malignant glioma cells to methylating and chloroethylating anticancer drugs: p53 determines the switch by regulating xpc, ddb2, and DNA double-strand breaks. Cancer Res 2007;67:11886–95.

www.aacrjournals.org

23. Naumann SC, Roos WP, Jost E, Belohlavek C, Lennerz V, Schmidt CW, et al. Temozolomide- and fotemustine-induced apoptosis in human malignant melanoma cells: response related to MGMT, MMR, DSBs, and p53. Br J Cancer 2009;100:322–33. 24. Li G, Tang L, Zhou X, Tron V, Ho V. Chemotherapy-induced apoptosis in melanoma cells is p53 dependent. Melanoma Res 1998;8: 17–23. 25. Barckhausen C, Roos WP, Naumann SC, Kaina B. Malignant melanoma cells acquire resistance to DNA interstrand cross-linking chemotherapeutics by p53-triggered upregulation of DDB2/XPC-mediated DNA repair. Oncogene 2014;33:1964–74. 26. Hoffmann JS, Cazaux C. Aberrant expression of alternative DNA polymerases: a source of mutator phenotype as well as replicative stress in cancer. Semin Cancer Biol 2010;20:312–9. 27. Rey L, Sidorova JM, Puget N, Boudsocq F, Biard DS, Monnat RJ Jr, et al. Human DNA polymerase eta is required for common fragile site stability during unperturbed DNA replication. Mol Cell Biol 2009;29: 3344–54. 28. Bergoglio V, Boyer AS, Walsh E, Naim V, Legube G, Lee MY, et al. DNA synthesis by Pol eta promotes fragile site stability by preventing underreplicated DNA in mitosis. J Cell Biol 2013;201:395–408. 29. Roos W, Baumgartner M, Kaina B. Apoptosis triggered by DNA damage O6-methylguanine in human lymphocytes requires DNA replication and is mediated by p53 and Fas/CD95/Apo-1. Oncogene 2004;23:359–67. 30. Wischhusen J, Naumann U, Ohgaki H, Rastinejad F, Weller M. CP31398, a novel p53-stabilizing agent, induces p53-dependent and p53-independent glioma cell death. Oncogene 2003;22:8233–45. 31. Christmann M, Kaina B. Nuclear translocation of mismatch repair proteins MSH2 and MSH6 as a response of cells to alkylating agents. J Biol Chem 2000;275:36256–62. 32. Christmann M, Tomicic MT, Aasland D, Berdelle N, Kaina B. Three prime exonuclease I (TREX1) is Fos/AP-1 regulated by genotoxic stress and protects against ultraviolet light and benzo(a)pyreneinduced DNA damage. Nucleic Acids Res 2010;38:6418–32. 33. Liu G, Chen X. DNA polymerase eta, the product of the xeroderma pigmentosum variant gene and a target of p53, modulates the DNA damage checkpoint and p53 activation. Mol Cell Biol 2006;26: 1398–413. 34. Tomicic MT, Friedrichs C, Christmann M, Wutzler P, Thust R, Kaina B. Apoptosis induced by (E)-5-(2-bromovinyl)-20 -deoxyuridine in varicella zoster virus thymidine kinase-expressing cells is driven by activation of c-Jun/activator protein-1 and Fas ligand/caspase-8. Mol Pharmacol 2003;63:439–49. 35. Spanswick VJ, Hartley JM, Ward TH, Hartley JA. Measurement of drug-induced DNA interstrand crosslinking using the single-cell gel electrophoresis (comet) assay. Methods Mol Med 1999;28:143–54. 36. Tomicic MT, Thust R, Sobol RW, Kaina B. DNA polymerase beta mediates protection of mammalian cells against ganciclovirinduced cytotoxicity and DNA breakage. Cancer Res 2001;61: 7399–403. 37. Christmann M, Pick M, Lage H, Schadendorf D, Kaina B. Acquired resistance of melanoma cells to the antineoplastic agent fotemustine is caused by reactivation of the DNA repair gene MGMT. Int J Cancer 2001;92:123–9. 38. Komarov PG, Komarova EA, Kondratov RV, Christov-Tselkov K, Coon JS, Chernov MV, et al. A chemical inhibitor of p53 that protects mice from the side effects of cancer therapy. Science 1999;285:1733–7. 39. Andersen PL, Xu F, Ziola B, McGregor WG, Xiao W. Sequential assembly of translesion DNA polymerases at UV-induced DNA damage sites. Mol Biol Cell 2011;22:2373–83. 40. Kaina B, Christmann M, Naumann S, Roos WP. MGMT: key node in the battle against genotoxicity, carcinogenicity and apoptosis induced by alkylating agents. DNA Repair 2007;6:1079–99. 41. Brent TP, Lestrud SO, Smith DG, Remack JS. Formation of DNA interstrand cross-links by the novel chloroethylating agent 2-chloroethyl(methylsulfonyl)methanesulfonate: suppression by O6-alkylguanine-DNA alkyltransferase purified from human leukemic lymphoblasts. Cancer Res 1987;47:3384–7.

Cancer Res; 74(19) October 1, 2014

5595

Tomicic et al.

42. Zheng H, Wang X, Warren AJ, Legerski RJ, Nairn RS, Hamilton JW, et al. Nucleotide excision repair- and polymerase eta-mediated errorprone removal of mitomycin C interstrand cross-links. Mol Cell Biol 2003;23:754–61. 43. Albertella MR, Green CM, Lehmann AR, O'Connor MJ. A role for polymerase eta in the cellular tolerance to cisplatin-induced damage. Cancer Res 2005;65:9799–806. 44. Chen YW, Cleaver JE, Hanaoka F, Chang CF, Chou KM. A novel role of DNA polymerase eta in modulating cellular sensitivity to chemotherapeutic agents. Mol Cancer Res 2006;4:257–65. 45. Mogi S, Butcher CE, Oh DH. DNA polymerase eta reduces the gammaH2AX response to psoralen interstrand crosslinks in human cells. Exp Cell Res 2008;314:887–95. 46. Kawamoto T, Araki K, Sonoda E, Yamashita YM, Harada K, Kikuchi K, et al. Dual roles for DNA polymerase eta in homologous DNA

5596

Cancer Res; 74(19) October 1, 2014

47.

48.

49.

50.

recombination and translesion DNA synthesis. Mol Cell 2005;20: 793–9. McIlwraith MJ, Vaisman A, Liu Y, Fanning E, Woodgate R, West SC. Human DNA polymerase eta promotes DNA synthesis from strand invasion intermediates of homologous recombination. Mol Cell 2005;20:783–92. Sneeden JL, Grossi SM, Tappin I, Hurwitz J, Heyer WD. Reconstitution of recombination-associated DNA synthesis with human proteins. Nucleic Acids Res 2013;41:4913–25. Soria G, Belluscio L, van Cappellen WA, Kanaar R, Essers J, Gottifredi V. DNA damage induced Pol eta recruitment takes place independently of the cell cycle phase. Cell Cycle 2009;8:3340–8. Tucker MA, Meadows AT, Boice JD Jr., Stovall M, Oberlin O, Stone BJ, et al. Leukemia after therapy with alkylating agents for childhood cancer. J Natl Cancer Inst 1987;78:459–64.

Cancer Research