Accepted Article
Article Type: Original Article
Title page
Transplantation of human umbilical mesenchymal stem cells attenuates dextran sulfate sodium-induced colitis in mice
Yan Lin1, Lianjie Lin1, Qiushi Wang2, Yu Jin1, Ying Zhang1, Yong Cao1, Changqing Zheng1, *
1
Department of Gastroenterology, Shengjing Hospital of China Medical University,
Shenyang 110004, People’s Republic of China 2
Department of Blood Transfusion, Shengjing Hospital of China Medical University,
Shenyang 110004, People’s Republic of China
*
Corresponding author: Dr. Changqing Zheng, Department of Gastroenterology,
Shengjing Hospital of China Medical University, 36 Sanhao Street, Shenyang 110004, People’s Republic of China
This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1111/1440-1681.12321 This article is protected by copyright. All rights reserved.
Accepted Article
Tel: +86-24-96615-26211
E-mail: [email protected]
ABSTRACT
Ulcerative colitis (UC) is a major form of inflammatory bowel disease (IBD) and increases the risk of the development of colorectal carcinoma. The anti-inflammatory and immunomodulatory properties of mesenchymal stem cells (MSCs) make them promising tools for treating immune-mediated and inflammatory diseases. However, the lack of robust technique for harvesting and expanding of MSCs has hampered the use of bone marrow and umbilical cord blood derived MSCs in clinical applications. In the present study, we investigated the intestinal protective effects of Wharton’s jelly derived umbilical MSCs (UMSCs) on dextran sulfate sodium (DSS) induced colitis in mice. The severity of colitis in mice was assessed using body weight loss, stool consistency, rectal bleeding, colon shortening, and hematological parameters. Colonic myeloperoxidase (MPO) and proinflammatory cytokines levels were also measured. Furthermore, the expression of cyclooxygenase 2 (COX2) and inducible nitric oxide synthase (iNOS) in the colon were detected. In addition, intestinal permeability and tight junction proteins expressions in the colon were examined as well. The results showed that Wharton’s jelly derived UMSCs significantly diminished the severity of colitis, reduced histolopathological score, and decreased MPO activity and cytokines levels. Furthermore, the UMSCs markedly decreased the This article is protected by copyright. All rights reserved.
Accepted Article
Mesenchymal stem cells (MSCs) were first reported as a population of nonhematopoietic, plastic-adherent, fibroblast-like cells isolated from bone marrow (BM) by Friedenstein et al.(4). These cells are capable of differentiation into adipocytes, chondrocytes, osteocytes, smooth muscle cells, fibroblasts and hematopoietic supportive stroma (5, 6) and be self-renewing (7). Human umbilical MSCs (UMSC) are isolated from human umbilical cord (HUC). Compared with BM, HUC represents more suitable source for MSC collection for the painless, simple and safe isolation procedure and the relatively high frequency. Furthermore, MSCs derived from Wharton’s jelly exhibit a shorter doubling time and a broader pluripotency as compared to BM-MSCs (8). In addition, UMSCs possess anti-inflammatory and immunomodulatory properties, which render them as appealing candidates for cell based therapies (9). Studies suggest that inflammatory response and immunological changes are responsible for both the development and healing of UC (10-12). Numerous studies have shown that BM-MSCs contribute to the healing of experimental colitis in rats (13-15). HUC blood derived MSCs was also proved reduce colitis in mice (16). However, the frequency of UC blood is much lower than BM (17, 18).
Tight junction (TJ) proteins play an essential role in cellular proliferation, adhesion and glandular differentiation. The function of these proteins is compromised in intestinal diseases including UC. TJ composed by transmembrane proteins, such as
This article is protected by copyright. All rights reserved.
Accepted Article
RESULTS
Culture and identification of UMSCs
Two weeks after the UMSCs were isolated, all non-adherent cells were removed by medium change, and the adherent cells which formed typical fibroblastic morphology were UMSCs. Cells showed the typical phenotype of mesenchymal cells under phase contrast microscopy (Figure 1A and B). The immunophenotype analysis of UMSCs was performed by flow cytometry after 3 passages to further confirm the purity of UMSCs. Fibroblast-like cells showed strong expression of CD44 and CD105, with weak expression of the hematopoietic lineage marker CD34 (Figure 1) according to the previous studies (27, 28). Thus, we concluded that the adherent cells derived from umbilical cord were MSCs.
Cell track in vivo
When the experiments were finished, the colon was harvested for cell track analysis. Under a confocal laser scanning microscope, live cells should appear blue for being stained by DAPI and CM-Dil positive cells should appear red. The cells that were double stained blue and red could thus be identified as the implanted UMSCs. As shown in Figure 2, none of the CM-Dil labeled cells were present in the control or DSS group, while CM-Dil positive cells which appeared red were observed in UMSC group. The result indicated the success of the implantation.
This article is protected by copyright. All rights reserved.
Accepted Article
Effects of USMCs implantation on DSS induced colitis
Disease activity index (DAI) score
Mice fed with DSS developed signs of colitis as evidenced by a DAI score higher than 2 at day 7 (Figure 3A). USMCs implantation resulted in a significantly lower DAI score at day 7 (1.57 ± 0.45 in USMCs group vs. 2.63 ± 0.55 in DSS group, P < 0.01, n = 10).
Colon length
The colon in DSS-fed mice showed markedly shorter (6.08 ± 1.55 cm) than normal control mice (10.02 ± 1.61 cm, P < 0.05, n = 5, Figure 3B). The colon in the UMSCs implanted DSS group was significantly longer (9.56 ± 2.36 cm) than in DSS-fed mice (P < 0.05, n = 5).
Histological Score
HE staining of the colon of DSS-fed mice showed greater infiltration of inflammatory cells, marked necrosis of colonic mucosa, hyperemia and adhesions (Figure 4B). In UMSCs-treated mice, mucosal destruction and edema in the submucosa were reduced when compared with DSS-fed mice (Figure 4C). Accordingly, the histological score
This article is protected by copyright. All rights reserved.
Accepted Article
RESULTS
Culture and identification of UMSCs
Two weeks after the UMSCs were isolated, all non-adherent cells were removed by medium change, and the adherent cells which formed typical fibroblastic morphology were UMSCs. Cells showed the typical phenotype of mesenchymal cells under phase contrast microscopy (Figure 1A and B). The immunophenotype analysis of UMSCs was performed by flow cytometry after 3 passages to further confirm the purity of UMSCs. Fibroblast-like cells showed strong expression of CD44 and CD105, with weak expression of the hematopoietic lineage marker CD34 (Figure 1) according to the previous studies (27, 28). Thus, we concluded that the adherent cells derived from umbilical cord were MSCs.
Cell track in vivo
When the experiments were finished, the colon was harvested for cell track analysis. Under a confocal laser scanning microscope, live cells should appear blue for being stained by DAPI and CM-Dil positive cells should appear red. The cells that were double stained blue and red could thus be identified as the implanted UMSCs. As shown in Figure 2, none of the CM-Dil labeled cells were present in the control or DSS group, while CM-Dil positive cells which appeared red were observed in UMSC group. The result indicated the success of the implantation.
This article is protected by copyright. All rights reserved.
Accepted Article
Effects of USMCs implantation on DSS induced colitis
Disease activity index (DAI) score
Mice fed with DSS developed signs of colitis as evidenced by a DAI score higher than 2 at day 7 (Figure 3A). USMCs implantation resulted in a significantly lower DAI score at day 7 (1.57 ± 0.45 in USMCs group vs. 2.63 ± 0.55 in DSS group, P < 0.01, n = 10).
Colon length
The colon in DSS-fed mice showed markedly shorter (6.08 ± 1.55 cm) than normal control mice (10.02 ± 1.61 cm, P < 0.05, n = 5, Figure 3B). The colon in the UMSCs implanted DSS group was significantly longer (9.56 ± 2.36 cm) than in DSS-fed mice (P < 0.05, n = 5).
Histological Score
HE staining of the colon of DSS-fed mice showed greater infiltration of inflammatory cells, marked necrosis of colonic mucosa, hyperemia and adhesions (Figure 4B). In UMSCs-treated mice, mucosal destruction and edema in the submucosa were reduced when compared with DSS-fed mice (Figure 4C). Accordingly, the histological score
This article is protected by copyright. All rights reserved.
Accepted Article
For immunofluorescence assay, sections were inculated in claudin-1, occludin (Abcam) or ZO-1 antibodies (1: 200, Boster, Wuhan, China) at 4°C overnight, respectively. After washed by 1 × PBS, sections were incubated in FITC labeled goat anti-rabbit secondary antibody (1: 200, Beyotime) at 37 °C for 1 hour in dark. After washing, sections were counterstained with DAPI and mounted in aqueous mounting medium. Fluorescent labeling was examined using a confocal system (Olympus).
MPO assay and cytokine measurement
Neutrophil infiltration in the colon was determined by measuring MPO activity. Colon segments were homogenized at 10% in 0.9% saline solution. MPO activity was assayed using a Myeloperoxidase Assay Kit (Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s instructions.
Protein lysates were extracted from colonic tissues in NP-40 lysis buffer (Beyotime) containing 1% Triton X-100 with 1 mM PMSF. Protein extracts were centrifuged at 12,000g for 10 min and stored at -80 °C. TNF-α, IL-6, IFN-γ and IL-1β concentrations were measured using a commercial enzyme-linked immunosorbent assay kit (Boster) according to the manufacturer's protocol.
This article is protected by copyright. All rights reserved.
Accepted Article
implantation significantly down-regulated the mRNA and protein expression of these proteins associated with inflammation. The expression and subcellular localization of cyclooxygenase 2 (COX2) and inducible nitric oxide synthase (iNOS) were also evaluated by immunohistochemistry (IHC). As shown in Figure 6C, the IHC images demonstrated that DSS resulted in high-levels of COX2 and iNOS and UMSCs implantation reversed this effect partly. These results suggest UMSCs implantation may alleviate DSS induced colitis by inhibiting inflammatory response.
UMSCs implantation improved intestinal permeability in DSS induced colitis
As compared with control group, the Evans Blue (EB) content of the colon in DSS-fed mice was significantly higher (Figure 7A, P < 0.01). UMSCs implantation significantly reduced the EB content (P < 0.01), suggesting that UMSCs treatment may decrease the intestinal permeability of rats with DSS-induced colitis.
UMSCs implantation down-regulated tight junction protein expression in DSS induced colitis
To further investigate the effect of UMSCs implantation on intestinal permeability in DSS induced colitis, we detected the expression of TJ proteins which regulate paracellular permeability (24, 29). As shown in Figure 7, occludin, claudin-1 and ZO-1 mRNA levels were markedly down-regulated by DSS treatment (Figure 7B). In This article is protected by copyright. All rights reserved.
Accepted Article
accordance, protein levels were decreased as well (Figure 7C). USMCs implantation significantly increased the expression of three TJ proteins. In addition, the protein levels were also confirmed by immunofluorescence. As shown in Figure 8, the immunofluorescent images demonstrated that USMCs implantation counteracted the inhibitory effects of DSS on tight junction proteins. The results indicated that USMCs implantation might improve intestinal permeability by regulating tight junction proteins.
DISCUSSION
DSS induced UC model was originally reported by Okayasu et al. (30). This model exhibits features including mucosal damage, increased production of cytokines and other inflammatory mediators and leukocyte infiltration. In our study, mice treated with DSS for 7 days were characterized by decreased body weight, diarrhoea and rectal bleeding, and increased in DAI compared with the normal control group. Colon length was significantly shorter in the DSS group as well, and signs of inflammation were visible in the colon. These observations indicate the success of the model establishment. MSCs were demonstrated to improve the survival rate and reduce disease activity of experimental colitis in mice (31, 32). In the present study, we have isolated MSCs from the Wharton’s jelly of HUC, termed as UMSCs, which exhibit several unique stem cell-like properties as MSCs derived from other tissues. The results showed the This article is protected by copyright. All rights reserved.
Accepted Article
25. Liang L, Dong C, Chen X, et al. Human umbilical cord mesenchymal stem cells ameliorate mice trinitrobenzene sulfonic acid (TNBS)-induced colitis. Cell transplantation 2011; 20:1395-408. 26. Oh SY, Cho KA, Kang JL, Kim KH, Woo SY. Comparison of experimental mouse models of inflammatory bowel disease. International journal of molecular medicine 2014; 33:333-40.
27. Chen M, Xiang Z, Cai J. The anti-apoptotic and neuro-protective effects of human umbilical cord blood mesenchymal stem cells (hUCB-MSCs) on acute optic nerve injury is transient. Brain research 2013; 1532:63-75.
28. Ma S, Liang S, Jiao H, et al. Human umbilical cord mesenchymal stem cells inhibit C6 glioma growth via secretion of dickkopf-1 (DKK1). Molecular and cellular biochemistry 2014; 385:277-86. 29. Anderson JM, Van Itallie CM. Tight junctions and the molecular basis for regulation of paracellular permeability. The American journal of physiology 1995; 269:G467-75.
30. Okayasu I, Hatakeyama S, Yamada M, Ohkusa T, Inagaki Y, Nakaya R. A novel method in the induction of reliable experimental acute and chronic ulcerative colitis in mice. Gastroenterology 1990; 98:694-702. 31. Zhang Q, Shi S, Liu Y, et al. Mesenchymal stem cells derived from human gingiva are capable of immunomodulatory functions and ameliorate This article is protected by copyright. All rights reserved.
Accepted Article
Table 1. Parameters of DAI
Score
0
1
2
3
4
body weight loss
0
0-5 %
5-10 %
10-20 %
≥ 20%
stool consistency
Normal
-
loose stools
-
watery diarrhea
-
severe bleeding
presence of
rectal bleeding
none
hemoccult
Table 2 Oligonucleotide primer sets for real-time PCR
Genes
COX2-F
Sequence(5'-3')
Size (bp)
GATGACTGCCCAACTCCCA 193
COX2-R
TGAACCCAGGTCCTCGCTTA
iNOS-F
GCAGGGAATCTTGGAGCGAGTTG 139
iNOS-R
GTAGGTGAGGGCTTGGCTGAGTG
This article is protected by copyright. All rights reserved.
Accepted Article
in ZO-1 damages the direct link between actin and the transmembrane proteins. Most studies reported the loss of occludin and ZO-1 in UC. The expression of claudin-1 in UC varies with studies (44-48), which may be due to the variety of subjects or environments. In our study, we found reduction in all the three TJ proteins in the colon after DSS treatment. Additionally, in intestinal diseases, proinflammatory cytokines play an important role in the intestinal barrier. Studies reported that TNF-α and IFN-γ impaired epithelial barrier function by affecting the structure and function of the TJ such as occludin and ZO-1 (49, 50), which might be responsible for the increased intestinal permeability (51). After UMSC treatment, the reduced EB content in the colon indicated that systemic application of UMSCs significantly decreased intestinal permeability, which might be due to both of the inhibition of inflammation and the up-regulation of the TJ proteins.
In the present study, we first used Wharton’s jelly derived UMSCs for the therapy of DSS induced UC. We found the systematic application of UMSCs could alleviate UC via reducing inflammatory response by inhibiting the productions of cytokines and other inflammatory mediators and decreasing intestinal permeability by up-regulating TJ proteins. Although further study is still needed for revealing the underlining mechanisms of the beneficial effects of UMSCs treatment on experimental UC, and the long term effect of UMSCs is also waiting to be observed, this study may have suggested a more convenient and repeatable approach for the MSCs therapy in UC.
This article is protected by copyright. All rights reserved.
Accepted Article
METHODS Isolation, culture and identification of UMSC
Isolation of UMSC was carried out as previous described protocol (52). UMSCs were isolated within 2 h of umbilical cords obtaining. Briefly, the surface of the cord was rinsed with sterile phosphate buffer saline (PBS) and blood vessels were removed, and then Wharton’s jelly was peeled off from the remaining part of the umbilical cords. After washed 3 times in D-Hank’s salt solution, the Wharton’s jelly was cut into 1 mm3 pieces and cultured in Dulbecco’s modified Eagle’s medium/nutrient mixture F-12 (DMEM/F12) medium supplemented with 10% fetal bovine serum (FBS) and 100 U/ml penicillin-streptomycin. Cells were cultured at 37 °C in an incubator with 5% CO2 atmosphere. The UMSCs of passages 3-5 were subjected to labeling with CM-Dil (Beyotime, Haimen, China) according to the manufacturer’s instructions before transplantation.
The obtaining of sampling human umbilical cords was approved by the ethics committee of the first affiliated hospital of China Medical University. Written informed consent was obtained from all mothers before labor and delivery of infants.
This article is protected by copyright. All rights reserved.
Accepted Article
Flow cytometry analysis
The UMSCs from passage 3 were harvested by use of a 0.25% trypsin. For analysis, cells were stained by a combination of antibodies: PE-conjugated CD34, CD44 and CD105 (Santa Cruz Biotechnology. Santa Cruz, CA, USA). After exposure to labeled antibodies, cells were washed with ice-cold PBS and resuspended in ice-cold PBS. The expression of the corresponding cell-surface antigen was assayed by a FACSCalibur flow cytometer (BD Biosciences, San Jose, CA, USA).
Animal model and cell transplantation
Thirty male C57BL/6 mice (6-8 week-old) obtained from the Laboratory Animal Center of China Medical University were housed in ventilated cages under controlled temperature (18-25 °C), humidity (30-70% RH) and normal light/dark (12h/12h) cycle conditions. Food and water were provided ad labium. Experimental protocol was approved by the Ethics Committee of China Medical University. Mice were randomly assigned to three experimental groups: control group (control), 5% DSS treatment group (5% DSS) and 5% DSS plus UMSC transplantation group (UMSC). Experimental colitis was induced by feeding mice with 5% w/v DSS for 7 days in drinking water. Control mice received drinking water without DSS. Mice in UMSC group were injected 2.0 × 106 / 200 μl UMSC marked with CM-Dil via intravenous at day 2 after receiving DSS. Mice in other two groups received only UMSC culture medium injection. This article is protected by copyright. All rights reserved.
Accepted Article
UMSC tracing in vivo
Cell tracing was performed at the end of the experiments. Animals were euthanized and colon tissue samples were harvested and fixed in formalin for 24 h. Samples were then frozen and 10 μm cryosections were prepared and counterstained with DAPI (Biosharp, Hefei, China) for 5 min. The results were observed using a fluorescence microscope (BX53, Olympus, Tokyo, Japan)
Colitis Severity
Body weight, stool consistency and rectal bleeding for each mouse were recorded at the end of treatment. The DAI was calculated by daily grading on a scale of 0 to 4 using the parameters listed in table 1. The final score for each mouse was represented as the mean value of the 3 scores of body weight loss, stool consistency and rectal bleeding as described previously (53). On 7th day of treatment, all mice were anaesthetized and sacrificed. Midline incision was made and colons from the colocecal junction to the anus were removed. Colon lengths were measured.
Histopathology
Colon tissues were fixed for 24 h in 4% paraformaldehyde (PFA) at 4 °C. The following day, colons were embedded in paraffin and serially sectioned as 5 μm sections. The sections were cleared with xylene and hydrated in graded Ethanol. For This article is protected by copyright. All rights reserved.
Accepted Article
hematoxylin and eosin (HE) stain, sections were stained with HE (Solarbio Science & Technology, Beijing, China) using standard protocols. Sections were mounted using Permount and observed under the light microscope (DP73, Olympus, Tokyo, Japan). Score was given as per severity of pathology as described previously (54). Briefly, normal colon mucosa for score of 0, slight edema and infiltration of inflammatory cells for score of 1, loss of basal crypts with moderate inflammation in lamina propria for score of 2, total loss of basal crypts with severe inflammation in lamina propria but with surface epithelium still remaining for score of 3, loss of all crypts and surface epithelium with severe inflammation in the mucosa, muscularis propria and submucosa for score of 4. For IHC, sections were incubated in 3 % H2O2 for 15 min and then blocked with goat serum (Solarbio) for 15 min at room temperature. Sections were incubated overnight at 4 °C with COX2 and iNOS primary antibody (1: 100, Wanleibio, Shenyang, China), respectively. After washed by PBS, biotinylated goat anti-rabbit secondary antibody (1: 200, Beyotime) was added and incubated for 30 min. Sections were then washed with 1 × PBS and incubated with horseradish peroxidase (HRP) labeled streptavidin (Beyotime) for 30 min at 37 ˚C. The staining was visualized by reaction with diaminobenzidine tetrahydrochloride (DAB) and counterstaining with hematoxylin. After mounted using Permount, stained sections were analyzed under a light microscope (DP73, Olympus).
This article is protected by copyright. All rights reserved.
Accepted Article
For immunofluorescence assay, sections were inculated in claudin-1, occludin (Abcam) or ZO-1 antibodies (1: 200, Boster, Wuhan, China) at 4°C overnight, respectively. After washed by 1 × PBS, sections were incubated in FITC labeled goat anti-rabbit secondary antibody (1: 200, Beyotime) at 37 °C for 1 hour in dark. After washing, sections were counterstained with DAPI and mounted in aqueous mounting medium. Fluorescent labeling was examined using a confocal system (Olympus).
MPO assay and cytokine measurement
Neutrophil infiltration in the colon was determined by measuring MPO activity. Colon segments were homogenized at 10% in 0.9% saline solution. MPO activity was assayed using a Myeloperoxidase Assay Kit (Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s instructions.
Protein lysates were extracted from colonic tissues in NP-40 lysis buffer (Beyotime) containing 1% Triton X-100 with 1 mM PMSF. Protein extracts were centrifuged at 12,000g for 10 min and stored at -80 °C. TNF-α, IL-6, IFN-γ and IL-1β concentrations were measured using a commercial enzyme-linked immunosorbent assay kit (Boster) according to the manufacturer's protocol.
This article is protected by copyright. All rights reserved.
Accepted Article
Total protein concentrations were measured by a BCA Protein Assay Kit (Beyotime) for calibration.
Measurement of Colonic Mucosal Permeability
Colonic permeability was assayed using the method described with modifications (55). The dissected colon was perfused with 2 ml of 1.5% (w/v) EB (Sigma-Aldrich, St Louis, MO, USA) in PBS. After 120 min of incubated in Evans blue, the colon was rinsed three times in 6 mM acetylcysteine (Sigma) to remove any unabsorbed dye. The colon was then incubated with 1 ml of formamide (Biosharp) at 50 °C for 24 h to elute the Evans blue. Colorimetric measurements of the solvent were performed in a microplate reader (Bio-Tek Instruments, Winooski, VT, USA) at a wavelength of 632 nm, and permeability was calculated as μg of Evans blue / g of colonic tissue based on the standard curve of Evans blue.
Real-time PCR Total RNA was isolated from the colon homogenates using RNAsimple Total RNA Kit (Tiangen Biotech, Beijing, China) in accordance with the supplier's instructions. Total RNA from each sample was taken for cDNA synthesis using Super M-MLV Reverse transcriptase (BioTeke, Beijing, China). An equal amount of cDNA from each sample was taken for quantitative real-time PCR using an Exicycler 96 (Bioneer, Daejeon, Korea). Levels of mRNA were determined using SYBR Green (Solarbio) This article is protected by copyright. All rights reserved.
Accepted Article
quantitative real-time PCR with β-actin as a house-keeping gene. Primer sequences are listed in Table 2.
Western blot analysis Colonic protein extracts were separated by SDS-PAGE and transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore, Billerica, MA, USA). After blocked in 5% nonfat milk, membranes were incubated with COX2 (1: 100), iNOS (1: 500) (Wanleibio), occludin (1: 400), claudin-1 (1: 1000) (Abcam, Cambridge, MA, USA) and ZO-1 (1: 500, Boster) primary antibodies overnight at 4 ˚C, respectively. Membranes were then washed with TBST and incubated with goat anti-rabbit immunoglobulin G (IgG)-HRP-conjugated secondary antibodies (1:5000, Beyotime) for 45 min at 37 ˚C. After washing with TBST, protein bands were visualized by the enhanced chemiluminescence (ECL) regent (7 Sea Pharmtech, Shanghai, China). The protein levels were quantified by gray analysis using Gel-Pro-Analyzer.
Statistical analysis Results are expressed as means ± standard deviation (SD). All raw data were analyzed by one-way analysis of variance (ANOVA) followed by the Bonferroni test for post hoc comparisons. P value less than 0.05 was considered statistically significant.
DISCLOSURE The authors declare no conflicts of interest. This article is protected by copyright. All rights reserved.
Accepted Article
ACKNOWLEDGEMENTS
This study was supported by grants from the Science and Technology Program of Shenyang City (No.: F13-318-1-42) and the Science and Technology Program of Liaoning Province (No.: 2013225303).
REFERENCES
1.
Strober W, Fuss IJ, Blumberg RS. The immunology of mucosal models of
inflammation. Annual review of immunology 2002; 20:495-549.
2.
Vagefi PA, Longo WE. Colorectal cancer in patients with inflammatory bowel
disease. Clinical colorectal cancer 2005; 4:313-9. 3.
Eaden JA, Abrams KR, Mayberry JF. The risk of colorectal cancer in ulcerative
colitis: a meta-analysis. Gut 2001; 48:526-35. 4.
McCracken MD, Carlton WW, Tuite J. Penicillium viridicatum mycotoxicosis in
the rat. IV. Attempts to modify the tissue responses. Food and cosmetics toxicology 1974; 12:331-40.
5.
Delorme B, Ringe J, Pontikoglou C, et al. Specific lineage-priming of bone
marrow mesenchymal stem cells provides the molecular framework for their plasticity. Stem cells 2009; 27:1142-51.
This article is protected by copyright. All rights reserved.
Accepted Article
6.
Pittenger MF, Mackay AM, Beck SC, et al. Multilineage potential of adult human
mesenchymal stem cells. Science 1999; 284:143-7. 7.
Sacchetti B, Funari A, Michienzi S, et al. Self-renewing osteoprogenitors in bone
marrow sinusoids can organize a hematopoietic microenvironment. Cell 2007; 131:324-36.
8.
Troyer DL, Weiss ML. Wharton's jelly-derived cells are a primitive stromal cell
population. Stem cells 2008; 26:591-9. 9.
Batsali AK, Kastrinaki MC, Papadaki HA, Pontikoglou C. Mesenchymal stem
cells derived from Wharton's Jelly of the umbilical cord: biological properties and emerging clinical applications. Current stem cell research & therapy 2013; 8:144-55. 10. Bouma G, Strober W. The immunological and genetic basis of inflammatory bowel disease. Nature reviews. Immunology 2003; 3:521-33.
11. Rubin DT, Huo D, Kinnucan JA, et al. Inflammation is an independent risk factor for colonic neoplasia in patients with ulcerative colitis: a case-control study. Clinical gastroenterology and hepatology : the official clinical practice journal of the American Gastroenterological Association 2013; 11:1601-8 e1-4.
12. Rosenberg L, Nanda KS, Zenlea T, et al. Histologic markers of inflammation in patients with ulcerative colitis in clinical remission. Clinical gastroenterology and hepatology : the official clinical practice journal of the American Gastroenterological Association 2013; 11:991-6. This article is protected by copyright. All rights reserved.
Accepted Article
13. He XW, He XS, Lian L, Wu XJ, Lan P. Systemic infusion of bone marrow-derived mesenchymal stem cells for treatment of experimental colitis in mice. Digestive diseases and sciences 2012; 57:3136-44. 14. Ko IK, Kim BG, Awadallah A, et al. Targeting improves MSC treatment of inflammatory bowel disease. Molecular therapy : the journal of the American Society of Gene Therapy 2010; 18:1365-72.
15. Hayashi Y, Tsuji S, Tsujii M, et al. Topical implantation of mesenchymal stem cells has beneficial effects on healing of experimental colitis in rats. The Journal of pharmacology and experimental therapeutics 2008; 326:523-31.
16. Kim HS, Shin TH, Lee BC, et al. Human umbilical cord blood mesenchymal stem cells reduce colitis in mice by activating NOD2 signaling to COX2. Gastroenterology 2013; 145:1392-403 e1-8. 17. Wexler SA, Donaldson C, Denning-Kendall P, Rice C, Bradley B, Hows JM. Adult bone marrow is a rich source of human mesenchymal 'stem' cells but umbilical cord and mobilized adult blood are not. British journal of haematology 2003; 121:368-74.
18. Perdikogianni C, Dimitriou H, Stiakaki E, Martimianaki G, Kalmanti M. Could cord blood be a source of mesenchymal stromal cells for clinical use? Cytotherapy 2008; 10:452-9.
This article is protected by copyright. All rights reserved.
Accepted Article
19. Gonzalez-Mariscal L, Betanzos A, Nava P, Jaramillo BE. Tight junction proteins. Progress in biophysics and molecular biology 2003; 81:1-44. 20. Kyoko OO, Kono H, Ishimaru K, et al. Expressions of tight junction proteins Occludin and Claudin-1 are under the circadian control in the mouse large intestine: implications in intestinal permeability and susceptibility to colitis. PloS one 2014; 9:e98016.
21. Bruewer M, Utech M, Ivanov AI, Hopkins AM, Parkos CA, Nusrat A. Interferon-gamma induces internalization of epithelial tight junction proteins via a macropinocytosis-like process. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 2005; 19:923-33. 22. Bruewer M, Luegering A, Kucharzik T, et al. Proinflammatory cytokines disrupt epithelial barrier function by apoptosis-independent mechanisms. Journal of immunology 2003; 171:6164-72. 23. Kucharzik T, Walsh SV, Chen J, Parkos CA, Nusrat A. Neutrophil transmigration in inflammatory bowel disease is associated with differential expression of epithelial intercellular junction proteins. The American journal of pathology 2001; 159:2001-9.
24. Mees ST, Mennigen R, Spieker T, et al. Expression of tight and adherens junction proteins in ulcerative colitis associated colorectal carcinoma: upregulation of claudin-1, claudin-3, claudin-4, and beta-catenin. International journal of colorectal disease 2009; 24:361-8.
This article is protected by copyright. All rights reserved.
Accepted Article
Article Type: Original Article
Title page
Transplantation of human umbilical mesenchymal stem cells attenuates dextran sulfate sodium-induced colitis in mice
Yan Lin1, Lianjie Lin1, Qiushi Wang2, Yu Jin1, Ying Zhang1, Yong Cao1, Changqing Zheng1, *
1
Department of Gastroenterology, Shengjing Hospital of China Medical University,
Shenyang 110004, People’s Republic of China 2
Department of Blood Transfusion, Shengjing Hospital of China Medical University,
Shenyang 110004, People’s Republic of China
*
Corresponding author: Dr. Changqing Zheng, Department of Gastroenterology,
Shengjing Hospital of China Medical University, 36 Sanhao Street, Shenyang 110004, People’s Republic of China
This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1111/1440-1681.12321 This article is protected by copyright. All rights reserved.
Accepted Article
inflammation-related tissue destruction in experimental colitis. Journal of immunology 2009; 183:7787-98. 32. Gonzalez MA, Gonzalez-Rey E, Rico L, Buscher D, Delgado M. Adipose-derived mesenchymal stem cells alleviate experimental colitis by inhibiting inflammatory and autoimmune responses. Gastroenterology 2009; 136:978-89.
33. Kristjansson G, Venge P, Wanders A, Loof L, Hallgren R. Clinical and subclinical intestinal inflammation assessed by the mucosal patch technique: studies of mucosal neutrophil and eosinophil activation in inflammatory bowel diseases and irritable bowel syndrome. Gut 2004; 53:1806-12.
34. Hakansson A, Tormo-Badia N, Baridi A, et al. Immunological alteration and changes of gut microbiota after dextran sulfate sodium (DSS) administration in mice. Clinical and experimental medicine 2014. 35. Olsen T, Goll R, Cui G, et al. Tissue levels of tumor necrosis factor-alpha correlates with grade of inflammation in untreated ulcerative colitis. Scandinavian journal of gastroenterology 2007; 42:1312-20.
36. Itzkowitz SH. Molecular biology of dysplasia and cancer in inflammatory bowel disease. Gastroenterology clinics of North America 2006; 35:553-71. 37. Rosillo MA, Sanchez-Hidalgo M, Cardeno A, et al. Dietary supplementation of an ellagic acid-enriched pomegranate extract attenuates chronic colonic inflammation
This article is protected by copyright. All rights reserved.
Accepted Article
in rats. Pharmacological research : the official journal of the Italian Pharmacological Society 2012; 66:235-42. 38. Bitton A, Dobkin PL, Edwardes MD, et al. Predicting relapse in Crohn's disease: a biopsychosocial model. Gut 2008; 57:1386-92.
39. Clayburgh DR, Musch MW, Leitges M, Fu YX, Turner JR. Coordinated epithelial NHE3 inhibition and barrier dysfunction are required for TNF-mediated diarrhea in vivo. The Journal of clinical investigation 2006; 116:2682-94. 40. Ma TY. Intestinal epithelial barrier dysfunction in Crohn's disease. Proceedings of the Society for Experimental Biology and Medicine. Society for Experimental Biology and Medicine 1997; 214:318-27. 41. Mankertz J, Schulzke JD. Altered permeability in inflammatory bowel disease: pathophysiology and clinical implications. Current opinion in gastroenterology 2007; 23:379-83.
42. Al-Sadi R, Khatib K, Guo S, Ye D, Youssef M, Ma T. Occludin regulates macromolecule flux across the intestinal epithelial tight junction barrier. American journal of physiology. Gastrointestinal and liver physiology 2011; 300:G1054-64.
43. Fanning AS, Ma TY, Anderson JM. Isolation and functional characterization of the actin binding region in the tight junction protein ZO-1. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 2002; 16:1835-7. This article is protected by copyright. All rights reserved.
Accepted Article
44. Mennigen R, Nolte K, Rijcken E, et al. Probiotic mixture VSL#3 protects the epithelial barrier by maintaining tight junction protein expression and preventing apoptosis in a murine model of colitis. American journal of physiology. Gastrointestinal and liver physiology 2009; 296:G1140-9.
45. Li X, Wang Q, Xu H, et al. Somatostatin regulates tight junction proteins expression in colitis mice. International journal of clinical and experimental pathology 2014; 7:2153-62.
46. Xia XM, Wang FY, Zhou J, Hu KF, Li SW, Zou BB. CXCR4 antagonist AMD3100 modulates claudin expression and intestinal barrier function in experimental colitis. PloS one 2011; 6:e27282. 47. Kinugasa T, Akagi Y, Yoshida T, et al. Increased claudin-1 protein expression contributes to tumorigenesis in ulcerative colitis-associated colorectal cancer. Anticancer research 2010; 30:3181-6. 48. Poritz LS, Harris LR, 3rd, Kelly AA, Koltun WA. Increase in the tight junction protein claudin-1 in intestinal inflammation. Digestive diseases and sciences 2011; 56:2802-9.
49. Youakim A, Ahdieh M. Interferon-gamma decreases barrier function in T84 cells by reducing ZO-1 levels and disrupting apical actin. The American journal of physiology 1999; 276:G1279-88.
This article is protected by copyright. All rights reserved.
Accepted Article
50. Mankertz J, Tavalali S, Schmitz H, et al. Expression from the human occludin promoter is affected by tumor necrosis factor alpha and interferon gamma. Journal of cell science 2000; 113 ( Pt 11):2085-90. 51. Wang F, Graham WV, Wang Y, Witkowski ED, Schwarz BT, Turner JR. Interferon-gamma and tumor necrosis factor-alpha synergize to induce intestinal epithelial barrier dysfunction by up-regulating myosin light chain kinase expression. The American journal of pathology 2005; 166:409-19.
52. Liu S, Hou KD, Yuan M, et al. Characteristics of mesenchymal stem cells derived from Wharton's jelly of human umbilical cord and for fabrication of non-scaffold tissue-engineered cartilage. Journal of bioscience and bioengineering 2014; 117:229-35.
53. Siegmund B, Rieder F, Albrich S, et al. Adenosine kinase inhibitor GP515 improves experimental colitis in mice. The Journal of pharmacology and experimental therapeutics 2001; 296:99-105.
54. Patel RB, Prajapati KD, Sonara BM, et al. Ameliorative potential of aliskiren in experimental colitis in mice. European journal of pharmacology 2014; 737:70-6.
55. Kitajima S, Takuma S, Morimoto M. Changes in colonic mucosal permeability in mouse colitis induced with dextran sulfate sodium. Experimental animals / Japanese Association for Laboratory Animal Science 1999; 48:137-43.
This article is protected by copyright. All rights reserved.
Accepted Article
Table 1. Parameters of DAI
Score
0
1
2
3
4
body weight loss
0
0-5 %
5-10 %
10-20 %
≥ 20%
stool consistency
Normal
-
loose stools
-
watery diarrhea
-
severe bleeding
presence of
rectal bleeding
none
hemoccult
Table 2 Oligonucleotide primer sets for real-time PCR
Genes
COX2-F
Sequence(5'-3')
Size (bp)
GATGACTGCCCAACTCCCA 193
COX2-R
TGAACCCAGGTCCTCGCTTA
iNOS-F
GCAGGGAATCTTGGAGCGAGTTG 139
iNOS-R
GTAGGTGAGGGCTTGGCTGAGTG
This article is protected by copyright. All rights reserved.
Accepted Article
Occludin-F
TCTGCTTCATCGCTTCCTTAG 160
Occludin-R
GTCGGGTTCACTCCCATTA
Claudin-1-F
GTCCTACTTTCCTGCTCCTGTCC 146
Claudin-1-R
ATGTCCATTTTGTATTTGCTCC
ZO-1-F
CTGGTGGAAATGATGTCGGAAT 165
ZO-1-R
CTTTAGGGAGGTCAAGGAGG
β-actin-F
CTGTGCCCATCTACGAGGGCTAT 155
β-actin-R
TTTGATGTCACGCACGATTTCC
FIGURE LEGENDS
Figure 1. Morphological and immunophenotypic characterization of human UMSCs. (A) and (B) UMSCs showed the typical phenotype of mesenchymal cells. The scale bars represent 100 μm in A and 20 μm in B. Fluorocytometry was performed to check the cell surface markers: (C) unstained control; (D) CD34; (E) CD44; (F) CD105.
Figure 2. Representative fluorescence images of colon injected with UMSCs. CM-Dil positive cells were only observed in colons of UMSC groups. Scale bar =40 μm. This article is protected by copyright. All rights reserved.
Accepted Article
Figure 3. Protective effects of UMSCs implantation against DSS-induced colitis in mice. UMSCs implantation decreased DAI for colitis severity (A) and reduced colon length shortening in DSS-induced colitis (B). Results are shown as mean ± SD. * P < 0.05 versus control group, ** P < 0.01 versus control group, #P < 0.05 versus DSS group, ##P < 0.01 versus DSS group.
Figure 4. Representative HE staining of colon of mice receiving water (A normal control), DSS (B) and DSS + USMCs (C). Compared with that of normal controls, colon of DSS-treated mice showed destruction of epithelial architecture and inflammatory cellular infiltration. USMCs treatment attenuated damage of colon. Necrosis, edema or infiltration of inflammatory cells was indicated with arrows. D: Effect of USMCs on histological score in DSS induced colitis in mice. Results are shown as mean ± SD. ** P < 0.01 versus control group, ##P < 0.01 versus DSS group. Scale bar =100 μm shown in C.
Figure 5. Effect of USMCs implantation on MPO activity and cytokines levels in DSS induced colitis in mice. USMCs reduced DSS induced elevation of MPO activity (A) and cytokines levels (B). Results are shown as mean ± SD, n = 5. ** P < 0.01 versus control group, ##P < 0.01 versus DSS group.
This article is protected by copyright. All rights reserved.
Accepted Article
Figure 6. Effect of USMCs implantation on inflammatory enzymes in DSS induced colitis in mice. COX2 and iNOS expression were detected by PCR (A), western blot (B) and IHC (C). USMCs implantation down-regulated DSS induced COX2 and iNOS up-regulation. Results are shown as mean ± SD, n = 5. ** P < 0.01 versus control group, #P < 0.05 versus DSS group, ##P < 0.01 versus DSS group. Scale bar = 40 μm.
Figure 7. Effect of USMCs implantation on the intestinal permeability of DSS induced colitis in mice. USMCs implantation decreased EB content (A) and up-regulated TJ proteins expression (B, C) in mice with DSS induced colitis. Results are shown as mean ± SD, n = 5. ** P < 0.01 versus control group, #P < 0.05 versus DSS group, ##P < 0.01 versus DSS group.
Figure 8. Confirmation of the effect of USMCs implantation on tight junction proteins in rats with DSS induced colitis by immunofluorescence. 5% DSS reduced occludin (A), claudin (B) and ZO-1 (C) expression in the colon of mice. USMCs increased these TJ proteins expressions. Scale bar = 40 μm.
This article is protected by copyright. All rights reserved.
Accepted Article
This article is protected by copyright. All rights reserved.
Accepted Article
This article is protected by copyright. All rights reserved.
Accepted Article
This article is protected by copyright. All rights reserved.
Accepted Article
This article is protected by copyright. All rights reserved.
Accepted Article
This article is protected by copyright. All rights reserved.
Article Type: Original Article
Title page
Transplantation of human umbilical mesenchymal stem cells attenuates dextran sulfate sodium-induced colitis in mice
Yan Lin1, Lianjie Lin1, Qiushi Wang2, Yu Jin1, Ying Zhang1, Yong Cao1, Changqing Zheng1, *
1
Department of Gastroenterology, Shengjing Hospital of China Medical University,
Shenyang 110004, People’s Republic of China 2
Department of Blood Transfusion, Shengjing Hospital of China Medical University,
Shenyang 110004, People’s Republic of China
*
Corresponding author: Dr. Changqing Zheng, Department of Gastroenterology,
Shengjing Hospital of China Medical University, 36 Sanhao Street, Shenyang 110004, People’s Republic of China
This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1111/1440-1681.12321 This article is protected by copyright. All rights reserved.
Accepted Article
Tel: +86-24-96615-26211
E-mail: [email protected]
ABSTRACT
Ulcerative colitis (UC) is a major form of inflammatory bowel disease (IBD) and increases the risk of the development of colorectal carcinoma. The anti-inflammatory and immunomodulatory properties of mesenchymal stem cells (MSCs) make them promising tools for treating immune-mediated and inflammatory diseases. However, the lack of robust technique for harvesting and expanding of MSCs has hampered the use of bone marrow and umbilical cord blood derived MSCs in clinical applications. In the present study, we investigated the intestinal protective effects of Wharton’s jelly derived umbilical MSCs (UMSCs) on dextran sulfate sodium (DSS) induced colitis in mice. The severity of colitis in mice was assessed using body weight loss, stool consistency, rectal bleeding, colon shortening, and hematological parameters. Colonic myeloperoxidase (MPO) and proinflammatory cytokines levels were also measured. Furthermore, the expression of cyclooxygenase 2 (COX2) and inducible nitric oxide synthase (iNOS) in the colon were detected. In addition, intestinal permeability and tight junction proteins expressions in the colon were examined as well. The results showed that Wharton’s jelly derived UMSCs significantly diminished the severity of colitis, reduced histolopathological score, and decreased MPO activity and cytokines levels. Furthermore, the UMSCs markedly decreased the This article is protected by copyright. All rights reserved.
Accepted Article
Mesenchymal stem cells (MSCs) were first reported as a population of nonhematopoietic, plastic-adherent, fibroblast-like cells isolated from bone marrow (BM) by Friedenstein et al.(4). These cells are capable of differentiation into adipocytes, chondrocytes, osteocytes, smooth muscle cells, fibroblasts and hematopoietic supportive stroma (5, 6) and be self-renewing (7). Human umbilical MSCs (UMSC) are isolated from human umbilical cord (HUC). Compared with BM, HUC represents more suitable source for MSC collection for the painless, simple and safe isolation procedure and the relatively high frequency. Furthermore, MSCs derived from Wharton’s jelly exhibit a shorter doubling time and a broader pluripotency as compared to BM-MSCs (8). In addition, UMSCs possess anti-inflammatory and immunomodulatory properties, which render them as appealing candidates for cell based therapies (9). Studies suggest that inflammatory response and immunological changes are responsible for both the development and healing of UC (10-12). Numerous studies have shown that BM-MSCs contribute to the healing of experimental colitis in rats (13-15). HUC blood derived MSCs was also proved reduce colitis in mice (16). However, the frequency of UC blood is much lower than BM (17, 18).
Tight junction (TJ) proteins play an essential role in cellular proliferation, adhesion and glandular differentiation. The function of these proteins is compromised in intestinal diseases including UC. TJ composed by transmembrane proteins, such as
This article is protected by copyright. All rights reserved.
Accepted Article
RESULTS
Culture and identification of UMSCs
Two weeks after the UMSCs were isolated, all non-adherent cells were removed by medium change, and the adherent cells which formed typical fibroblastic morphology were UMSCs. Cells showed the typical phenotype of mesenchymal cells under phase contrast microscopy (Figure 1A and B). The immunophenotype analysis of UMSCs was performed by flow cytometry after 3 passages to further confirm the purity of UMSCs. Fibroblast-like cells showed strong expression of CD44 and CD105, with weak expression of the hematopoietic lineage marker CD34 (Figure 1) according to the previous studies (27, 28). Thus, we concluded that the adherent cells derived from umbilical cord were MSCs.
Cell track in vivo
When the experiments were finished, the colon was harvested for cell track analysis. Under a confocal laser scanning microscope, live cells should appear blue for being stained by DAPI and CM-Dil positive cells should appear red. The cells that were double stained blue and red could thus be identified as the implanted UMSCs. As shown in Figure 2, none of the CM-Dil labeled cells were present in the control or DSS group, while CM-Dil positive cells which appeared red were observed in UMSC group. The result indicated the success of the implantation.
This article is protected by copyright. All rights reserved.
Accepted Article
Effects of USMCs implantation on DSS induced colitis
Disease activity index (DAI) score
Mice fed with DSS developed signs of colitis as evidenced by a DAI score higher than 2 at day 7 (Figure 3A). USMCs implantation resulted in a significantly lower DAI score at day 7 (1.57 ± 0.45 in USMCs group vs. 2.63 ± 0.55 in DSS group, P < 0.01, n = 10).
Colon length
The colon in DSS-fed mice showed markedly shorter (6.08 ± 1.55 cm) than normal control mice (10.02 ± 1.61 cm, P < 0.05, n = 5, Figure 3B). The colon in the UMSCs implanted DSS group was significantly longer (9.56 ± 2.36 cm) than in DSS-fed mice (P < 0.05, n = 5).
Histological Score
HE staining of the colon of DSS-fed mice showed greater infiltration of inflammatory cells, marked necrosis of colonic mucosa, hyperemia and adhesions (Figure 4B). In UMSCs-treated mice, mucosal destruction and edema in the submucosa were reduced when compared with DSS-fed mice (Figure 4C). Accordingly, the histological score
This article is protected by copyright. All rights reserved.
Accepted Article
RESULTS
Culture and identification of UMSCs
Two weeks after the UMSCs were isolated, all non-adherent cells were removed by medium change, and the adherent cells which formed typical fibroblastic morphology were UMSCs. Cells showed the typical phenotype of mesenchymal cells under phase contrast microscopy (Figure 1A and B). The immunophenotype analysis of UMSCs was performed by flow cytometry after 3 passages to further confirm the purity of UMSCs. Fibroblast-like cells showed strong expression of CD44 and CD105, with weak expression of the hematopoietic lineage marker CD34 (Figure 1) according to the previous studies (27, 28). Thus, we concluded that the adherent cells derived from umbilical cord were MSCs.
Cell track in vivo
When the experiments were finished, the colon was harvested for cell track analysis. Under a confocal laser scanning microscope, live cells should appear blue for being stained by DAPI and CM-Dil positive cells should appear red. The cells that were double stained blue and red could thus be identified as the implanted UMSCs. As shown in Figure 2, none of the CM-Dil labeled cells were present in the control or DSS group, while CM-Dil positive cells which appeared red were observed in UMSC group. The result indicated the success of the implantation.
This article is protected by copyright. All rights reserved.
Accepted Article
Effects of USMCs implantation on DSS induced colitis
Disease activity index (DAI) score
Mice fed with DSS developed signs of colitis as evidenced by a DAI score higher than 2 at day 7 (Figure 3A). USMCs implantation resulted in a significantly lower DAI score at day 7 (1.57 ± 0.45 in USMCs group vs. 2.63 ± 0.55 in DSS group, P < 0.01, n = 10).
Colon length
The colon in DSS-fed mice showed markedly shorter (6.08 ± 1.55 cm) than normal control mice (10.02 ± 1.61 cm, P < 0.05, n = 5, Figure 3B). The colon in the UMSCs implanted DSS group was significantly longer (9.56 ± 2.36 cm) than in DSS-fed mice (P < 0.05, n = 5).
Histological Score
HE staining of the colon of DSS-fed mice showed greater infiltration of inflammatory cells, marked necrosis of colonic mucosa, hyperemia and adhesions (Figure 4B). In UMSCs-treated mice, mucosal destruction and edema in the submucosa were reduced when compared with DSS-fed mice (Figure 4C). Accordingly, the histological score
This article is protected by copyright. All rights reserved.
Accepted Article
For immunofluorescence assay, sections were inculated in claudin-1, occludin (Abcam) or ZO-1 antibodies (1: 200, Boster, Wuhan, China) at 4°C overnight, respectively. After washed by 1 × PBS, sections were incubated in FITC labeled goat anti-rabbit secondary antibody (1: 200, Beyotime) at 37 °C for 1 hour in dark. After washing, sections were counterstained with DAPI and mounted in aqueous mounting medium. Fluorescent labeling was examined using a confocal system (Olympus).
MPO assay and cytokine measurement
Neutrophil infiltration in the colon was determined by measuring MPO activity. Colon segments were homogenized at 10% in 0.9% saline solution. MPO activity was assayed using a Myeloperoxidase Assay Kit (Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s instructions.
Protein lysates were extracted from colonic tissues in NP-40 lysis buffer (Beyotime) containing 1% Triton X-100 with 1 mM PMSF. Protein extracts were centrifuged at 12,000g for 10 min and stored at -80 °C. TNF-α, IL-6, IFN-γ and IL-1β concentrations were measured using a commercial enzyme-linked immunosorbent assay kit (Boster) according to the manufacturer's protocol.
This article is protected by copyright. All rights reserved.
Accepted Article
implantation significantly down-regulated the mRNA and protein expression of these proteins associated with inflammation. The expression and subcellular localization of cyclooxygenase 2 (COX2) and inducible nitric oxide synthase (iNOS) were also evaluated by immunohistochemistry (IHC). As shown in Figure 6C, the IHC images demonstrated that DSS resulted in high-levels of COX2 and iNOS and UMSCs implantation reversed this effect partly. These results suggest UMSCs implantation may alleviate DSS induced colitis by inhibiting inflammatory response.
UMSCs implantation improved intestinal permeability in DSS induced colitis
As compared with control group, the Evans Blue (EB) content of the colon in DSS-fed mice was significantly higher (Figure 7A, P < 0.01). UMSCs implantation significantly reduced the EB content (P < 0.01), suggesting that UMSCs treatment may decrease the intestinal permeability of rats with DSS-induced colitis.
UMSCs implantation down-regulated tight junction protein expression in DSS induced colitis
To further investigate the effect of UMSCs implantation on intestinal permeability in DSS induced colitis, we detected the expression of TJ proteins which regulate paracellular permeability (24, 29). As shown in Figure 7, occludin, claudin-1 and ZO-1 mRNA levels were markedly down-regulated by DSS treatment (Figure 7B). In This article is protected by copyright. All rights reserved.
Accepted Article
accordance, protein levels were decreased as well (Figure 7C). USMCs implantation significantly increased the expression of three TJ proteins. In addition, the protein levels were also confirmed by immunofluorescence. As shown in Figure 8, the immunofluorescent images demonstrated that USMCs implantation counteracted the inhibitory effects of DSS on tight junction proteins. The results indicated that USMCs implantation might improve intestinal permeability by regulating tight junction proteins.
DISCUSSION
DSS induced UC model was originally reported by Okayasu et al. (30). This model exhibits features including mucosal damage, increased production of cytokines and other inflammatory mediators and leukocyte infiltration. In our study, mice treated with DSS for 7 days were characterized by decreased body weight, diarrhoea and rectal bleeding, and increased in DAI compared with the normal control group. Colon length was significantly shorter in the DSS group as well, and signs of inflammation were visible in the colon. These observations indicate the success of the model establishment. MSCs were demonstrated to improve the survival rate and reduce disease activity of experimental colitis in mice (31, 32). In the present study, we have isolated MSCs from the Wharton’s jelly of HUC, termed as UMSCs, which exhibit several unique stem cell-like properties as MSCs derived from other tissues. The results showed the This article is protected by copyright. All rights reserved.
Accepted Article
25. Liang L, Dong C, Chen X, et al. Human umbilical cord mesenchymal stem cells ameliorate mice trinitrobenzene sulfonic acid (TNBS)-induced colitis. Cell transplantation 2011; 20:1395-408. 26. Oh SY, Cho KA, Kang JL, Kim KH, Woo SY. Comparison of experimental mouse models of inflammatory bowel disease. International journal of molecular medicine 2014; 33:333-40.
27. Chen M, Xiang Z, Cai J. The anti-apoptotic and neuro-protective effects of human umbilical cord blood mesenchymal stem cells (hUCB-MSCs) on acute optic nerve injury is transient. Brain research 2013; 1532:63-75.
28. Ma S, Liang S, Jiao H, et al. Human umbilical cord mesenchymal stem cells inhibit C6 glioma growth via secretion of dickkopf-1 (DKK1). Molecular and cellular biochemistry 2014; 385:277-86. 29. Anderson JM, Van Itallie CM. Tight junctions and the molecular basis for regulation of paracellular permeability. The American journal of physiology 1995; 269:G467-75.
30. Okayasu I, Hatakeyama S, Yamada M, Ohkusa T, Inagaki Y, Nakaya R. A novel method in the induction of reliable experimental acute and chronic ulcerative colitis in mice. Gastroenterology 1990; 98:694-702. 31. Zhang Q, Shi S, Liu Y, et al. Mesenchymal stem cells derived from human gingiva are capable of immunomodulatory functions and ameliorate This article is protected by copyright. All rights reserved.
Accepted Article
Table 1. Parameters of DAI
Score
0
1
2
3
4
body weight loss
0
0-5 %
5-10 %
10-20 %
≥ 20%
stool consistency
Normal
-
loose stools
-
watery diarrhea
-
severe bleeding
presence of
rectal bleeding
none
hemoccult
Table 2 Oligonucleotide primer sets for real-time PCR
Genes
COX2-F
Sequence(5'-3')
Size (bp)
GATGACTGCCCAACTCCCA 193
COX2-R
TGAACCCAGGTCCTCGCTTA
iNOS-F
GCAGGGAATCTTGGAGCGAGTTG 139
iNOS-R
GTAGGTGAGGGCTTGGCTGAGTG
This article is protected by copyright. All rights reserved.
Accepted Article
in ZO-1 damages the direct link between actin and the transmembrane proteins. Most studies reported the loss of occludin and ZO-1 in UC. The expression of claudin-1 in UC varies with studies (44-48), which may be due to the variety of subjects or environments. In our study, we found reduction in all the three TJ proteins in the colon after DSS treatment. Additionally, in intestinal diseases, proinflammatory cytokines play an important role in the intestinal barrier. Studies reported that TNF-α and IFN-γ impaired epithelial barrier function by affecting the structure and function of the TJ such as occludin and ZO-1 (49, 50), which might be responsible for the increased intestinal permeability (51). After UMSC treatment, the reduced EB content in the colon indicated that systemic application of UMSCs significantly decreased intestinal permeability, which might be due to both of the inhibition of inflammation and the up-regulation of the TJ proteins.
In the present study, we first used Wharton’s jelly derived UMSCs for the therapy of DSS induced UC. We found the systematic application of UMSCs could alleviate UC via reducing inflammatory response by inhibiting the productions of cytokines and other inflammatory mediators and decreasing intestinal permeability by up-regulating TJ proteins. Although further study is still needed for revealing the underlining mechanisms of the beneficial effects of UMSCs treatment on experimental UC, and the long term effect of UMSCs is also waiting to be observed, this study may have suggested a more convenient and repeatable approach for the MSCs therapy in UC.
This article is protected by copyright. All rights reserved.
Accepted Article
METHODS Isolation, culture and identification of UMSC
Isolation of UMSC was carried out as previous described protocol (52). UMSCs were isolated within 2 h of umbilical cords obtaining. Briefly, the surface of the cord was rinsed with sterile phosphate buffer saline (PBS) and blood vessels were removed, and then Wharton’s jelly was peeled off from the remaining part of the umbilical cords. After washed 3 times in D-Hank’s salt solution, the Wharton’s jelly was cut into 1 mm3 pieces and cultured in Dulbecco’s modified Eagle’s medium/nutrient mixture F-12 (DMEM/F12) medium supplemented with 10% fetal bovine serum (FBS) and 100 U/ml penicillin-streptomycin. Cells were cultured at 37 °C in an incubator with 5% CO2 atmosphere. The UMSCs of passages 3-5 were subjected to labeling with CM-Dil (Beyotime, Haimen, China) according to the manufacturer’s instructions before transplantation.
The obtaining of sampling human umbilical cords was approved by the ethics committee of the first affiliated hospital of China Medical University. Written informed consent was obtained from all mothers before labor and delivery of infants.
This article is protected by copyright. All rights reserved.
Accepted Article
Flow cytometry analysis
The UMSCs from passage 3 were harvested by use of a 0.25% trypsin. For analysis, cells were stained by a combination of antibodies: PE-conjugated CD34, CD44 and CD105 (Santa Cruz Biotechnology. Santa Cruz, CA, USA). After exposure to labeled antibodies, cells were washed with ice-cold PBS and resuspended in ice-cold PBS. The expression of the corresponding cell-surface antigen was assayed by a FACSCalibur flow cytometer (BD Biosciences, San Jose, CA, USA).
Animal model and cell transplantation
Thirty male C57BL/6 mice (6-8 week-old) obtained from the Laboratory Animal Center of China Medical University were housed in ventilated cages under controlled temperature (18-25 °C), humidity (30-70% RH) and normal light/dark (12h/12h) cycle conditions. Food and water were provided ad labium. Experimental protocol was approved by the Ethics Committee of China Medical University. Mice were randomly assigned to three experimental groups: control group (control), 5% DSS treatment group (5% DSS) and 5% DSS plus UMSC transplantation group (UMSC). Experimental colitis was induced by feeding mice with 5% w/v DSS for 7 days in drinking water. Control mice received drinking water without DSS. Mice in UMSC group were injected 2.0 × 106 / 200 μl UMSC marked with CM-Dil via intravenous at day 2 after receiving DSS. Mice in other two groups received only UMSC culture medium injection. This article is protected by copyright. All rights reserved.
Accepted Article
UMSC tracing in vivo
Cell tracing was performed at the end of the experiments. Animals were euthanized and colon tissue samples were harvested and fixed in formalin for 24 h. Samples were then frozen and 10 μm cryosections were prepared and counterstained with DAPI (Biosharp, Hefei, China) for 5 min. The results were observed using a fluorescence microscope (BX53, Olympus, Tokyo, Japan)
Colitis Severity
Body weight, stool consistency and rectal bleeding for each mouse were recorded at the end of treatment. The DAI was calculated by daily grading on a scale of 0 to 4 using the parameters listed in table 1. The final score for each mouse was represented as the mean value of the 3 scores of body weight loss, stool consistency and rectal bleeding as described previously (53). On 7th day of treatment, all mice were anaesthetized and sacrificed. Midline incision was made and colons from the colocecal junction to the anus were removed. Colon lengths were measured.
Histopathology
Colon tissues were fixed for 24 h in 4% paraformaldehyde (PFA) at 4 °C. The following day, colons were embedded in paraffin and serially sectioned as 5 μm sections. The sections were cleared with xylene and hydrated in graded Ethanol. For This article is protected by copyright. All rights reserved.
Accepted Article
hematoxylin and eosin (HE) stain, sections were stained with HE (Solarbio Science & Technology, Beijing, China) using standard protocols. Sections were mounted using Permount and observed under the light microscope (DP73, Olympus, Tokyo, Japan). Score was given as per severity of pathology as described previously (54). Briefly, normal colon mucosa for score of 0, slight edema and infiltration of inflammatory cells for score of 1, loss of basal crypts with moderate inflammation in lamina propria for score of 2, total loss of basal crypts with severe inflammation in lamina propria but with surface epithelium still remaining for score of 3, loss of all crypts and surface epithelium with severe inflammation in the mucosa, muscularis propria and submucosa for score of 4. For IHC, sections were incubated in 3 % H2O2 for 15 min and then blocked with goat serum (Solarbio) for 15 min at room temperature. Sections were incubated overnight at 4 °C with COX2 and iNOS primary antibody (1: 100, Wanleibio, Shenyang, China), respectively. After washed by PBS, biotinylated goat anti-rabbit secondary antibody (1: 200, Beyotime) was added and incubated for 30 min. Sections were then washed with 1 × PBS and incubated with horseradish peroxidase (HRP) labeled streptavidin (Beyotime) for 30 min at 37 ˚C. The staining was visualized by reaction with diaminobenzidine tetrahydrochloride (DAB) and counterstaining with hematoxylin. After mounted using Permount, stained sections were analyzed under a light microscope (DP73, Olympus).
This article is protected by copyright. All rights reserved.
Accepted Article
For immunofluorescence assay, sections were inculated in claudin-1, occludin (Abcam) or ZO-1 antibodies (1: 200, Boster, Wuhan, China) at 4°C overnight, respectively. After washed by 1 × PBS, sections were incubated in FITC labeled goat anti-rabbit secondary antibody (1: 200, Beyotime) at 37 °C for 1 hour in dark. After washing, sections were counterstained with DAPI and mounted in aqueous mounting medium. Fluorescent labeling was examined using a confocal system (Olympus).
MPO assay and cytokine measurement
Neutrophil infiltration in the colon was determined by measuring MPO activity. Colon segments were homogenized at 10% in 0.9% saline solution. MPO activity was assayed using a Myeloperoxidase Assay Kit (Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s instructions.
Protein lysates were extracted from colonic tissues in NP-40 lysis buffer (Beyotime) containing 1% Triton X-100 with 1 mM PMSF. Protein extracts were centrifuged at 12,000g for 10 min and stored at -80 °C. TNF-α, IL-6, IFN-γ and IL-1β concentrations were measured using a commercial enzyme-linked immunosorbent assay kit (Boster) according to the manufacturer's protocol.
This article is protected by copyright. All rights reserved.
Accepted Article
Total protein concentrations were measured by a BCA Protein Assay Kit (Beyotime) for calibration.
Measurement of Colonic Mucosal Permeability
Colonic permeability was assayed using the method described with modifications (55). The dissected colon was perfused with 2 ml of 1.5% (w/v) EB (Sigma-Aldrich, St Louis, MO, USA) in PBS. After 120 min of incubated in Evans blue, the colon was rinsed three times in 6 mM acetylcysteine (Sigma) to remove any unabsorbed dye. The colon was then incubated with 1 ml of formamide (Biosharp) at 50 °C for 24 h to elute the Evans blue. Colorimetric measurements of the solvent were performed in a microplate reader (Bio-Tek Instruments, Winooski, VT, USA) at a wavelength of 632 nm, and permeability was calculated as μg of Evans blue / g of colonic tissue based on the standard curve of Evans blue.
Real-time PCR Total RNA was isolated from the colon homogenates using RNAsimple Total RNA Kit (Tiangen Biotech, Beijing, China) in accordance with the supplier's instructions. Total RNA from each sample was taken for cDNA synthesis using Super M-MLV Reverse transcriptase (BioTeke, Beijing, China). An equal amount of cDNA from each sample was taken for quantitative real-time PCR using an Exicycler 96 (Bioneer, Daejeon, Korea). Levels of mRNA were determined using SYBR Green (Solarbio) This article is protected by copyright. All rights reserved.
Accepted Article
quantitative real-time PCR with β-actin as a house-keeping gene. Primer sequences are listed in Table 2.
Western blot analysis Colonic protein extracts were separated by SDS-PAGE and transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore, Billerica, MA, USA). After blocked in 5% nonfat milk, membranes were incubated with COX2 (1: 100), iNOS (1: 500) (Wanleibio), occludin (1: 400), claudin-1 (1: 1000) (Abcam, Cambridge, MA, USA) and ZO-1 (1: 500, Boster) primary antibodies overnight at 4 ˚C, respectively. Membranes were then washed with TBST and incubated with goat anti-rabbit immunoglobulin G (IgG)-HRP-conjugated secondary antibodies (1:5000, Beyotime) for 45 min at 37 ˚C. After washing with TBST, protein bands were visualized by the enhanced chemiluminescence (ECL) regent (7 Sea Pharmtech, Shanghai, China). The protein levels were quantified by gray analysis using Gel-Pro-Analyzer.
Statistical analysis Results are expressed as means ± standard deviation (SD). All raw data were analyzed by one-way analysis of variance (ANOVA) followed by the Bonferroni test for post hoc comparisons. P value less than 0.05 was considered statistically significant.
DISCLOSURE The authors declare no conflicts of interest. This article is protected by copyright. All rights reserved.
Accepted Article
ACKNOWLEDGEMENTS
This study was supported by grants from the Science and Technology Program of Shenyang City (No.: F13-318-1-42) and the Science and Technology Program of Liaoning Province (No.: 2013225303).
REFERENCES
1.
Strober W, Fuss IJ, Blumberg RS. The immunology of mucosal models of
inflammation. Annual review of immunology 2002; 20:495-549.
2.
Vagefi PA, Longo WE. Colorectal cancer in patients with inflammatory bowel
disease. Clinical colorectal cancer 2005; 4:313-9. 3.
Eaden JA, Abrams KR, Mayberry JF. The risk of colorectal cancer in ulcerative
colitis: a meta-analysis. Gut 2001; 48:526-35. 4.
McCracken MD, Carlton WW, Tuite J. Penicillium viridicatum mycotoxicosis in
the rat. IV. Attempts to modify the tissue responses. Food and cosmetics toxicology 1974; 12:331-40.
5.
Delorme B, Ringe J, Pontikoglou C, et al. Specific lineage-priming of bone
marrow mesenchymal stem cells provides the molecular framework for their plasticity. Stem cells 2009; 27:1142-51.
This article is protected by copyright. All rights reserved.
Accepted Article
6.
Pittenger MF, Mackay AM, Beck SC, et al. Multilineage potential of adult human
mesenchymal stem cells. Science 1999; 284:143-7. 7.
Sacchetti B, Funari A, Michienzi S, et al. Self-renewing osteoprogenitors in bone
marrow sinusoids can organize a hematopoietic microenvironment. Cell 2007; 131:324-36.
8.
Troyer DL, Weiss ML. Wharton's jelly-derived cells are a primitive stromal cell
population. Stem cells 2008; 26:591-9. 9.
Batsali AK, Kastrinaki MC, Papadaki HA, Pontikoglou C. Mesenchymal stem
cells derived from Wharton's Jelly of the umbilical cord: biological properties and emerging clinical applications. Current stem cell research & therapy 2013; 8:144-55. 10. Bouma G, Strober W. The immunological and genetic basis of inflammatory bowel disease. Nature reviews. Immunology 2003; 3:521-33.
11. Rubin DT, Huo D, Kinnucan JA, et al. Inflammation is an independent risk factor for colonic neoplasia in patients with ulcerative colitis: a case-control study. Clinical gastroenterology and hepatology : the official clinical practice journal of the American Gastroenterological Association 2013; 11:1601-8 e1-4.
12. Rosenberg L, Nanda KS, Zenlea T, et al. Histologic markers of inflammation in patients with ulcerative colitis in clinical remission. Clinical gastroenterology and hepatology : the official clinical practice journal of the American Gastroenterological Association 2013; 11:991-6. This article is protected by copyright. All rights reserved.
Accepted Article
13. He XW, He XS, Lian L, Wu XJ, Lan P. Systemic infusion of bone marrow-derived mesenchymal stem cells for treatment of experimental colitis in mice. Digestive diseases and sciences 2012; 57:3136-44. 14. Ko IK, Kim BG, Awadallah A, et al. Targeting improves MSC treatment of inflammatory bowel disease. Molecular therapy : the journal of the American Society of Gene Therapy 2010; 18:1365-72.
15. Hayashi Y, Tsuji S, Tsujii M, et al. Topical implantation of mesenchymal stem cells has beneficial effects on healing of experimental colitis in rats. The Journal of pharmacology and experimental therapeutics 2008; 326:523-31.
16. Kim HS, Shin TH, Lee BC, et al. Human umbilical cord blood mesenchymal stem cells reduce colitis in mice by activating NOD2 signaling to COX2. Gastroenterology 2013; 145:1392-403 e1-8. 17. Wexler SA, Donaldson C, Denning-Kendall P, Rice C, Bradley B, Hows JM. Adult bone marrow is a rich source of human mesenchymal 'stem' cells but umbilical cord and mobilized adult blood are not. British journal of haematology 2003; 121:368-74.
18. Perdikogianni C, Dimitriou H, Stiakaki E, Martimianaki G, Kalmanti M. Could cord blood be a source of mesenchymal stromal cells for clinical use? Cytotherapy 2008; 10:452-9.
This article is protected by copyright. All rights reserved.
Accepted Article
19. Gonzalez-Mariscal L, Betanzos A, Nava P, Jaramillo BE. Tight junction proteins. Progress in biophysics and molecular biology 2003; 81:1-44. 20. Kyoko OO, Kono H, Ishimaru K, et al. Expressions of tight junction proteins Occludin and Claudin-1 are under the circadian control in the mouse large intestine: implications in intestinal permeability and susceptibility to colitis. PloS one 2014; 9:e98016.
21. Bruewer M, Utech M, Ivanov AI, Hopkins AM, Parkos CA, Nusrat A. Interferon-gamma induces internalization of epithelial tight junction proteins via a macropinocytosis-like process. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 2005; 19:923-33. 22. Bruewer M, Luegering A, Kucharzik T, et al. Proinflammatory cytokines disrupt epithelial barrier function by apoptosis-independent mechanisms. Journal of immunology 2003; 171:6164-72. 23. Kucharzik T, Walsh SV, Chen J, Parkos CA, Nusrat A. Neutrophil transmigration in inflammatory bowel disease is associated with differential expression of epithelial intercellular junction proteins. The American journal of pathology 2001; 159:2001-9.
24. Mees ST, Mennigen R, Spieker T, et al. Expression of tight and adherens junction proteins in ulcerative colitis associated colorectal carcinoma: upregulation of claudin-1, claudin-3, claudin-4, and beta-catenin. International journal of colorectal disease 2009; 24:361-8.
This article is protected by copyright. All rights reserved.
Accepted Article
Article Type: Original Article
Title page
Transplantation of human umbilical mesenchymal stem cells attenuates dextran sulfate sodium-induced colitis in mice
Yan Lin1, Lianjie Lin1, Qiushi Wang2, Yu Jin1, Ying Zhang1, Yong Cao1, Changqing Zheng1, *
1
Department of Gastroenterology, Shengjing Hospital of China Medical University,
Shenyang 110004, People’s Republic of China 2
Department of Blood Transfusion, Shengjing Hospital of China Medical University,
Shenyang 110004, People’s Republic of China
*
Corresponding author: Dr. Changqing Zheng, Department of Gastroenterology,
Shengjing Hospital of China Medical University, 36 Sanhao Street, Shenyang 110004, People’s Republic of China
This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1111/1440-1681.12321 This article is protected by copyright. All rights reserved.
Accepted Article
inflammation-related tissue destruction in experimental colitis. Journal of immunology 2009; 183:7787-98. 32. Gonzalez MA, Gonzalez-Rey E, Rico L, Buscher D, Delgado M. Adipose-derived mesenchymal stem cells alleviate experimental colitis by inhibiting inflammatory and autoimmune responses. Gastroenterology 2009; 136:978-89.
33. Kristjansson G, Venge P, Wanders A, Loof L, Hallgren R. Clinical and subclinical intestinal inflammation assessed by the mucosal patch technique: studies of mucosal neutrophil and eosinophil activation in inflammatory bowel diseases and irritable bowel syndrome. Gut 2004; 53:1806-12.
34. Hakansson A, Tormo-Badia N, Baridi A, et al. Immunological alteration and changes of gut microbiota after dextran sulfate sodium (DSS) administration in mice. Clinical and experimental medicine 2014. 35. Olsen T, Goll R, Cui G, et al. Tissue levels of tumor necrosis factor-alpha correlates with grade of inflammation in untreated ulcerative colitis. Scandinavian journal of gastroenterology 2007; 42:1312-20.
36. Itzkowitz SH. Molecular biology of dysplasia and cancer in inflammatory bowel disease. Gastroenterology clinics of North America 2006; 35:553-71. 37. Rosillo MA, Sanchez-Hidalgo M, Cardeno A, et al. Dietary supplementation of an ellagic acid-enriched pomegranate extract attenuates chronic colonic inflammation
This article is protected by copyright. All rights reserved.
Accepted Article
in rats. Pharmacological research : the official journal of the Italian Pharmacological Society 2012; 66:235-42. 38. Bitton A, Dobkin PL, Edwardes MD, et al. Predicting relapse in Crohn's disease: a biopsychosocial model. Gut 2008; 57:1386-92.
39. Clayburgh DR, Musch MW, Leitges M, Fu YX, Turner JR. Coordinated epithelial NHE3 inhibition and barrier dysfunction are required for TNF-mediated diarrhea in vivo. The Journal of clinical investigation 2006; 116:2682-94. 40. Ma TY. Intestinal epithelial barrier dysfunction in Crohn's disease. Proceedings of the Society for Experimental Biology and Medicine. Society for Experimental Biology and Medicine 1997; 214:318-27. 41. Mankertz J, Schulzke JD. Altered permeability in inflammatory bowel disease: pathophysiology and clinical implications. Current opinion in gastroenterology 2007; 23:379-83.
42. Al-Sadi R, Khatib K, Guo S, Ye D, Youssef M, Ma T. Occludin regulates macromolecule flux across the intestinal epithelial tight junction barrier. American journal of physiology. Gastrointestinal and liver physiology 2011; 300:G1054-64.
43. Fanning AS, Ma TY, Anderson JM. Isolation and functional characterization of the actin binding region in the tight junction protein ZO-1. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 2002; 16:1835-7. This article is protected by copyright. All rights reserved.
Accepted Article
44. Mennigen R, Nolte K, Rijcken E, et al. Probiotic mixture VSL#3 protects the epithelial barrier by maintaining tight junction protein expression and preventing apoptosis in a murine model of colitis. American journal of physiology. Gastrointestinal and liver physiology 2009; 296:G1140-9.
45. Li X, Wang Q, Xu H, et al. Somatostatin regulates tight junction proteins expression in colitis mice. International journal of clinical and experimental pathology 2014; 7:2153-62.
46. Xia XM, Wang FY, Zhou J, Hu KF, Li SW, Zou BB. CXCR4 antagonist AMD3100 modulates claudin expression and intestinal barrier function in experimental colitis. PloS one 2011; 6:e27282. 47. Kinugasa T, Akagi Y, Yoshida T, et al. Increased claudin-1 protein expression contributes to tumorigenesis in ulcerative colitis-associated colorectal cancer. Anticancer research 2010; 30:3181-6. 48. Poritz LS, Harris LR, 3rd, Kelly AA, Koltun WA. Increase in the tight junction protein claudin-1 in intestinal inflammation. Digestive diseases and sciences 2011; 56:2802-9.
49. Youakim A, Ahdieh M. Interferon-gamma decreases barrier function in T84 cells by reducing ZO-1 levels and disrupting apical actin. The American journal of physiology 1999; 276:G1279-88.
This article is protected by copyright. All rights reserved.
Accepted Article
50. Mankertz J, Tavalali S, Schmitz H, et al. Expression from the human occludin promoter is affected by tumor necrosis factor alpha and interferon gamma. Journal of cell science 2000; 113 ( Pt 11):2085-90. 51. Wang F, Graham WV, Wang Y, Witkowski ED, Schwarz BT, Turner JR. Interferon-gamma and tumor necrosis factor-alpha synergize to induce intestinal epithelial barrier dysfunction by up-regulating myosin light chain kinase expression. The American journal of pathology 2005; 166:409-19.
52. Liu S, Hou KD, Yuan M, et al. Characteristics of mesenchymal stem cells derived from Wharton's jelly of human umbilical cord and for fabrication of non-scaffold tissue-engineered cartilage. Journal of bioscience and bioengineering 2014; 117:229-35.
53. Siegmund B, Rieder F, Albrich S, et al. Adenosine kinase inhibitor GP515 improves experimental colitis in mice. The Journal of pharmacology and experimental therapeutics 2001; 296:99-105.
54. Patel RB, Prajapati KD, Sonara BM, et al. Ameliorative potential of aliskiren in experimental colitis in mice. European journal of pharmacology 2014; 737:70-6.
55. Kitajima S, Takuma S, Morimoto M. Changes in colonic mucosal permeability in mouse colitis induced with dextran sulfate sodium. Experimental animals / Japanese Association for Laboratory Animal Science 1999; 48:137-43.
This article is protected by copyright. All rights reserved.
Accepted Article
Table 1. Parameters of DAI
Score
0
1
2
3
4
body weight loss
0
0-5 %
5-10 %
10-20 %
≥ 20%
stool consistency
Normal
-
loose stools
-
watery diarrhea
-
severe bleeding
presence of
rectal bleeding
none
hemoccult
Table 2 Oligonucleotide primer sets for real-time PCR
Genes
COX2-F
Sequence(5'-3')
Size (bp)
GATGACTGCCCAACTCCCA 193
COX2-R
TGAACCCAGGTCCTCGCTTA
iNOS-F
GCAGGGAATCTTGGAGCGAGTTG 139
iNOS-R
GTAGGTGAGGGCTTGGCTGAGTG
This article is protected by copyright. All rights reserved.
Accepted Article
Occludin-F
TCTGCTTCATCGCTTCCTTAG 160
Occludin-R
GTCGGGTTCACTCCCATTA
Claudin-1-F
GTCCTACTTTCCTGCTCCTGTCC 146
Claudin-1-R
ATGTCCATTTTGTATTTGCTCC
ZO-1-F
CTGGTGGAAATGATGTCGGAAT 165
ZO-1-R
CTTTAGGGAGGTCAAGGAGG
β-actin-F
CTGTGCCCATCTACGAGGGCTAT 155
β-actin-R
TTTGATGTCACGCACGATTTCC
FIGURE LEGENDS
Figure 1. Morphological and immunophenotypic characterization of human UMSCs. (A) and (B) UMSCs showed the typical phenotype of mesenchymal cells. The scale bars represent 100 μm in A and 20 μm in B. Fluorocytometry was performed to check the cell surface markers: (C) unstained control; (D) CD34; (E) CD44; (F) CD105.
Figure 2. Representative fluorescence images of colon injected with UMSCs. CM-Dil positive cells were only observed in colons of UMSC groups. Scale bar =40 μm. This article is protected by copyright. All rights reserved.
Accepted Article
Figure 3. Protective effects of UMSCs implantation against DSS-induced colitis in mice. UMSCs implantation decreased DAI for colitis severity (A) and reduced colon length shortening in DSS-induced colitis (B). Results are shown as mean ± SD. * P < 0.05 versus control group, ** P < 0.01 versus control group, #P < 0.05 versus DSS group, ##P < 0.01 versus DSS group.
Figure 4. Representative HE staining of colon of mice receiving water (A normal control), DSS (B) and DSS + USMCs (C). Compared with that of normal controls, colon of DSS-treated mice showed destruction of epithelial architecture and inflammatory cellular infiltration. USMCs treatment attenuated damage of colon. Necrosis, edema or infiltration of inflammatory cells was indicated with arrows. D: Effect of USMCs on histological score in DSS induced colitis in mice. Results are shown as mean ± SD. ** P < 0.01 versus control group, ##P < 0.01 versus DSS group. Scale bar =100 μm shown in C.
Figure 5. Effect of USMCs implantation on MPO activity and cytokines levels in DSS induced colitis in mice. USMCs reduced DSS induced elevation of MPO activity (A) and cytokines levels (B). Results are shown as mean ± SD, n = 5. ** P < 0.01 versus control group, ##P < 0.01 versus DSS group.
This article is protected by copyright. All rights reserved.
Accepted Article
Figure 6. Effect of USMCs implantation on inflammatory enzymes in DSS induced colitis in mice. COX2 and iNOS expression were detected by PCR (A), western blot (B) and IHC (C). USMCs implantation down-regulated DSS induced COX2 and iNOS up-regulation. Results are shown as mean ± SD, n = 5. ** P < 0.01 versus control group, #P < 0.05 versus DSS group, ##P < 0.01 versus DSS group. Scale bar = 40 μm.
Figure 7. Effect of USMCs implantation on the intestinal permeability of DSS induced colitis in mice. USMCs implantation decreased EB content (A) and up-regulated TJ proteins expression (B, C) in mice with DSS induced colitis. Results are shown as mean ± SD, n = 5. ** P < 0.01 versus control group, #P < 0.05 versus DSS group, ##P < 0.01 versus DSS group.
Figure 8. Confirmation of the effect of USMCs implantation on tight junction proteins in rats with DSS induced colitis by immunofluorescence. 5% DSS reduced occludin (A), claudin (B) and ZO-1 (C) expression in the colon of mice. USMCs increased these TJ proteins expressions. Scale bar = 40 μm.
This article is protected by copyright. All rights reserved.
Accepted Article
This article is protected by copyright. All rights reserved.
Accepted Article
This article is protected by copyright. All rights reserved.
Accepted Article
This article is protected by copyright. All rights reserved.
Accepted Article
This article is protected by copyright. All rights reserved.
Accepted Article
This article is protected by copyright. All rights reserved.
