Neuroscience Letters 595 (2015) 30–34
Contents lists available at ScienceDirect
Neuroscience Letters journal homepage: www.elsevier.com/locate/neulet
Research article
Tumor necrosis factor-alpha is a potential diagnostic biomarker for chronic neuropathic pain after spinal cord injury Jun Xu a , Xiaoqiang E b , Huiyong Liu c , Feng Li a , Yanhui Cao b , Jun Tian a , Jinglong Yan a,∗ a
Department of Orthopedics, Second Affiliated Hospital of Harbin Medical University, Harbin, China Department of Orthopedics, First Affiliated Hospital of Harbin Medical University, Harbin, China c Department of Orthopedics, Chinese Medical Hospital in Hulan District, Harbin, China b
h i g h l i g h t s • • • •
Role of neuro-immune in neuropathic pain after spinal cord injury was evaluated. The levels of TLR4, TNF-␣ and IL-6 were upregulated in SCI-NP subjects. High TNF-␣ level was associated with high risk of NP in SCI patients. TNF-␣ could be a sensitive diagnostic biomarker for NP in SCI subjects.
a r t i c l e
i n f o
Article history: Received 16 March 2015 Received in revised form 2 April 2015 Accepted 2 April 2015 Available online 3 April 2015 Keywords: Spinal cord injury Neuropathic pain Tumor necrosis factor-alpha Toll-like receptor 4 Interleukin-6
a b s t r a c t Neuropathic pain (NP) is one of the most common complications after spinal cord injury (SCI), but no protein biomarkers has ever been introduced into clinical diagnosis. Previous studies implicated that toll-like receptor (TLR) 4 played a critical role in the development of NP in animal SCI models. Here, a total of 140 participants were recruited, 70 of them were SCI-NP subject and the rest 70 controls did not show neuropathic symptoms. TLR4 was upregulated significantly in SCI-NP patients compared with SCInoNP subjects. Furthermore, we measured the concentrations of tumor necrosis factor-alpha (TNF-␣) and interleukin-6 (IL-6), two TLR4 downstream pro-inflammatory cytokines, to assess their diagnostic values. Receiver operating characteristics (ROC) analysis revealed that TNF-␣ had great potential advantages to predict the progression of neuropathy, the risks of NP were strongly increased in SCI subjects with higher levels of TNF-␣ (odds ratio: 4.92; 95% confidence interval: 1.89–12.32). These results suggested neuroimmune activation contributed to the development of neuropathic disorder after SCI, and TNF-␣ could be a potential sensitive diagnostic biomarker for chronic neuropathic pain in SCI patients. © 2015 Published by Elsevier Ireland Ltd.
1. Introduction About 273,000 individuals are living with a spinal cord injury (SCI) in US, and many are disabled [1]. Chronic pain is a serious and frequent health problem for patients with SCI. Depending on the study population and the definition of pain, 26–96% of people with SCI experience pain and describe it as a problem [9,24]. Chronic neuropathic pain (NP), which results from a lesion or disease of the somatosensory nervous system related to the injury, increases the
∗ Corresponding author. Tel.: +86 45186296061; fax: +86 45186296061. E-mail address: [email protected] (J. Yan). http://dx.doi.org/10.1016/j.neulet.2015.04.004 0304-3940/© 2015 Published by Elsevier Ireland Ltd.
complexity of SCI management since NP is challenging to treat [25]. NP has a significant impact on the physical, emotional and cognitive functioning of subjects with SCI [10]. It is estimated that the mean expenditures were US $47,518 for each SCI patient with NP [18]. Therefore, it is vital for the SCI patients to control the risk factors of NP at the early stage. Toll-like receptors (TLRs), a protein family of 14 identified receptors, play a critical role in the innate immune system [20]. Interactions between TLRs and their ligands can trigger a signaling cascade leading to cytokine production and initiation of an adaptive immune response [20]. TLRs have been found on glial (astrocytes and microglia) and non-glial (spinal and DRG neurons) CNS cells [4,11]. The role of central and peripheral glial activation in the
J. Xu et al. / Neuroscience Letters 595 (2015) 30–34
Fig. 1. TLR4 mRNA expression (a), TNF-␣ (b) and IL-6 (c) concentration in SCI-noNP and SCI-NP subjects.
neuropathic pain may indicate TLRs involve in mediating spinal sensitization, initiated by peripheral nerve injury [16]. In fact, various studies support the importance of TLR signaling in neuropathic pain [5,13,21]. In particular, TLR4 has been implicated as playing a critical role in the development of neuropathic pain in animal models [5,28]. Recent study even indicated that spinal TLR4 and its downstream signaling molecules predicted the onset and severity of persistent neuropathic pain after spinal cord injury in rodents [7,27]. Although, it had been recognized that, TLR4 was involved in the pathophysiological process of NP in animal models, the contribution of this receptor and signaling intermediaries to neuropathic pain in SCI patients had not been explored to date. Thus, by undertaking a comprehensive analysis of TLR4 and downstream signaling cytokines from SCI-NP subjects and matched SCI-noNP controls, the purpose of current study was to assess the diagnostic values of TNF-␣ and IL-6 as protein biomarker for NP in SCI patients.
31
SCI, spinal cord injury; NP, neuropathic pain.
Ethics Committee of Second Affiliated Hospital of Harbin Medical University. 2.2. Collection of human peripheral blood mononuclear cells (HPBMC) 10 ml of peripheral venous blood was taken from every participant and collected in tubes coated with the anti-coagulant EDTA. As previously reported [6], HPBMC were isolated from buffy coats using Ficoll–Paque gradient centrifugation. Then the isolated cells were cultured in RPMI-1640 medium (containing 10% fetal bovine serum, 1000 U/ml penicillin and streptomycin). Total cell counts were performed with a Neurbauer haemocytometer and the number of viable cells present was assessed by trypan blue exclusion test. 1 × 106 cells/ml were usually obtained and cell viability was always >95%. 2.3. TLR4 expression by real-time PCR
2. Materials and methods 2.1. Subjects Patients aged >18 years with C2-T12 SCI (any level and any degree of completeness), of over 12 months’ duration were recruited from Second Affiliated Hospital of Harbin Medical University. Patients with SCI due to trauma were included. Exclusion criteria included the following conditions: acute illness of any etiology; patients with chronic renal, liver, lung or cardiac disease; diabetes and other metabolic, rheumatologic or infectious causes of painful neuropathy; the presence of other neurologic disorders, or pain that could confound the assessment of neuropathic pain associated with SCI. Women were excluded if they were pregnant or breastfeeding. Patients were informed to continue their therapies and medications without any changes for at least one week before study enrollment. Medications were continued because of the ethical concern that discontinuation would lead to severe problems. The inclusion criteria for NP included the presence of daily nonevoked and/or evoked pain. Specifically, central NP was diagnosed based on the 7-day pain intensity measured on the 0–10 numerical rating scale (NRS). NRSs have been used widely to assess pain and have shown high reliability and validity [12]. Participants were asked to rate how intense each of their pains was on average using an 11-pint NRS, with “0” indicating “no pain” and 10 indicating “the most intense pain imaginable”. Subjects with a mild pain intensity score of less than 4 rated on the NRS were not recruited. Accordingly, individuals were finally recruited and assigned to the SCI-noNP group and the SCI-NP group. The authors state that they have followed the principles outlined in the Declaration of Helsinki, and this study was approved by the
Total RNA was extracted from HPBMC with Trizol reagent (Life Tech, USA) according to the manufacturer’s instruction. The following PCR primers (Sangon Biotech, China) were used: TLR4 (forward: 5 - CCGCTTTCACTTCCTCTCAC -3 ; reverse: 5 - CATCCTGGCATCATCCTCAC - 3 ), the anticipated length was 182 bp; GAPDH (forward: 5 CACCCACTCCTCCACCTTTG -3 ; reverse: 5 - CCACCACCCTGTTGCTGTAG - 3 ), the anticipated length was 110 bp. Quantitative real-time PCR was conducted in triplicates with an ABI-Prism 7300 sequence detection system (Applied Biosystems, USA). PCR was performed at 95 ◦ C for 10 min, followed by 35 cycles at 95 ◦ C for 45 s, 60 ◦ C for 50 s and 72 ◦ C for 50 s; then 10 min at 72 ◦ C for extension. All reactions were performed in triplicate in a final volume of 10 L. Relative concentration of mRNA were calculated on the basis of threshold cycle values and corrected by GAPDH expression. 2.4. TNF-˛ and IL-6 levels by ELISA The peripheral venous blood was centrifuged at 5000 r/min for 10 min. Cell supernatants were used for measuring tumor necrosis factor-alpha (TNF-␣) and interleukin (IL)-6 by high sensitivity enzyme linked immunosorbent assay (ELISA) (R&D System, USA). TNF-␣ and IL-6 concentrations from each sample were quantified according to the manufacturer’s instruction. 2.5. Statistical analysis Data analysis was performed using SPSS 17.0 software (SPSS, USA). Data were expressed as mean ± SD for continuous variables, and as percentages for categorical variables. Receiver operating characteristics (ROC) curves were constructed to assess areas under curves (AUC), sensitivity and specificity. The optimum cutoff value
32
J. Xu et al. / Neuroscience Letters 595 (2015) 30–34
Fig. 2. ROC curve of TNF-␣ (a) and IL-6 (b) for SCI-NP patients versus SCI-noNP controls.
AUC: area under curve.
Table 1 Patient demographics and baseline characteristics.
n (male/female) Age (years, mean ± SD) Body mass index (kg/m2 , mean ± SD) Time since onset of SCI (years, mean ± SD) Time from onset of SCI to onset of neuropathic pain (month, mean ± SD) Pain intensity (mean ± SD)
SCI-noNP
SCI-NP
70(36/34) 38 ± 13 23.7 ± 6.4 6.9 ± 4.2 ND ND
70(38/32) 42 ± 10 24.6 ± 5.2 8.2 ± 5.6 10.8 ± 8.2 6.9 ± 3.2
SCI, spinal cord injury; NP, neuropathic pain; ND, no data; SD, standard deviation.
Table 2 Receiver operating characteristic (ROC) analysis of TNF-␣ and IL-6 for SCI-NP patients.
TNF-␣ IL-6
AUC
95% CI
Sensitivity (%)
Specificity (%)
Optimum cutoff
0.84 0.72
0.77–0.90 0.64–0.79
73.6 51.4
79.4 82.4
14.61 40.70
AUC, area under curve; CI, confidence interval.
was calculated by maximizing the sum of sensitivity and specificity and minimizing the overall error and the distance of the cutoff value to the top-left corner of ROC curve. Binary logistic regression analysis was used to calculate the odds ratios (OR) and 95% confidence interval (CI). p < 0.05 was considered statistically significant. 3. Results The clinical characteristics for both SCI patients with and without NP are shown in Table 1. A total of 140 subjects were recruited in current study, 70 of them showed chronic neuropathic pain, the rest participant did not have such symptoms. As revealed in Table 1, subjects from both SCI-NP group and SCI-noNP group were well matched in terms of age, gender, body mass index and duration of SCI. Symptoms commonly endorsed by NP patients were recorded and considered to be in the range of moderate or high, rated as >4 on 0–10 numeric scale. These symptoms included burning, aching, hot, stabbing, electrical, shooting, tingling, numbness, sensitive to touch, sensitive skin and increased pain due to cold temperature and touch. The mean interval between SCI onset and NP onset was
10.8 month in SCI-NP participants. Pain intensity was also rated in SCI-NP group according to NRS, and the average score was 6.9. TLR4 mRNA in peripheral blood mononuclear cells (HPBMC) were up-regulated in SCI-NP subjects compare with controls (p < 0.001, Fig. 1a). The concentrations of TNF-␣ (p < 0.001, Fig. 1b) and IL-6 (p < 0.001, Fig. 1c), two major downstream cytokines of TLR4 signal pathway [20], were also increased significantly in SCI-NP patients compare with SCI-noNP subjects. Since high concentration of TNF-␣ and IL-6 were related to the presence of NP in the SCI population, we performed receiver operating characteristic (ROC) curve analysis to verify the diagnostic value of these two cytokines (Table 2). The area under curves (AUCs) of TNF-␣ (Fig. 2a) and IL-6 (Fig. 2b) were 0.84 and 0.72, respectively. Based on the ROC analysis, the optimal cutoff values for TNF-␣ and IL-6 were 14.61 pg/ml and 40.70 pg/ml. The odds ratios (ORs) and 95% confidence intervals (CI) for both cytokines were calculated and shown in Table 3. After adjusting, OR for NP increased approximate 5-fold in patients with high TNF-␣ levels than those subjects with low levels; while IL-6 did not display strong association with the presence of NP.
Table 3 Odds ratios (OR) and 95% CI of NP in SCI subjects by TNF-␣ and IL-6.
TNF-␣ IL-6 a
OR(95% CI)
p
Adjusted OR(95% CI)a
p
10.76(4.89–23.65) 4.93(2.27–10.72)
Contents lists available at ScienceDirect
Neuroscience Letters journal homepage: www.elsevier.com/locate/neulet
Research article
Tumor necrosis factor-alpha is a potential diagnostic biomarker for chronic neuropathic pain after spinal cord injury Jun Xu a , Xiaoqiang E b , Huiyong Liu c , Feng Li a , Yanhui Cao b , Jun Tian a , Jinglong Yan a,∗ a
Department of Orthopedics, Second Affiliated Hospital of Harbin Medical University, Harbin, China Department of Orthopedics, First Affiliated Hospital of Harbin Medical University, Harbin, China c Department of Orthopedics, Chinese Medical Hospital in Hulan District, Harbin, China b
h i g h l i g h t s • • • •
Role of neuro-immune in neuropathic pain after spinal cord injury was evaluated. The levels of TLR4, TNF-␣ and IL-6 were upregulated in SCI-NP subjects. High TNF-␣ level was associated with high risk of NP in SCI patients. TNF-␣ could be a sensitive diagnostic biomarker for NP in SCI subjects.
a r t i c l e
i n f o
Article history: Received 16 March 2015 Received in revised form 2 April 2015 Accepted 2 April 2015 Available online 3 April 2015 Keywords: Spinal cord injury Neuropathic pain Tumor necrosis factor-alpha Toll-like receptor 4 Interleukin-6
a b s t r a c t Neuropathic pain (NP) is one of the most common complications after spinal cord injury (SCI), but no protein biomarkers has ever been introduced into clinical diagnosis. Previous studies implicated that toll-like receptor (TLR) 4 played a critical role in the development of NP in animal SCI models. Here, a total of 140 participants were recruited, 70 of them were SCI-NP subject and the rest 70 controls did not show neuropathic symptoms. TLR4 was upregulated significantly in SCI-NP patients compared with SCInoNP subjects. Furthermore, we measured the concentrations of tumor necrosis factor-alpha (TNF-␣) and interleukin-6 (IL-6), two TLR4 downstream pro-inflammatory cytokines, to assess their diagnostic values. Receiver operating characteristics (ROC) analysis revealed that TNF-␣ had great potential advantages to predict the progression of neuropathy, the risks of NP were strongly increased in SCI subjects with higher levels of TNF-␣ (odds ratio: 4.92; 95% confidence interval: 1.89–12.32). These results suggested neuroimmune activation contributed to the development of neuropathic disorder after SCI, and TNF-␣ could be a potential sensitive diagnostic biomarker for chronic neuropathic pain in SCI patients. © 2015 Published by Elsevier Ireland Ltd.
1. Introduction About 273,000 individuals are living with a spinal cord injury (SCI) in US, and many are disabled [1]. Chronic pain is a serious and frequent health problem for patients with SCI. Depending on the study population and the definition of pain, 26–96% of people with SCI experience pain and describe it as a problem [9,24]. Chronic neuropathic pain (NP), which results from a lesion or disease of the somatosensory nervous system related to the injury, increases the
∗ Corresponding author. Tel.: +86 45186296061; fax: +86 45186296061. E-mail address: [email protected] (J. Yan). http://dx.doi.org/10.1016/j.neulet.2015.04.004 0304-3940/© 2015 Published by Elsevier Ireland Ltd.
complexity of SCI management since NP is challenging to treat [25]. NP has a significant impact on the physical, emotional and cognitive functioning of subjects with SCI [10]. It is estimated that the mean expenditures were US $47,518 for each SCI patient with NP [18]. Therefore, it is vital for the SCI patients to control the risk factors of NP at the early stage. Toll-like receptors (TLRs), a protein family of 14 identified receptors, play a critical role in the innate immune system [20]. Interactions between TLRs and their ligands can trigger a signaling cascade leading to cytokine production and initiation of an adaptive immune response [20]. TLRs have been found on glial (astrocytes and microglia) and non-glial (spinal and DRG neurons) CNS cells [4,11]. The role of central and peripheral glial activation in the
J. Xu et al. / Neuroscience Letters 595 (2015) 30–34
Fig. 1. TLR4 mRNA expression (a), TNF-␣ (b) and IL-6 (c) concentration in SCI-noNP and SCI-NP subjects.
neuropathic pain may indicate TLRs involve in mediating spinal sensitization, initiated by peripheral nerve injury [16]. In fact, various studies support the importance of TLR signaling in neuropathic pain [5,13,21]. In particular, TLR4 has been implicated as playing a critical role in the development of neuropathic pain in animal models [5,28]. Recent study even indicated that spinal TLR4 and its downstream signaling molecules predicted the onset and severity of persistent neuropathic pain after spinal cord injury in rodents [7,27]. Although, it had been recognized that, TLR4 was involved in the pathophysiological process of NP in animal models, the contribution of this receptor and signaling intermediaries to neuropathic pain in SCI patients had not been explored to date. Thus, by undertaking a comprehensive analysis of TLR4 and downstream signaling cytokines from SCI-NP subjects and matched SCI-noNP controls, the purpose of current study was to assess the diagnostic values of TNF-␣ and IL-6 as protein biomarker for NP in SCI patients.
31
SCI, spinal cord injury; NP, neuropathic pain.
Ethics Committee of Second Affiliated Hospital of Harbin Medical University. 2.2. Collection of human peripheral blood mononuclear cells (HPBMC) 10 ml of peripheral venous blood was taken from every participant and collected in tubes coated with the anti-coagulant EDTA. As previously reported [6], HPBMC were isolated from buffy coats using Ficoll–Paque gradient centrifugation. Then the isolated cells were cultured in RPMI-1640 medium (containing 10% fetal bovine serum, 1000 U/ml penicillin and streptomycin). Total cell counts were performed with a Neurbauer haemocytometer and the number of viable cells present was assessed by trypan blue exclusion test. 1 × 106 cells/ml were usually obtained and cell viability was always >95%. 2.3. TLR4 expression by real-time PCR
2. Materials and methods 2.1. Subjects Patients aged >18 years with C2-T12 SCI (any level and any degree of completeness), of over 12 months’ duration were recruited from Second Affiliated Hospital of Harbin Medical University. Patients with SCI due to trauma were included. Exclusion criteria included the following conditions: acute illness of any etiology; patients with chronic renal, liver, lung or cardiac disease; diabetes and other metabolic, rheumatologic or infectious causes of painful neuropathy; the presence of other neurologic disorders, or pain that could confound the assessment of neuropathic pain associated with SCI. Women were excluded if they were pregnant or breastfeeding. Patients were informed to continue their therapies and medications without any changes for at least one week before study enrollment. Medications were continued because of the ethical concern that discontinuation would lead to severe problems. The inclusion criteria for NP included the presence of daily nonevoked and/or evoked pain. Specifically, central NP was diagnosed based on the 7-day pain intensity measured on the 0–10 numerical rating scale (NRS). NRSs have been used widely to assess pain and have shown high reliability and validity [12]. Participants were asked to rate how intense each of their pains was on average using an 11-pint NRS, with “0” indicating “no pain” and 10 indicating “the most intense pain imaginable”. Subjects with a mild pain intensity score of less than 4 rated on the NRS were not recruited. Accordingly, individuals were finally recruited and assigned to the SCI-noNP group and the SCI-NP group. The authors state that they have followed the principles outlined in the Declaration of Helsinki, and this study was approved by the
Total RNA was extracted from HPBMC with Trizol reagent (Life Tech, USA) according to the manufacturer’s instruction. The following PCR primers (Sangon Biotech, China) were used: TLR4 (forward: 5 - CCGCTTTCACTTCCTCTCAC -3 ; reverse: 5 - CATCCTGGCATCATCCTCAC - 3 ), the anticipated length was 182 bp; GAPDH (forward: 5 CACCCACTCCTCCACCTTTG -3 ; reverse: 5 - CCACCACCCTGTTGCTGTAG - 3 ), the anticipated length was 110 bp. Quantitative real-time PCR was conducted in triplicates with an ABI-Prism 7300 sequence detection system (Applied Biosystems, USA). PCR was performed at 95 ◦ C for 10 min, followed by 35 cycles at 95 ◦ C for 45 s, 60 ◦ C for 50 s and 72 ◦ C for 50 s; then 10 min at 72 ◦ C for extension. All reactions were performed in triplicate in a final volume of 10 L. Relative concentration of mRNA were calculated on the basis of threshold cycle values and corrected by GAPDH expression. 2.4. TNF-˛ and IL-6 levels by ELISA The peripheral venous blood was centrifuged at 5000 r/min for 10 min. Cell supernatants were used for measuring tumor necrosis factor-alpha (TNF-␣) and interleukin (IL)-6 by high sensitivity enzyme linked immunosorbent assay (ELISA) (R&D System, USA). TNF-␣ and IL-6 concentrations from each sample were quantified according to the manufacturer’s instruction. 2.5. Statistical analysis Data analysis was performed using SPSS 17.0 software (SPSS, USA). Data were expressed as mean ± SD for continuous variables, and as percentages for categorical variables. Receiver operating characteristics (ROC) curves were constructed to assess areas under curves (AUC), sensitivity and specificity. The optimum cutoff value
32
J. Xu et al. / Neuroscience Letters 595 (2015) 30–34
Fig. 2. ROC curve of TNF-␣ (a) and IL-6 (b) for SCI-NP patients versus SCI-noNP controls.
AUC: area under curve.
Table 1 Patient demographics and baseline characteristics.
n (male/female) Age (years, mean ± SD) Body mass index (kg/m2 , mean ± SD) Time since onset of SCI (years, mean ± SD) Time from onset of SCI to onset of neuropathic pain (month, mean ± SD) Pain intensity (mean ± SD)
SCI-noNP
SCI-NP
70(36/34) 38 ± 13 23.7 ± 6.4 6.9 ± 4.2 ND ND
70(38/32) 42 ± 10 24.6 ± 5.2 8.2 ± 5.6 10.8 ± 8.2 6.9 ± 3.2
SCI, spinal cord injury; NP, neuropathic pain; ND, no data; SD, standard deviation.
Table 2 Receiver operating characteristic (ROC) analysis of TNF-␣ and IL-6 for SCI-NP patients.
TNF-␣ IL-6
AUC
95% CI
Sensitivity (%)
Specificity (%)
Optimum cutoff
0.84 0.72
0.77–0.90 0.64–0.79
73.6 51.4
79.4 82.4
14.61 40.70
AUC, area under curve; CI, confidence interval.
was calculated by maximizing the sum of sensitivity and specificity and minimizing the overall error and the distance of the cutoff value to the top-left corner of ROC curve. Binary logistic regression analysis was used to calculate the odds ratios (OR) and 95% confidence interval (CI). p < 0.05 was considered statistically significant. 3. Results The clinical characteristics for both SCI patients with and without NP are shown in Table 1. A total of 140 subjects were recruited in current study, 70 of them showed chronic neuropathic pain, the rest participant did not have such symptoms. As revealed in Table 1, subjects from both SCI-NP group and SCI-noNP group were well matched in terms of age, gender, body mass index and duration of SCI. Symptoms commonly endorsed by NP patients were recorded and considered to be in the range of moderate or high, rated as >4 on 0–10 numeric scale. These symptoms included burning, aching, hot, stabbing, electrical, shooting, tingling, numbness, sensitive to touch, sensitive skin and increased pain due to cold temperature and touch. The mean interval between SCI onset and NP onset was
10.8 month in SCI-NP participants. Pain intensity was also rated in SCI-NP group according to NRS, and the average score was 6.9. TLR4 mRNA in peripheral blood mononuclear cells (HPBMC) were up-regulated in SCI-NP subjects compare with controls (p < 0.001, Fig. 1a). The concentrations of TNF-␣ (p < 0.001, Fig. 1b) and IL-6 (p < 0.001, Fig. 1c), two major downstream cytokines of TLR4 signal pathway [20], were also increased significantly in SCI-NP patients compare with SCI-noNP subjects. Since high concentration of TNF-␣ and IL-6 were related to the presence of NP in the SCI population, we performed receiver operating characteristic (ROC) curve analysis to verify the diagnostic value of these two cytokines (Table 2). The area under curves (AUCs) of TNF-␣ (Fig. 2a) and IL-6 (Fig. 2b) were 0.84 and 0.72, respectively. Based on the ROC analysis, the optimal cutoff values for TNF-␣ and IL-6 were 14.61 pg/ml and 40.70 pg/ml. The odds ratios (ORs) and 95% confidence intervals (CI) for both cytokines were calculated and shown in Table 3. After adjusting, OR for NP increased approximate 5-fold in patients with high TNF-␣ levels than those subjects with low levels; while IL-6 did not display strong association with the presence of NP.
Table 3 Odds ratios (OR) and 95% CI of NP in SCI subjects by TNF-␣ and IL-6.
TNF-␣ IL-6 a
OR(95% CI)
p
Adjusted OR(95% CI)a
p
10.76(4.89–23.65) 4.93(2.27–10.72)
