GENES, CHROMOSOMES & CANCER 1:194-208 (19W)

Two Distinct Mechanisms for the SCL Gene Activation in the t( I ;14) Translocation of T=CellLeukemias Olivier Bernard, Paul Guglielrni, Philippe Jonveaux, Dorra Cherif, Sylvia Girrelbrecht, Martine Mauchauffe, Roland Berger, Christian-Jacques Larsen, and Daniele Mathieu-Mahul

U30l INSERM and SDI I59541 CNRS, lnstitut de Genetique Moieculaire (O.B, P J , D.C., M.M., R.B., C.-J.L.,D.M M). U108 iNSERM HBpital St LOUIS (P.G ), and U I52 INSERM HBpital Cochin (S.G.), Paris, France Molecular study of a t ( I; 14)(p32;q I I ) translocation found in an acute T-cell leukemia (Kd cells) with a relatively mature phenotype is reported. Complex DNA rearrangements were characterized in the TCRaIG locus. Besides a productive Va/ja assembly found on the normal allele, two deletions within the JOL cluster were identified in the translocated allele. The translocation breakpoints involved the TCRS gene on chromosome I 4 and the SCL locus on chromosome band Ip32 that was recently shown t o be activated by the t( I ;14) translocation of the DU 528 leukemic cell line. Significantly, both Kd and D U 528 translocation breakpoints were located at the boundaries of D6 or JS segments and were clustered in a I0 kb genomic fragment of the SCL gene. The presence of recombination signal motifs (heptamer- 12/23 bp spacer-nonamer) on both normal chromosome partners, and N nucleotide addition on both derivative chromosomes involved the recombinase system in the translocation event. The SCL locus was highly expressed as a 5 kb transcript in Kd cells and, as already reported, as a 2 kb transcript in DU 528 cells. Importantly, a 5 kb SCL transcript was also detected in immature nonlymphoid hematopoietic cells but not in normal mature T cells, suggesting that it might correspond to the normal SCL transcript. Taken together, our data support the notion that the involvement of the SCL gene in the leukemogenic process may occur through overexpression of an apparently normal transcript (Kd cells) or expression of a truncated RNA (DU 528 cells).

INTRODUCTION

I t is now widely established that nonrandom chromosome aberrations such as translocations or inversions (Trent et al., 1989) constitute an important mechanism to activate or deregulate certain cellular genes that are assumed to play a role in oncogenic processes. In lymphoid tumors, chromosome abnormalities have been shown to be often associated with the rearranging genes normally producing immunoglobulins or T-cell antigen receptors. In B-cell neoplasia, the central model is that of Burkitt lymphoma in which the MYC protooncogene is activated by translocations affecting invariably the band 8q24 where this gene is located and the immunoglobulin loci on chromosomes 14, 2, and 22 (Klein and Klein, 1985). Recently, it has been found that some t(2;8) and t(8;22) variant translocations that occur downstream of MYC lie within or close to a new transcriptional unit designated PVT (Shtilvelman et al., 1989). Another documented model of B-cell neoplasia is human follicular lymphoma in which t( 14;18)(q34;q21) translocations place the BCLZ gene in the close vicinity of the heavy chain of immunoglobulin gene, resulting in the constitutive expression of a truncated D I990 WILEY-LISS. INC.

transcript with a conserved coding capacity (Cleary et al., 1986; Seto et al., 1988). Recombinase enzyme system that normally carries out the assembly of separate variable (V), diversity (D), and joining (J) segments has been involved in the generation of some chromosomal abnormalities of B-cell tumors. It has been proposed that some of these illegitimate recombinations map have occurred via signallike sequences (heptamer-nonamer) situated on the donor partners (Haluska et al., 1986; Tsujimoto et al., 1988). However, in some cases, other mechanisms than recombinase-mediated sequence recognition are required to explain the origin of the translocation (Cleary et al., 1986). In T-cell neoplasia (for a review, see Rabbitts et al., 1988), recurring abnormalities involve the chromosomal band 1 4 q l l where the T-cell receptor (TCR) a- and &-chain genes have been mapped (Caccia et al., 1985; Croce e t al., 1985; Rabbitts et al., 1985; Chien et al., 1987) and the bands 7q35 and 7p15 that, respectively, contain the P-chain

Received August 9, 1989: accepted August 28, 1989. Address reprint requests to Daniele Marhieu-Mahul, U301 INSEKM and SDI 159541 CNRS, Instirur de Genetique Moleculaire, 27 rue Juliette Dodu, 75010 Paris, France.

SCL GENE ACTIVATION IN T-CELL LEUKEMIAS

and the y-chain of TCR genes (Isobe et al., 1985; Murre et al., 1985). Molecular analysis of several T-cell leukemias with translocations t( 14; 14) (Russo et al., 1989), t(8; 14) (Mathieu-Mahul et al., 1985; Finger et al., 1986) and inversion of chromosome 14 (Baer et al., 1985) have led to the conclusion that these chromosomal aberrations occurred during TCR gene somatic rearrangments. Most of the breakpoints have been located within the Ja region and more rarely in the V a region (Bernard et al., 1988). More recently, t(l1; 14) translocations were reported to involve the TCRS gene (Erikson et al., 1985; Boehm et al., 1988a; Harvey et al., 1989; McGuire et al., 1989). A similar situation exists for translocations t(7;9), t(7; 14), and t(7; 19), as breakpoints have been localized in the Jp region (Cleary et al., 1988). By analogy with the B-cell tumor models, genes located at the sites of recurrent translocations of T-cell malignancies are likely to participate in the leukemogenic process. Besides MYC, which is implicated in T-ALL with a t(8; 14) translocation, three genes, whose oncogenic potential remains to be determined, have been characterized: LYLl on band 1 9 ~ 1 (Cleary 3 et al., 1988; Mellentin et al., 1989), TCL3 on band 9q34.3 (Reynolds et al., 1987), and Ttgl on band llp15 (McGuire et al., 1989). For other DNA sequences, TCLl on band 14q32.1 (Russo et al., 1989), TCL2 on band llp13 (Boehm et al., 1988a,b; Harvey et al., 1989), and TCL3 on band 10q24 (Kagan et al., 1987, 1989), there is no indication, at the moment, that they are parts of genes as no transcriptional data have been reported. In any case, the nomenclature for these potential genes is confusing and should be rapidly clarified. A rare translocation t(1; 14)(p32;qll) was recently described in an acute T-cell leukemia (Hershfield et al., 1984). T h e DU 528 cell line, which was derived from leukemic cells of this patient, also presented the translocation (Kurtzberg et al., 1985). We recently reported a similar translocation t(1;14)(p32;qll) in the leukemic cells of a young patient with an acute T-cell leukemia (Mathieu-Mahul et al., 1985). We have now identified the translocation sites for this chromosomal abnormality. In both cases, the breakpoints were localized in the TCRS rearranging segments on band 14qll and within the SCL gene located on band lp32 (Begley et al., 1989). Our data clearly indicate that the aberration occurred during an abortive attempt to rearrange the TCRS gene and resulted in the activation of the SCL locus that is silent in normal T cells.

I 95

MATERIALS AND METHODS Cells and Cell Lines

Kd leukemic cells were obtained from a blood sample of a young male with a T-ALL (Ll), whose case (CG4703) has been reported elsewhere (Mathieu-Mahul et a]., 1986). DU 528 cell line, provided by Drs. Kurtzberg and Hershfield, was derived from a primary leukemia with clinical and immunophenotypic features of an early T-cell precursor acute lymphoblastic leukemia (Kurtzberg et al., 1985). Other human cells and cell lines used for Northern blot analysis included the following: K562, HEL, HL60, and U937 nonlymphoid leukemic cell lines, CEM and KE37 leukemic T-cell lines, Raji Burkitt’s lymphoma cell line, cwp and yS normal T-cell clones isolated from PBL allogenic stimulation described elsewhere (Dastot et al., in preparation). Southern and Northern Blot Analysis

High-molecular-weight DNA was extracted from fresh leukemic cells or from cell line according to standard methods. Genomic DNAs (15 pg) were digested to completion with restriction enzymes under manufacturer’s conditions, size fractionated in 0.7% agarose gel, and transferred to nylon membranes (CompassTM, Genofit). For the isolation of total RNA, cell pellets were disrupted in the presence of guanidine thiocyanate by “ultrason” homogenization. Total RNA was collected as a pellet after CsCl gradient centrifugation. PoIy(A) RNA was selected by oligo(dT)-cellulose chromatography. Samples consisting of 20 pg total RNA or 2 pg poly(A) RNA were denatured in formamide, electrophoresed in 1% agarose gel, and transferred to nitrocellulose membranes. Blots were hybridized to appropriate probes labeled by random priming method and washed under stringent conditions as described (Bernard et al., 1988). Isolation and Analysis of Clones

A Recombinant clones were isolated from genomic libraries made in XL47-1 or E M B L - 3 (Promega) vectors, using Sau3A partially digested DNA and size fractionated on a sucrose gradient. Libraries were prepared from Kd leukemic cells and the MCR5 fibroblast cell line, which was considered as the germline control for this study. Restriction maps were prepared by single and double digests of ADNA, and fragments of interest were subcloned in pGEM plasmid and phage M13 vectors. Nucleotide sequencing was conducted in M13 vectors using the dideoxy chain termination method with modified T 7 polymerase (Sequenase;

I 96

BERNARD ET AL.

USB). All sequences were compared, aligned, and analyzed using automatic computing procedure (B.I.S.A.N.C.E, CITI 2 , Paris). PCR Amplification

PCR was performed according to Saiki et al. (1988). Briefly, 1 pg of DU 528 genomic DNA was incubated in a 100 pl reaction mixture with 0.25 pg of each synthetic primer (oli-36E-5':TGAGACTTGCCTTCCTAAGCC and JS 1:ACACGGGTTCCTTTTCCAAAG) or (oli-36E-3':GCAAACAGACATCTTACAGC and DS2:AGCATTGGTGAAAGGAGTTC); 200 nM each dATP, dCTP, dGTP, and dTTP; 10 nM MgCl,; 50 mM KCl; gelatine 0.01%; DMSO 10%. Denaturation was undertaken at 92" for 7 min in the first cycle and for 2 min in subsequent cycles. Annealing and extension steps were performed for 2 min at 50" and 72" respectively. Two and one-half units of Taq polymerase (Cetus Corp., CA) were added prior to amplification. Amplification products were analyzed in 1% agarose gel and directly subcloned in M13 phage vectors for sequencing. RESULTS

T h e karyotype of Kd leukemic cells recovered from a patient with acute T-cell leukemia showed a t(1;14)(p32;qll) translocation (Mathieu-Mahul et al., 1986). T h e monoclonality of these cells was attested by rearrangement patterns of TCRP and TCRy genes (data not shown). Moreover, immunophenotype studies revealed the expression of CD7, CD5, CD4, CD8, and CD3 antigens at the cell surface, confirming their T-cell .nature. Since the lp32 region has been shown to contain several proto-oncogenes (MYCL, LCK, JUN), the possibility that the translocation might affect one of these loci was tested using specific probes in Southern and Northern blot analysis. Neither genomic rearrangements nor abnormal expression of these genes was detected. Three Rearrangements Are Observed in the TCRdfi Locus of Kd Cell DNA

Molecular analysis of the TCRaIS locus is complicated by the presence of about 100 Ja segments that encompass more than 75 kb (Baer et al., 1988). Furthermore, the TCR-S gene is entirely inserted between the J a and Va clusters (Chien et al., 1987; Boehm et al., 1988; Hockett et al., 1988; Isobe et al., 1988; Satyanarayana et al., 1988; Takihara et al., 1988). As a consequence, the loop-excision mechanism that is normally used for Va-Ja assem-

bly results in the deletion of D, J, and CG segments. T o examine the genomic structure of the 14qll region in Kd cell DNA, we performed Southern blot analysis with TCR-alG-derived genomic probes covering the 100 kb region upstream of the C a region. T h e isolation of TCR-6 probes from a polymorphonuclear cell genomic library was described previously (Guglielmi et al., 1988). Most of the TCRa probes have been derived from multiple overlapping genomic clones of a human DNA fibroblast library (MRC5 cell line). Three different rearrangements were detected, whose locations are indicated on the map on top of Figure 1 and are presented in Figure 1B. A JSl genomic probe (1.7 kb Xba I fragment) revealed two EcoRI bands in human fibroblast MRC5 DNA: a major one (6.5 kb) containing the JSl segment and a fainter one (5.5 kb) corresponding to a segment located 3' to JSl. In Kd cell DNA EcoRI digests, no 6.5 kb germline fragment was detected and the lower intensity of the 5.5 kb band indicated the presence of a unique copy of the sequences located 3' to JSl. In addition, a 2.5 kb rearranged band was observed. T h e same probe detected a 19 kb BamHI germline fragment in MRC5 cell DNA, and only a rearranged 12 kb band in Kd cell DNA. These data indicated that JSl was deleted on one allele and rearranged on the other. Only one copy of CS sequences was present in Kd cell DNA (data not shown). T h e Ja-M27C probe located at 60 kb from C a (see top of Fig. 1) recognized two EcoRI fragments in MRC5 cell DNA, due to the existence of a polymorphic EcoRI site as described (Baer et al., 1988a) and a unique 3.0 kb BamHI fragment. In Kd cell DNA, this probe did not detect any germline fragment but unique rearranged bands of 5.5 kb for BcoRI and 18 kb for BamHI. Therefore, the Ja-M27C sequences were deleted on one allele and rearranged on the other one. T h e Ja-M16D probe derived from the J a region located at 45 kb from Ca detected a unique 5.5 kb EcoRI fragment and a 3.0 kb BamHI fragment in germline DNA. On the other hand, two bands were observed in Kd DNA digested by the same restriction enzymes: one corresponding to the germline band and a rearranged one (4.4 kb for EcoRI and 8 kb for BamHI). These observations showed that these sequences were in germline configuration on one allele and rearranged on the other one. Since TCRS is deleted on one allele, we expected this allele to have undergone a Va to Ja

SCL GENE ACTIVATION IN T-CELL LEUKEMIAS

I97

Figure I. Rearrangements of the JCRa/G-chain locus in Kd cells. Top: Schematic organization of the germline JCRaIG- chain locus and locations of the probes that detected the rearrangements in Kd cell DNA. Bottom: Southern blot analysis of leukemic Kd cell D N A (lanes L) and MRC5 fibroblast D N A (lanes F) digested by €c&l (E) or BamHl (B), were hybridized with the 161 probe ( I .7kb Xbal fragment), with the JaM27C probe ( I .7 kb Xbal-€c&I fragment), and with the JaM I 6 0 probe (3.5 kb Hindill fragment). Germline fragments are indicated by arrows. Rearranged fragments are indicated by triangles. *8 kb EcoRl fragment is a polymorphic site as described (Baer et al., 1988).

rearrangement. T h e rearrangement detected by the Ja-M16D probe was consistent with such a Va-Ja joint as only one copy of Ja/Ssequences was detected by probes located upstream of Ja-M16D. It follows that the two other rearrangements, detected by probes JSl and Ja-27C, should have occurred on the same allele. One of those rearrangements should correspond to the chromosomal translocation junction. In order to identify those rearrangements, a Kd leukemic DNA library was therefore screened with the three probes above described. Detection of a Productive VdJcu Assembly With Jcu-M16D Probe

A recombinant phage clone (AKd6) was isolated with Ja-M16D probe. Comparison of its restriction map with that of the XMR16 germline clone (isolated from the MRC5 genomic library) allowed the location of the recombination site to the 5' end of XKd6 (see top of Fig. 2). Therefore, a 1.4 kb Hind111 fragment (designated Kd6B) was subcloned and sequenced. T h e protein sequence deduced from nucleotide sequence analysis (see Fig. 2, bottom) revealed that the rearrangement in XKd6 represented a V-J join: the V a segment (bases 7-662) was identified as Va7-1 gene segment according to the nomenclature of Yoshikai et

al. (1986). Nucleotides 678-728 are clearly homologous to the J a sequence of a TCR-acDNA clone described previously (clone AC17, Klein et al., 1987). Moreover, the addition of 15 N nucleotides (noted as N residues from 663 to 677) by the terminal deoxynucleotide transferase during the assembly process had maintained the reading frame in phase through the recombination site. Taken as a whole, these observations indicate that the Jcx-Ml6D rearrangement resulted in a productive V/J assembly. This result is consistent with the detection of a mature TCRa mRNA (1.5 kb) in Kd cell cytoplasm (data not shown) and of CD3 antigen, which is normally associated with functional TCR,at the surface of Kd cells. Complex JaRearrangements Detected by Jcu-MZ7C Probe

A recombinant clone (XKd86) was isolated from the Kd DNA library screened with the probe Ja-M27C and compared with germline clones isolated from MRCS genomic library (Fig. 3A). A 1.2 kb HindIII-EcoRI fragment from the clone hKd86 (noted as 86A) contained the recombined sequences. T h e examination of the restriction map of XKd86 upstream of the recombination point showed that this region was homologous to an upstream J a portion, the rearrangement being con-

I 98

BERNARD ET AL.

I

I

H H

I

I

I

H

H

H

r

1

57

c t g c a g A T G TGG GGA GCT T T C C T T C T C T A T G T T TCC ATG AAG ATG GGA G g t a r g t c t M e t T r p G l y A l a P h e Leu Leu T y r V a l S e r M e t L y s M e t G l y

caatctaatagtrratgctgctaggaattttcaaaacratttcctttcagctaaattattgcaaattttgac

129

atttgtaatgagagtatttcctgaatatgcattttcctaacgtggtgctaattgtcctcct9ttactattgc

"0 1

273

345

t g g g g g t g c t t g c c t a g t a a c a a t c a c t g t a t c t t g t c a t a GGC ACT GCA GGA CAA AGC C T T G l y T h r A l a G l y G l n Set- Leu

407

GAG CAG CCC T C T GAA G I G ACA GCT GTG G A A GGA GCC A T T GTC L A G A T A AAC TGC G l u G l n Fro S e r G l u V a l T h r A l a V a l G l u G l y A l a I l e V a l G l n I l e A s n C y s

46 1

ACG T A C CAG ACA T C T GGG T T T T A T GGG C T G T C C TGG TAC CRG CAA CAT GAT GGC T h r T y r G l n T h r S e r G l y F h e T y r G l y Leu S e r T r p T y r G l n G l n His A 5 p G l y

5 1F

GGC AGA CCC ACA T T T C T T T C T TAC A A T GCT C T G GAT GGT T T G GAG GAG ACA GGT G l y A r g F r o T h r F h e Leu S e r T y r A s n A l a Leu Asp G l y Leu G l u G l u T h r G l y

ce4

CGT T T T T C T T C A T T C C T T AGT CGC T C T GAT AGT T A T GGT TAC C T C C T T C T A L A G Fhe S e r S e r Fhe Leu S e r A r g S e r A s p S e r T y r G l y T y r Leu Leu Leu G l n

623

arg

N reriduer GAG C T C C A G A T G CIAA GAC T C T GCC T C T T A C T T C TGC GCTI'GGA GCC GCC GGC AA/; G l u Leu G l n M e t L y s A s p S e r Ala S e r T y r Fhe C y s A l a G l y A l a Ala G l y A s n

Jff

677

4

GCA GGC A A C A T G C T C ACC T T T GGA GGG GGA ACA AGG T T A A T G GTC A R A CCC c g t g A l a G I y A s n M e t Leu T h r Fhe G1 y G I y G1 y T h r A r g Leu M e t V a l L y s F r o

73,

a ~ t a t c t c t ~ c t ~ a a t c c a t a a t 9 a a t g c t c t a a t t t c a a a a 9 9 a a g c c g t a 9 c a c t g a g c t c t g t t t t c tegI:)4 Figure 2. Productive genomic Va-Ja rearrangement in Kd cell DNA. Top: Restriction map of bKd6 recombinant phage isolated from Kd cell DNA library screened with the M 16D probe (3.3 kb Hindlll fragment). It is compared to the germline counterpart of the Jaregion deduced from a recombinant phage isolated from MRCS D N A library. The position of the divergence of GL and bKd6 maps is indicated by a vertical dotted line. Restriction enzyme abbreviations: B = BamHI; E = EcORI; H = Hindlll. Bottom: Nucleotide sequence of region of joining Va-]a contained in the Kd6B fragment. The V a segment encoded by bases 7-47 (leader sequence) and 386-662 corresponds t o Va7-I (Yoshikai et al., 1986). The ]asegment encoded by bases 76&728 corresponds co the AC I 7 clone Jasegment (see Klein et al., 1987). Fifteen N nucleotides are found at the junction point (663-677).

SCL GENE ACTIVATION IN T-CELL LEUKEMIAS

tained in a 0.9 kb Pstl fragment (noted as 45C). Therefore, this rearrangement internal to the J a cluster led to the complete deletion of a 9 kb DNA fragment between the two segments Ja-27C and Ja-45C. In order to understand this rearrangement, we analyzed the nucleotide sequence of the rearranged fragment (86A) and its germline counterparts (45C and 27C). As shown on Figure 3B, the rearrangement involved a J a segment that is preceded by the consensus recombination signal (nonamer-1 Znucleotide spacer-heptamer) on the germline fragment (27C). This J a segment corresponds to JaU according to Yoshikai et al. (1985). As expected, the nucleotides preceding the JaU segment on the rearranged Kd86 clone do not code for any V a gene segment or for any J a segment. A perfect isolated heptamer, identical to the heptamer flanking the 5' side of the JaU segment (CACAGTG) is found downstream of the recombination site on germline 45C fragment. N nucleotides have been added a t the junction point. Further analysis of the 5' region of XKd86 clone revealed another divergence compared to the germline configuration as judged by the smaller size of Kd86H fragment (compared to the germline 45B fragment) and the existence of an additional EcoRI site in the same genomic segment (Fig. 3A). Nucleotide sequence analysis of rearranged and germline fragments (see Fig. 3C) showed that the rearrangement occurred just 3' to the recombination consensus signal of an undescribed J a segment, easily identified by the conserved amino acids Phe-Gly-X-Gly-Thr. Moreover, N nucleotide addition at the joining point created the additional EcoRI site contained in 86H fragment. An isolated heptamer (TGTGCAC, indicated by a double line on Fig. 3C) lies 190 bp downstream of the Ja-45B segment and is in the opposite orientation with respect to the heptamer flanking the 5' side of the J a segment (CACAGTG). T h e recombination led to the deletion of the 190 bp intervening sequences containing the coding Ja segment. These observations indicate that both of the deletions within the J a cluster have been generated by similar recombination events mediated solely by heptamers: one flanking a Ja segment and an isolated heptamer located upstream (in the same orientation) or downstream of the J a segment (in the opposite orientation). Chromosomal Translocation t( I ;14) Junction Is Located in the JS Region

In order to isolate the third rearrangement from

I99

the 1 4 q l l locus, the Kd genomic library was screened with the probe JSl. As Kd cell DNA did not contain any germline JSl region, any clone detected by the probe will contain the rearranged JSl sequences. A unique recombinant phage (AKd 62) was studied whose restriction map was compared to that of the JSl germline region (Fig. 4). This allowed us to map the recombination point into a 2.5 kb EcoRI fragment as indicated by an arrow. This fragment, completely devoid of any repetitive sequences, was thereafter used as a probe to isolate the normal counterpart of the sequences juxtaposed 5' to the JSl gene segment (XKdl03 recombinant phage, Fig. 4). A 1.8 kb EcoRI fragment (named Kdl03C on top of Fig. 5), used as a probe in Southern blot hybridization, detected a unique 5 kb BamHI band in germline DNA and two 5 and 12 kb BamHI bands in Kd cell DNA (data not shown). T h e 12 kb fragment corresponds to the rearranged band that was detected by the probe JSl (see Fig. 1). These observations confirmed that the Kd 103C fragment contained the rearrangement point. Since we had already identified rearrangements on both alleles within the J a locus of Kd cells, this rearrangement detected by both JSl and Kdl03C probes was likely to correspond to the chromosomal translocation junction. T h e chromosomal origin of the XKD103 sequences was therefore investigated by in situ hybridization of metaphase normal chromosomes using the Kdl03C biotinylated probe: a signal was observed on both chromatids in 51% metaphases on chromosome 1 at lp32 (details of this experiment have been published elsewhere, Cherif e t al., 1989). We concluded that the XKD103 clone contained sequences derived from the lp32 chromosomal region. Taken together, these observations demonstrated that clone AKd62 represents the junction of the t( 1; 14)(p32;qll) translocation. On chromosome 14, the site of breakage occurred within TCRS, which is located 100 kb upstream of Ca. Since t h e orientation of TCRaIS locus is centromere-VaIS-TCRS-Ja-Ca-telomere (Baer et al., 1985; Chien et al., 1987), the XKd62 clone must come from the l p + chromosome (i.e., the chromosome l p + containing the translocated long arm of chromosome 14). Isolation of the Reciprocal TranslocationJunction

As mentioned above, the probe Kdl03C detected two BamHI bands in Kd cell DNA a 5 kb corresponding to the germline chromosome 1 sequences and a 12 kb containing the I p s chromo-

BERNARD E T AL.

kb u p s t r e a m of

c,

45G

m

7

S

B S E;B

\

H'MX

I

I I ,

I

H

\ \

~ HX 9kbdeletion

\\

\

\

/

\

\ \

I

\ \

\

/

\

\

\

\ \

\

\

\

&,E sS i\,E

KD86

lkb

I

/

\

\

XJH

/ I 1 27G

\

0.2kb deletion

I

Yi I

J

H ~ H \

E

BrS' S E

S

I

GL

55

i

-

458

E y

60

65

70

I

I

/

/

/

\"//E

-

E c I

,I

HHX H H H H . I

/

X IH

86A

86H

/

\ 7

Ja45C

GTTATTTCTGThGAGTTTATTA/TTATArBCA(;TGTTCTTGAAGTAATAGAGRAGTGCATTAGARGCTCCTGCTCCTGC~TGG~TGAAATGT

. .. .. .. .. .. .. ......................... .. .. Kd86A

GTTATTTCTGTAGAGTTTATTMCCAATICA/MCACCGGTAACChGTTCTATTTTGGGACAGGGACAAGTTTTGACGGTCATTCCAG~~

Ja27A

T r

. .. .. .. .. .. .. .. .. ........................................................ . . . . . . . . . . . .. .. .. .. .. .. .. .. .. .. . TGAGCTTCCTAT~G/AACACCGGTARCCAGTTCTATTTTGGGACAGGGACRAGTTTGACGGTCATTCCAG~~TAA

9

7 AsnThrGlyAsnGln?heTyr?heGlyThrGlyTh~SerLeuThrValllePro

,-Ja7 ?heLySLySPrOValAla 9 AAAGCCCCTCAGWTTTAAGAAACCAGTGGCC Ja-M45B AAGCTGATGCCACA.. .. .. .. .. .. .. .. .. .. .. .. .. .. ..................................... .. .. .. .. .. .. .. .. .. . Kd 8 6 H

RAGCTGATGCCACAGGTTTTTGChAAGCCCCTCAGCACAGT~GG~TTC~--------

SerArgLeuThrPheGlyGluGlyThrGlnLeuThrValAsnPro

Ja-M45B TCTAGGTTGACCTTTGGGGARGGAACACAGCTCACAGTGAATCCTG~~AAGTGGAGGGGA

Ja-M45B G C A T T G A A T C C T C T G C C T G A T G T A T C C A T T T T A T G C C A A T T G A G A T A T G G C T T C T

Ja-M45B T G T G C A G T G G G A T G C A G C T T T T T C T k A C C T C T C T C A C ~ T C A C G C A A C C C C T T C A C C ~

.. .. .. .. ....... .. .. .. .. .. .. .. ..... .. .. .. .. .. .. .. ....... .. .. .. .. .. .. .. ..... .. .. .. .. .. .. .. ....... .. .. .. .. .. .. .. ...

kd 8 6 H

TGTGChGTGGGATGCAGCTTTTTCTAACCTCTCAC~ATCACGC~CCCCTTCACC~~~

201

SCL GENE ACTIVATION IN T-CELL LEUKEMIAS

J 61

1

Kd103

GL E

14q-

GL

B

I

Ikb

B

g B

B B

B

Kd4

D62

soma1junction. We did not observe any additional band that might be attributed to the reciprocal chromosomal junction in the 14q - chromosome. T h e fragment N32-11B immediately flanking the Kdl03C fragment (see Fig. 5 ) was also able to recognize two BamHI fragments in Kd cell DNA: the germline 5 kb fragment and a 2.8 kb fragment that could be issued from the chromosome 14q - (data not shown). This suggested that part of the sequences located immediately downstream of the breakpoint had been deleted. T o confirm this point, we screened the Kd genomic library with the probe N32-llB and a recombinant clone XKd4, presumed to correspond to the 14q - chromosome, was isolated. Restriction map analysis of XKd4 clone (shown in Fig. 4) and Southern blot analysis enabled us to locate the

translocation junction on chromosome 14q - (indicated by a black arrow); the data confirmed the loss of about 1 kb encompassing the 3’ EcoRI site of Kdl03C, downstream of the breakpoint on chromosome 1. Moreover, the restriction map of the 5’ region of XKd4 did not correspond to the region immediately 5’ to JSl gene segment, but actually to the germline region preceding the DS2 segment, thus indicating a deletion of 10 kb from chromosome 14. Taken together, these results confirmed that clone XKd4 contains sequences that originated from the chromosome 14q - . Nucleotide Sequence Analysis of Both TranslocationJunctions

An insight into the mechanism of translocation

Figure 3. ja deletions found in Kd cell DNA. A Comparative restriction maps of the clone AKD86 isolated from Kd genomic library screened with the M27C probe (I.7 XM-EcoRI fragment) and the germline Jaregion (deduced from t w o clones derived from MRCS genomic library). Two internal Jadeletions are carried by the clone AKD86 (indicated by dotted lines) and are contained in the 0.6 kb Hindlll fragment (86H) and the I.5 kb Hidlll-EcoRI fragment (86A). Restriction enzyme abbreviations: B = BamHI; E = EcoRI; H = Hindlll; S = Sad. 8: Nucleotide and derived protein sequences of the rearranged Kd 86A fragment and its germline counterparts 45C (a 0.9 kb Pstl fragment) and 27C ( I .7 kb Xbal fragment). An isolated perfect heptamer identical to the heptamer flanking the 5’ side of the ]a segment of M27C is underlined in the 45C germline fragment. C: Nucleotide and derived protein sequences of the rearranged Kd 86H fragment and its germline counterpart 458 (0.8 kb Hidlll fragment). N nucleotides indicated by an open box are found at the junction point. A perfect isolated heptamer is underlined in the 3’ region of 45C fragment.

202

BERNARD ET AL.

Pi

E

B E I

I

X

DU 528

Kd I

I

-

SBSS B I I UI XH H X

103 C

N 32 11B

BB I I

S I

I

I

X H

SB B I

l

l

-

X

36C-

36E

deletion of 10 kb between these two gene segments from the TCRS gene. Examination of the sequences of chromosomes 14 and 1 in germline configuration identifies some features that probably influenced the translocation process. On chromosome 14, consensus recombination signals (i.e., heptamer and nonamer sequences separated by 12 or 23 base pairs) are normally found immediately 5’ to the JSl segment and on both sides of the DS2 segment as previously reported; on the 3’ germline region of chromosome 1, potential heptamer-like and nonamer-like sequences separated by 23 bp (underlined at the bottom of the Fig. 6) were found a t the translocation junction. On the chromosome 14q - , both heptamers from the DS2 segment and from chromosome 1 were found in a head-to-head orientation with three additional nucleotides at the joining point. Similarly, a stretch of 16 nucleotides that could not be attributed either to chromosome 1 or to the D or J region on chromosome 14, were located at the recombination point of the derivative chromosome lq . In both cases, the presence of these extranucleotides is consistent with an N-region addition by terminal deoxynucleotide transferase. All these observations strongly suggest that the translocation resulted from an error of the recombinase involved in somatic recombinations of differentiating lymphocytes.

+

Figure 5. The translocation t(1;14) in DU 528 leukemic cells. Top: Restriction map of the normal chromosome region Ip32 deduced from overlapping clones isolated in the MCRS genomic library. Arrows mark the position of the translocation breakpoints in both leukemic cells. Black boxes indicate the fragments that were used as probes as written in the text: 103C = 1.9 kb EcoRl fragment; N32 I IB = 2.2 kb EcoRIHindlll fragment; 36C = 0.7 kb Sad-BarnHI fragment; 36E = 0.8 kb BamHl fragment. Restriction enzyme abbreviations: B = BamHI; E = EcoRI; H = Hindlll; S = Sad; X = X6al. B* is a polymorphic site as described elsewhere (Bernard et al., 1989). Bottom: Southern blots of fibroblast D N A (F) or DU 528 cell DNA (Du) digested with EcoRl (E) or BamHl (B) and hybridized with Jfjl probe or N36E. Germline fragments are indicated by arrows. Rearranged fragments are indicated by triangles.

can be obtained by analysis of sequences at the various chromosomal junctions. Because of the deletion on both chromosomes, we compared nucleotide sequences of the translocation junction from the derivative chromosome l p + with the 5’ region of germline chromosome 1 and with the 3‘ region of chromosome 14 (Fig. 6). Similarly, the breakpoint region of chromosome 14q- was compared to the 5‘ region of chromosome 14 and to the 3’ region of chromosome 1 (Fig. 6). T h e sites of breakage on chromosome 14 were precisely mapped: 5’ to the DS2 gene segment and in the 5’ portion of the segment JSl, thus confirming the

Translocation t( I ;14) From the DU 528 Cell Line Involves the Same Genomic Regions: Isolation of Both Breakpoint Regions

A translocation t( 1; 14), cytogenetically similar to the one present in Kd leukemic cells has been already described in an immature T-cell leukemia (Hershfield et al., 1984) from which the cell line DU 528 has been established (Kurtzberg et al., 1985). In order to see whether the same genomic regions are involved in both translocations, we performed Southern blots on DU 528 cell DNA, with several fragments derived from chromosomal lp32 region and from TCRS gene. A 0.8 kb BamHI fragment (N36E) that is located 11 kb from the site of the breakage on Kd chromosome 1 (see top of Fig. 5) was potentially interesting as it detected in DU 528 cell DNA (Fig. 5, bottom), in addition to germline fragments (indicated by arrows), rearranged fragments (indicated by triangles); two additional fragments were observed in EcoRI (14 and 9 kb)- and BamHI (10 and 2 kb)-digested DU 528 cell DNA. T h e probe JSl did not reveal any germline frag-

203

SCL GENE ACTIVATION IN T-CELL LEUKEMIAS

V

1 (5’)

CGGACACAGAGACTTGGTCATAAGGCARACATT/AACCCCCAGCGAACACG~CATTMGCCCCCGCG~CACCGGG~TGGAT~ATTCCCTCTTCTT

IPt

CGGAULCAGAGACTTGGTCATAAGGCAAACATT/GGGTGGCGGAT~CGG/T~CTCATCTTTGG~~GG~CCCGTGTG~CTGTGG~CC~~A

14 ( 3 ‘ )

GGGCAGCAGCGCTGA~~CGTCCTCAAGTGCCTCATCTTTGGAAAAGGAACCCGTGTGAACTGTGTGG~CC~~

9 - ? - - - - A

12

14 ( 5 ’ )

JSI

12

v-

D62

23

GAGGGTTTTTATACTGATGTGTTTCATTGTG / C C T T C C T A C C A C A C A G G T T G G A G T G C A T T A A G C C C T T T G T V C 9 7 7 9

14q-

GAGGGTTTTTATACTGATGTGTTTCATTGTG~CAACACCGCAGCGTAACTGCAGGCCTCTCAG~GAAAAAGGGAFAG~

1 (3’)

ACTCCGCTTTGGGCGCGGCAGATCGCCCAGGAC

9

7

7

/

9

CAACW2CGCAGCGTAACTGCAGGCCTCTCAGCGAAAAAGGGAFAGCFGA

1,’-

23

Figure 6. Nucleotide sequence analysis of the reciprocal translocation breakpoints from Kd cells and their corresponding germline regions. Because of the deletions on rearranged chromosomes, we compared the Ip+ chromosome breakpoint region with the 5’ flanking region of normal chromosome I (fragment 103C on Fig. 5) and with the germline j 6 l region. For the same reasons, the 14q- chromosome breakpoint region was compared with the germline D62 region and with the 3’ flanking region of normal chromosome I (fragment N32 I IB on Fig. 5). Black triangles mark the precise location of the chromosomal breaks. Areas representing N nucleotide addition on both reciprocal breakpoints are in italics and are framed. Signal recombination sequences (heptamer-spacer-nonamer) or related sequences (3’ flanking region of chromosome I) are underlined. The chromosome I4qbreakpoint contains the reciprocal signal joint in which recombination consensus sequences are fused head to head.

ment in DU 528 cell DNA but hybridized to abnormal fragments apparently identical to one of the additional bands detected by N36E probe (i.e., 14 kb EcoRI and 10 kb BamHI fragments). This observation was confirmed by a hybridization of the same blot with a mixture of both probes: the autoradiography was strictly identical to one obtained with N36E used alone (data not shown). Symmetrically, the second rearranged fragments (i.e., 9 kb BcoRI and 2 kb BamHI) were both detected by a DG2 probe (data not shown). Therefore, since they contain sequences from both chromosomes 1 and 14, these rearranged fragments are likely to correspond to both translocation junctions. T h e presence of two rearranged BamHI bands detected by the probe N36E suggested that the site of breakage on chromosome 1 is contained within this 0.8 kb BamHI fragment (as indicated at the top of Fig. 5). T h e orientation of the TCRG sequences on chromosome 14 is centromereDG-JG-CG-telomere. Therefore, the 10 kb BamHI fragment identified with the probe JSl must be carried by the derivative chromosome 1, whereas the 2 kb BamHI fragment that hybridized to the probe DG2 must be “derived” from the derivative chromosome 14. Both translocation breakpoints were isolated from total DU 528 DNA after amplification by the polymerase chain reaction. Two oligonucleotides specific for chromosome 1 were chosen from the nucleotide sequence of the fragment N36E as they were assumed to flank the break-

point on chromosome 1 (oli-36E-5’, oli-36E-3’, as indicated in Fig. 7 and in Materials and Methods). Chromosome 14 specific oligonucleotides were selected according to nucleotide sequence of JGl g e n o m i c region p u b l i s h e d e l s e w h e r e (Guglielmi et al., 1988; see Materials and Methods) and from germline D62 genomic segment isolated from the MRC5 genomic library. Finally, the amplification and sequencing of specific fragments (400 bp with oli-36E-3‘/DG2; 1,100 bp with oli-36E-Sf/JG1, see Fig. 7) from DU 528 cell DNA were in agreement with our Southern blot analysis and the results published by Begley et al. (1989). All these observations clearly indicate that the same genomic regions are involved in both translocations t( 1; 14) observed in Kd leukemic cells and in the DU 528 cell line. T h e site of breakage on chromosome 1 in the DU 528 cell line is a distance less than 11 kb from that in Kd leukemic cell. Meanwhile, the same TCR6 gene segments are found at the translocation junctions. Site of Breakage on Chromosome I Is Transcriptionally Active

Chromosomal aberrations occur preferentially in transcriptionally active genomic region, a feature that may facilitate the apparition of the abnormality. A 1.8 kb EcoRI fragment that contains the site of breakage of the translocation (Kdl03C on Fig. 6), strongly hybridized to specific bands in mouse and mink cell DNAs under stringent conditions

204

BERNARD ET AL.

kbal TCTAGATGAGCTGGGCCGO\GGTCAGGAAACCCAGTCGCCC~AC~C~GCCCTGGGGATC~G TKTGCTITCTCCCCATGTGGCTGTGGAGACCATGTCTGCAGCCC

V I

chromes

36E-5

TGAWlVAAGCCCTGTCGGGCTITGTGT~GGCAGAG~GGGACAATGATAGTA~GTGATATGG

AGC/V\GAGATATmGGGCATGTGGGC~CAACTCCTCO\CATCACTG~CATGCTGGCGAGTGAAT

36E5;_ ch romoS

'FI

36E-3'

AGCACAAAACCTGTCCTATGAATGCAmGGAATTmGCAGGAAGCGACCAGAGGTGGAAT

-

J

81

D62,

GCCAGTGTGCTOATGtGCGTACGCTGGT~TGAGTAGATGCTGG

ATGCTTAGAGGGAlTTClT~TGATGGTCTGGTCTATGTCCGAATTGG

*

chromosome 14q-

CTITAGCGCTCAATAGGACCAGGATCC

BamH

Figure 7. Isolation of both translocation breakpoints in DU 528 cells. Left: Nucleotide sequence of germline Ip32 region involved in the DU 528 translocation. The 0.5 kb Xbal-BamHI fragment was derived from the N36E fragment (see Fig. 5). The oligonucleotides used for PCR amplification are underlined and noted as 36E-5' and 36E-3' (see Materials and Methods). Black vertical triangles mark the precise position of the breaks on chromosome I, deduced from nucleotide sequence of PCR amplification products (data not shown). Right: Strategy of PCR amplification of both reciprocal breakpoints in DU 528 cell DNA. As expected, PCR amplification led to the production of specific fragments of 400 bp (with oli-36E-3' and 0 6 2 primers) and of 1,100 bp (with oli-36E-5' and 161 primers).

unique fragments spanning along chromosomes 1 and 14 that were used as probes in Northern blot containing RNAs from various normal or tumoral hematopoietic cell of lymphoid and nonlymphoid origins. T h e 0.7 kb Sad-BamHI fragment (36C in Fig. 5)

revealed the presence of high amounts of a 5 kb transcript appearing as a doublet in Kd leukemic cells (lane 6) and of a 2 kb transcript in DU 528 cells (lane 5). Upon a longer exposure, a 5.0 kb doublet apparently identical in size to that of Kd leukemic cells was also detected in two immature erythroid leukemic cell lines, H E L (lane 2) and K562 (lane 3 ) . A very faint expression of the 5 kb transcript was finally observed in DU 528 cells and in another leukemic T-cell line (CEM) only after a very long exposure (data not shown), whereas no transcription was detected in normal ap (lane 7) or yS T lymphocyte clones (lane 4). This transcript was not ever observed in a variety of B-lymphoid and myeloid leukemic cells (data not shown). Moreover, minor species of 2 kb were also detectable after a long exposure in Kd, HEL, and K562 cells, whose expression seems to be associated with the expression of the 5 kb RNA. A CS probe (Fig. 9A) identified two transcripts of 2 and 1.3 kb in Kd cells (lane l), whereas no transcription was detected in DU 528 (lane 2); those two RNA species shorter than the mature and functional TCRS mRNAs of a y/S T-cell clone (lane 1) may correspond to the early nonfunctional transcript of the TCRS gene as already described (Guglielmi et al., 1988). DISCUSSION

Figure 8. lnterspecies conservation of the lp32 chromosome region. Southern blot of genomic DNAs from human fibroblast (F) or T lymphocyte (LY) Or from murine fibroblast (SCI) Or mink fibrobkt (CCL64) digested with Hindlll were hybridized under stringent conditions with the probe 103C (see Fig. 5). Last wash - 0 . 2 ~ SSC at 60'C.

This study describes the molecular characterization of a chromosome translocation t( 1;14)(p32;qll) observed in a patient with a T-ALL and in the leukemic cell line DU 528. Cytogeneticabnormalities involving the chromosomal band lp32 have

SCL GENE ACTIVATION IN T-CELL LEUKEMIAS

205

B

A

Figure 9. Transcription analysis of TCRG sequencesan&otthe Ip32 locus. A Transcription of TCRG sequences: 20 pg total RNA from a $6 normal T-cell clone (lane I) from DU 528 cells (lane 2) and Kd cells (lane 3) were used. Blot was hybridized with a 3’ UT-CG probe and exposed for one night. B: Transcription of the Ip32 locus: 2 pg of polyA from HEL cell line (lane 2). K562 cell line (lane 3), and 20 pg total RNA from a y/6 normal T-cell clone (lane 4), DU S28 cell line (lane 9, Kd leukemic cells (lane 6), and KE 37 cell line (lane 7 ) were used. Blot was hybridized with the 36C probe (see Fig. 5) that is flanking the DU 528 translocation breakpoint. XDNA digested with Hindlll and labeled with 32Pwas comigrated as a marker (lane I). The picture is a mounting of two autoradiogaphies obtained after 3 days’ exposure (lanes 1-3) or one night’s exposure (lanes 47).

tion of a chromosome translocation t( 1;14)(p32;qll) observed in a patient with a T-ALL and in the leukemic cell line DU 528. Cytogenetic abnormalities involving the chromosomal band lp32 have been described already, but none of them seems to affect the proto-oncogenes located on this region (JUN, LCK, MYCL). T h e involvement of the chromosome band 1 4 q l l containing the TCR-alpha (TCRa) and -delta (TCRS) chain genes gave us the opportunity to isolate the genomic sequences from the lp32 chromosome region whose expression is assumed to have played a role during the oncogenic process. T h e TCR-dS locus has been found to be affected in a large number of specific chromosomal abnormalities of T-cell leukemias; the t( 1;14) translocation is another illustration of its involvement and confirms that this locus is a hot spot for illegitimate recombination. t( I ;14) Translocation Occurred in the TCRG Gene and Was Mediated by Recombinase

We identified the translocation breakpoints in the TCRS gene. In Kd cells, the junction of the derivative chromosome 14q- contains the 5’ flanking region of the D62 segment, whereas the JSl segment is found at the border of the translocation breakpoint on the chromosome l p , reflecting a

+

deletion of 10 kb in the TCRS gene. A similar situation was observed for the DU 528 cell translocation where the positions of the breaks on chromosome 14 have been localized 3’ to the DS2 segment and 5’ to D63 that is proximal to JSl, thus deleting the whole intervening segment (Begley et al., 1989; our results). Nucleotide sequence analysis of the DNA segment directly involved in the translocation of Kd and DU 528 cells indicates that several conserved features have influenced the translocation process. First, the recombination occurred immediately at the boundaries of JS or DS segments as is the case in physiological rearrangements. Second, recombination signal motifs (i.e., heptamer-12 bp/23 bp spacer-nonamer) or related sequences are present immediately adjacent to the sites of breakage on both chromosome partners: the two heptamers are found in a head-to-head orientation on the der 14q - chromosome. Third, potential N nucleotides are found at the translocation joints on both derivative chromosomes. All these observations clearly indicate that the recombinase machinery, normally required for V-D-J joining, participated to the translocation process. Several reports have already proposed this mechanism to explain the occurrence of some translocations in B- and T-cell malignancies (Haluska et al., 1986; Finger

206

BERNARD ET AL

et al., 1986; Bernard et al., 1988; Tsujimoto et al., 1988). Kd Cell DNA Contains a Functional Vcu/JcuAssembly

In Kd cells, the normal chromosome 14 carries a productive Va/Ja assembly. This functional V d J a rearrangement is consistent with the expression of a complete T-cell receptor at Kd leukemic cell surface. DU 528 cell DNA does not contain any 1’CRG or a productive rearrangement on normal chromosome 14 but exhibits a rearrangement between the 6 recombining element (Arec, de Villartay et al., 1988) lying 5‘ of DG, with a Japseudogene (Begley et al., 1989). This specific recombination has been proposed as a general mechanism to delete the TCRG gene during normal T-cell differentiation (Hockett et al., 1988). Rearrangements within the TCRaIG locus have been characterized on both alleles of Kd and DU 528 leukemic cells. In both cases, the TCRG gene rearrangement linked to the translocation is nonfunctional. These observations support the view that a T cell may rearrange its TCRa gene without deleting the TCRG sequences on the other allele; the conservation of these sequences seems to be related to the nonfunctional status of the rearranged TCRG gene. Kd Cell DNA Contains Two Deletions Within the Jcu Cluster

Two other genomic rearrangements were identified in Kd cell DNA. Both involved a Jasegment and noncoding genomic fragment that is very proximal in one case (less than 0.2 kb) or rather distant (9 kb) and led to the complete deletion of the intervening sequences. T h e recombination event did not follow the 12/23 spacer rule for immunoglobulin gene recombination, as it was certainly mediated solely by the heptamers flanking the 5’ side of the J a segments and isolated heptamers located in noncoding sequences. Internal recombinations within the J a locus, mediated solely by heptamers, seem to be quite frequent in human T-cell leukemia. Baer e t al. (1988) proposed that in normal T-cells the J a internal deletions could reflect a physiological process of “switching” between J a segments following a ValJa assembly, in order to replace the J a segment while maintaining the Va. In Kd cells, both J a internal recombinations are located on the rearranged chromosome l p . Similarly, in several leukemic T cells, bearing specific 1 4 q l l chromosomal abnormalities, J a internal deletions have been identified on

+

translocated chromosomes (Baer et al., 1988; Harvey et al., 1989; McGuire et al., 1989). Most of the 14qll chromosomal abnormalities split the TCRaIG locus within the Ja cluster or the TCRG gene. It seems likely that the physical separation of the V a cluster and J a cluster, as they were located on the two rearranged chromosomes, did not stop the course of TCRa/G rearrangement but favored illegitimate recombinations. In Kd cells, the transcription of CG sequences from the chromosome l p + should have maintained the Ja region accessible to the recombinase enzymatic complex. We can postulate that Jainternal deletions may have some physiological meaning. During normal early B-cell maturation, preferential rearrangements of V segments are based on their position on the chromosome, as segments from the most JHproximal V, family are rearranged a t an extraordinary high frequency (Yancopoulos and Alt, 1986). This should be particularly true for TCRa gene because of the huge size of the J a cluster. Internal rearrangements, by modifying spatial configuration of the J a cluster, might facilitate the assembly of some V a and J a segments that, in germline configuration, are less accessible to each other. T h e existence of complex rearrangements on the translocated allele and the deletion of sequences (1 kb) from chromosome 1 strongly suggest a two-step scenario for the Kd cell DNA rearrangements. First, the 5‘ region of DG2 was illegitimately joined to the 3‘ portion of chromosome 1, via the recombination signals present on both chromosomes, thus obeying the rule of 12/23 nucleotides spacer. This event would have yielded the recombinant chromosome 14q - . Thereafter, Kd cells during an attempt to secondarily rearrange the TCR-6 locus on the derivative chromosome 1 (i.e., assembly of DG2 to JGl) should have deleted a genomic segment constituted of recombined sequences originating from both chromosomes. In DU 528 cells, the translocation is conservative as there was no loss of material from chromosome 1. It is difficult to conclude whether the deletion between DG1 and DG3 gene segments, which is typical of physiological TCRG gene rearrangement, occurred prior to or at the same time as the translocation. Role of the lp32 Chromosome Region in Malignancy

An important fact is that the same lp32 genomic region (named SCL by Begley et al., 1989, and TCL5 by Finger et al., 1989) is involved in the two cases of t(1; 14) translocations described until now

207

SCL GENE ACTIVATION IN T-CELL LEUKEMIAS

(our case Kd and in DU 528 cell line). T h e breakpoints of chromosome 1 of the two translocations lie in a genomic fragment of less than 11 kb. By using specific probes flanking the lp32 breakpoint region of DU 528 cell, we observed the presence of large amounts of SCL transcripts with quite different sizes in both leukemic cells (5 kb for Kd cell RNA, 2 kb for DU 528 cells). In Kd cells, the genomic segment used to detect the SCL transcript is located on the der 14q- chromosome, excluding the C6 transcription from chromosome l p + could have had any effect on the SCL gene expression. T h e situation is quite different in DU 528 cells, since a part of these sequences is still located on the der l p + chromosome, but is now juxtaposed 5' to the C a region that has been described as containing a proximal enhancer element (Winoto and Baltimore, 1989). In fact, the 2 kb RNA expressed in DU 528 cells represents a fusion transcript between SCL sequences from chromosome 1 and the D62 segment from chromosome 14 (Begley et al., 1989). Studies of eukaryotic DNA have revealed that the in vivo accessibility of chromatin to various nucleases differs greatly between transcriptionally active and inactive genes (Gross and Garrard, 1988). In vitro experiments have demonstrated that transcriptional activation of a region targets this DNA region for a recombination event (Thomas and Rothstein, 1989). Consistently, during B-cell differentiation, transcription of the V, segment occurs at a time when the cells are undergoing VHDJH assembly (Yancopoulos and Alt, 1985). In that respect, it is interesting that both translocations t(1;14) affect the TCRG gene, which is known to rearrange very early during T-cell differentiation. In addition, the SCL gene appears to be expressed preferentially in some immature hematopoietic cells, whereas no transcription was detected in normal mature T- or B-cells (Begley et al., 1989; our results). This strongly suggests that the SCL gene was expressed a t the time when the cells were undergoing TCRG rearrangements. An open configuration of chromatin associated with SCL gene transcription may have increased the accessibility of this DNA domain to the recombination machinery. In conclusion, we found that both translocations t(1;14) impaired the SCL locus expression by two quite different mechanisms: In the immature DU 528 cells, the translocation resulted in the expression of a truncated and hybrid transcript at a time when the SCL gene must be functional. On the other hand, Kd cells that correspond to a relatively mature phenotype, expressed high levels of

an apparently normal transcript at a time when the SCL gene should be silent. In this case, the SCL gene activation may be due to the physical separation between regulatory sequences that stayed on the derivative chromosome 1 and the coding sequences transferred onto chromosome 14. Assuming that SCL gene deregulation participates in some leukemogenic processes, our results argue in favor of its oncogenic activation by two different mechanisms. ACKNOWLEDGMENTS

This work was supported in part by the Association pour la Recherche sur le Cancer (ARC). O.B. is a recipient of an ARC fellowship. We thank Mrs. V. Della Valle for efficient technical cooperation, Dr. Luc d'Auriol for his help in the PCR experiments and Michel Kaczorek (Pasteur Vaccins) for helpful discussion. REFERENCES Baer R, Chen KC, Smith SD, Rabbitts T H (1985) Fusion of an immunoglobulin variable gene and T cell receptor constant gene in the chromosome 14 inversion associated with T-cell tumors. Cell 43:705-713. Baer R, Boehm T , Yssel H, Spits H, Rabbitts T H (1988) Complex rearrangements within the human JG-CG/Ja-Ca locus and aberrant recombination between J a segments. EMBO J 7:16611668. Begley CG, Aplan PD, Davey MP, Nakahara K, Tchorz K, Kurtzberg J, Hershfield M, Haynes BF, Cohen DI, Waldman TA, Kirsch IR (1989) Chromosomal translocation in a human leukemic stem-cell line disrupts the T-cell antigen receptor 8-chain diversity region and results in a previously unreported fusion transcript. Proc Natl Acad Sci USA 86:2031-2035. Bernard 0, Larsen CJ, Hampe A, Mauchauffe M, Berger R, Mathieu-Mahul D (1988) Molecular mechanisms of a t(8;14) translocation juxtaposing c-myc and TCR-a genes in a T-cell leukaemia: Involvment of a V a internal heptamer. Oncogene 2: 195-200. Bernard 0, Mauchauffe M, Larsen CJ, Mathieu-Mahul D (1989) Two linked RFLPs at chromosomal band lp32. Nucleic Acid Res 17:6427. Boehm T , Baer R, Lavenir I, Forster A, Waters JJ, Nacheva E, Rabbitts T H (1988) T h e mechanism of chromosomal translocation t(l1; 14) involving the T-cell receptor C6 locus on human chromosome 14qll and a transcribed region of chromosome llp15. EMBO J 7:385-394. Caccia N, Bruns G, Kirsch I, Hollis G, Benness V, Mak T (1985) T-cell receptor a chain genes are located on chromosome 14 at 14qll-14q12 in humans. J Exp Med 161:1255-1261. Cherif D, Bernard 0, Berger R (1989) Detection of single-copy genes by nonisotopic in situ hybridization on human chromosomes. Hum Genet 81:35&362. Chien YH, Iwashima M, Wettstein DA, Kaplan KB, Elliott JF, Born W, Davis MM (1987) A new T-cell receptor gene located within the alpha locus and expressed early in T-cell differentiation. Nature 331:627431. Cleary M, Smith S, Sklar J (1986) Cloning and structural analysis of cDNAs for hcl-2 and a hybrid bcl-2/immunoglobulin transcript resulting from the t(14; 18) translocation. Cell 47: 19-28. Cleary M, Mellentin J, Spies J, Smith S D (1988) Chromosomal translocation involving the p T cell receptor gene in acute leukemia. J Exp Med 167:682487. Croce CM, Isobe M, Palumbo A, Puck J, Tweardy D, Erikson J, Davis M, Rovera A (1985) Gene for a-chain of human T-cell receptor: Location on chromosome 14 region involved in T-cell neoplasms. Science 227: 10441047. de Villartay JP, Hockett RD, Coran D, Korsmeyer SJ, Cohen DI

208

BERNARD ET AL.

(1988) Deletion of the human T-cell receptor &gene by a site specific recombination. Nature 335: 170-173. Erikson J, Williams D, Finan J, Nowell PC, Croce CM (1985) Locus of the a-chain of the T-cell receptor is split by chromosome translocation in T-cell leukemias. Science 229:784-786. Finger L, Harvey R, Moore R, Showe L, Croce CM (1986) A common mechanism of chromosomal translocation in T- and B-cell neoplasia. Science 234:982-985. Finger LR, Kagan J, Christopher G, Kurtzberg J, Hershfield MS, Nowell PC, Croce CM (1989) Involvement of the TCL5 gene on human chromosome 1 in T-cell leukemia and melanoma. Proc Natl Acad Sci USA 86:503%5043. Gross DS, Garrard W T (1988) Nuclease hypersensitivity sites in chromatin. Annu Rev Biochem 57: 159-197. Guglielmi P, Davi F, d’Auriol L, Bories JC, Dausset J, Bensoussan (1988) Use of a variable a region to create a functional T-cell receptor 6 chain. Proc Natl Acad Sci USA 855634-5638. Haluska F, Finver S, Tsujimoto Y, Croce CM (1986) T h e t(8;14) chromosomal translocation occurring in B-cell malignancies results from mistakes in v-D-J joining. Nature 324:158-159. Harvey R, Martinerie C, Sun LH, Williams D, Showe L (1989) Translocations and rearrangements in T-cell acute leukemias with the t( 11;14)(~13;qll)chromosomal translocations. Oncogene 4341-349. Hershfield M, Kurtzberg J, Harden E, Moore J. Whang-Peng J , Haynes B (1984) Conversion of a stem-cell leukemia from Tlymphoid to a myeloid phenotype induced by the adenosine deaminase inhibitor 2‘-deoxycoformycin. Proc Natl Acad Sci USA 81:253-257. Hockett RD, devillartay JP, Pollock K, Poplack DG, Cohen D1, Korsmeyer SJ (1988) Human T-cell antigen receptor (TCR) &chain locus and elements responsible for its deletion are within the TCR a-chain locus. Proc Natl Acad Sci USA 85:9694-9698. Isobe M, Erikson J, Emanuel B, Nowell P, Croce CM (1985) Location of gene for p subunit of human T-cell receptor at band 7q35, a region prone to rearrangements in T cells. Science 228:58&583. lsobe M, Russo G, Haluska FG, Croce CM (1988) Cloning of the gene encoding the 6 subunit of the human T-cell receptor reveals its physical organization with the a-subunit locus and its involvement in chromosome translocations in T-cell malignancies. Proc Natl Acad Sci USA 86:3933-3937. Kagan J. Finan J , Letofski J, Besa E, Nowell PC, Croce CM (1987) a-Chain locus of the T-cell antigen receptor is involved in the t( 10; 14) translocation of T-cell acute lymphocytic leukemia. Proc Natl Acad Sci USA 84:45434546. Kagan J, Finger LR, Letofsky J, Finan J, Nowell PC, Croce CM (1989) Clustering of breakpoints on chromosome 10 in acute T-cell leukemias with the t(10;14) chromosome translocation. Proc Natl Acad Sci USA 86:41614165. Klein G, Klein E (1985) Evolution of tumors and the impact of molecular biology. Nature 315:19&195. Klein MH, Concannon P, Everett M, Kim LD, Hunkapiller T , Hood L (1987) Diversity and structure of human T-cell receptor a-chain variable region genes. Proc Natl Acad Sci USA 84:68846888. Kurtzberg J, Bigner S, Hershfield M (1985) Establishment of the DU.528 human lymphohemopoietic stem cell line. J Exp Med 162: 1561-1578. Mathieu-Mahul D, Caubet JF, Bernheim A, Mauchauffk M, Palmer E, Berger R, Larsen CJ (1985) Molecular cloning of a DNA fragment from human chromosome 14 (14qll) involved in human T-cell malignancies. EMBO J 43427-3433. Mathieu-Mahul D, Berheim A, Sigaux S, Daniel MT, Larsen CJ, Berger R (1986) Translocation t(1;14) and rearrangement of the alpha chain T cell receptor gene in a T cell acute lymphoblastic leukemia. C R Acad Sci Paris 302525-528. McGuire E, Hockett R, Pollock K, Bartholdi M, OBrien S, Kors-

mayer S (1989) T h e t(l1;14)(plS;qll) translocation in a T-cell acute lymphoblastic leukemia cell line activates multiple transcripts, including Ttg-1, a gene encoding a potential zinc finger protein. Mol Cell Biol 9:2124-2132. Mellentin JD, Smith SD, Cleary ML (1989) lyl-1, A novel gene altered by chromosomal translocation in T cell leukemia, codes for a protein with a helix-loop-helix DNA binding motif. Cell 58:77-83. Murre C, Waldmann R, Morton CC, Bongiovanni KF, Waldmann TA, Shows TB, Seidman JG (1985) Human y-chain genes are rearranged in leukemic T-cells and map to the short arm of chromosome 7. Nature 31654%551. Rabbitts T H , Lefranc MP, Stinson MA, Sims JE, Schroder J, Steinmetz M, Spurr NL, Solomon E, Goodfellow PN (1985) T h e chromosomal location of T-cell receptor genes and a T cell rearranging gene: Possible correlation with specific translocations in human T cell leukaemia. EMBO J 4: 1461-1465. Rabbitts T H , Boehm T, Mengle-Gaw L (1988) Chromosomal abnormalities in lymphoid tumors: Mechanism and role in tumor pathogenesis. T I G 4:300-304. Reynolds T C , Smith SD, Sklar J (1987) Analysis of DNA surrounding the breakpoints of chromosomal translocations involving the p T cell receptor gene in human lymphoblastic neoplasms. Cell 50:107-117. Russo G, Isobe M, Gatti R, Finan J, Batuman 0, Huebner K, Nowell P, Croce CM (1989) Molecular analysis of a t(14;14) translocation in leukemic T-cells of an ataxia telangiectasia patient. Proc Natl Acad Sci USA 86:602406. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn G T , Mullis KB, Erlich HA (1988) Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:488-491. Satyanarayana K, Hata S, Devlin P, Roncarolo MG, De Vries JE, Spits H, Strominger JL, Krangel MS (1988) Genomic organization of the human T-cell antigen receptor a/S locus. Proc Natl Acad Sci USA 85:8166-8170. Seto M, Jaeger U, Hockett R, Graninger W, Bennett S, Goldman P, Korsmeyer SJ (1988) Alternative promoters and exons, somatic mutation and deregulation of the BCL2-lg fusion gene in lymphoma. EMBO J 7:123-131. Shtivelman E, Heinglein B, Groilt P, Lipp M, Bishop JM (1989) Identification of a human transcription unit affected by the variant chromosomal translocations 2;8 and 8;22 of Burkitt lymphoma. Proc Natl Acad Sci USA 863257-3260. Takihara Y, Champagne E, Griesser H, Kimura N, Tkachuk D, Reinmann J, Okada A, Alt FW, Chess L, Minden M, Mak T W (1988) Sequence and organization of the human T cell 6 chain gene. Eur J Immunol 18:283-287. Thomas BJ, Rothstein R (1989) Elevated recombination rates in transcriptionally active DNA. Cell 56:619-630. Trent JM, Kaneko Y, Mitelman F (1989) Report of the Committee on Structural Chromosome Changes in Neoplasia. Human Gene Mapping 9.5. Cytogenet Cell Genet 51:533-562. Tsujimoto Y, Louie E, Bashir M, Croce CM (1988) T h e reciprocal partners of both the t(14;18) and the t(l1;14) translocation involved in B-cell neoplasms are generated by the same mechanism. Oncogene 2:347-351. Winoto A, Baltimore D (1989) A novel, inducible and T cell-specific enhancer located at the 3’ end of the T cell receptor. EMBO J 8:72’?-733. Yancopoulos GD, Alt FW (1985) Developmentally controlled and tissue-specific expression of unrearranged V, gene segments. Cell 40:271-281. Yancopoulos GD, Alt FW (1986) Regulation of the assembly and expression of variable-region genes. Annu Rev Immunol4:33% 368. Yoshikai Y, Kimura N, Toyonaga B, MakTW (1986) Sequences and repertoire of human T-cell receptor a-chain variable region genes in mature T lymphocytes. J Exp Med 164:9&103.