Int J Clin Exp Med 2015;8(2):2656-2661 www.ijcem.com /ISSN:1940-5901/IJCEM0002619
Original Article Two novel mutations of ornithine transcarbamylase gene identified from three Chinese neonates with ornithine transcarbamylase deficiency Jing Liu1*, Lei Dong2*, Yan Wang3*, Mei Zhang1 Department of Pharmacology, General Military Hospital of Beijing PLA, Beijing 100700, China; 2Department of Surgery and Laboratory of Surgical Oncology, Peking University People’s Hospital, Beijing 100044, China; 3BaYi Children’s Hospital, General Military Hospital of Beijing PLA, Beijing 100700, China. *Equal contributors. 1
Received September 18, 2014; Accepted November 24, 2014; Epub February 15, 2015; Published February 28, 2015 Abstract: We aim to analyze the blood metabolic profiling and the gene mutation of ornithine transcarbamylase (OTC) in three neonates with ornithine transcarbamylase deficiency (OTCD). Three neonates with OTCD were included in this study. The profiling of amino acids and acylcarnitine was determined using MS-MS assay. The OTC exons were amplified using PCR amplification. DNA sequencing was performed, based on which mutation analysis of OTC genes was carried out. For the clinical symptoms, all the three neonates showed poor reaction and feeding. In addition, convulsion and neonatal infection were noticed. A remarkable decrease of citrulline concentration was revealed by MS-MS assay. In case 1, a 548A > G substitution was identified in exon 6, which resulted in replacement of cysteine by tyrosine in codon 183. In case 2, a 1016T > G substitution was identified in exon 10, leading to replacement of valine by glycine in codon 339. In case 3, a 995G > C mutation was noted in exon 9, resulting in missense mutation of tryptophane to serine in codon332. Three types of OTC gene mutations were identified in Chinese neonates with OTC deficiency, among which two novel mutations, including 1016T > G and 995G > C, are presented uniquely in our study. Keywords: Ornithine transcarbamylase deficiency, mutation, ornithine transcarbamylase, MS-MS assay
Introduction Ornithine transcarbamylase deficiency (OTCD) refers to an X-linked genetic disorder of the urea cycle that resulted in elevated ammonia in blood due to decreased activity or complete elimination of ornithine transcarbamylase (OTC) [1, 2]. The presentation of OTCD in males is usually in the neonatal period with a rapidly progressive metabolic encephalopathy, which is characterized by poor feeling, irritability, lethargy, coma, and respiratory failure [2]. The human OTC gene, with a full length of 73 Kb containing 10 exons, is located on the short arm of the X chromosome within band Xp21.1 [3]. To date, mutations of OTC encoding genes have been considered as the main cause for the decrease or elimination of OTC activity [4]. To our knowledge, the phenotype of OTCD is extremely heterogeneous. Until now, more than 379 mutations of human OTC gene have been
identified. As confirmed using molecular methods, only approximately 80% of patients with OTC deficiency are found to have mutations [5]. Studies have been carried out to investigate the mutation of OTC gene in the residents in Asian countries, including Japan and Korea [6-8]. However, rare studies have been carried out to analyze the gene mutation of OTC in Chinese neonates. In this study, a mutation analysis of OTC gene was performed in three infants with OTC deficiency treated in our hospital. We present two newly identified gene mutations in OTC gene, which could add more information to the analysis of OTC polymorphism. Materials and methods Patients Case 1 was a male neonate born to healthy parents. Two days after delivery, the patient
Novel OTC mutations in Chinese OCTD neonates Table 1. Specific primers for the PCR amplification Primers (5’-3’) GAGTTTTCAAGGGCATAGAATCGTC AGGAATCATGGTGATGCATAAAACT CACCATAGTACATGGGTCTTTTCTGA GTTCCAGTTACTACCAGTCCCCTTTTT CACTTATTTGGGGGCTAGTTATTACTTA AAGAGAGGGATTGAAGGTGAAGAC GTTGAGATGATGGCCAATTCTTTGT CAAAGCTGATTTCAGAATCTGATGG GCATTATTAAGCATAATTATCTTAG TAATTCCTGACTTGCTTTAAGTGAA TGGATTTCATCTCCTTCATCCCGTG GAAACTAACCCCTCTCTTAAATCAC CCTAAATAAGATTTAAATTCCTTCCT ATGCTCTCTCAGGTTCATTAATTCC GCCACATATAATAGTCAAAAAGTGG TGGGGAAATAATAAGCAAGTGAGAT TCTAGGTCCCTAAGCAGACTGTCGCT TGTTCTTCAGTAACAGAATGAGTTG
Exon 1 2 3 4 5 6
DNA isolation Peripheral blood was obtained from three cases and two mothers. DNA was isolated using the TIANamp Blood DNA extraction Kit according to the manufacture’s instructions. PCR amplification
7, 8 9 10
showed intermittent convulsion, combined with progressive dyspnea. The blood ammonia was 1000.0 µg/dl. The patient was diagnosed with OTCD using liver biopsy. The patient was lost in the follow up period. Case 2 was a male neonate, who was admitted to our department due to poor reaction and convulsion on day 7 after delivery. His blood ammonia rose rapidly to 1000.0 µg/dl using liver biopsy. He died on day 11. Case 3 was a male neonate, who was admitted to our department due to neonatal pneumonia and convulsion on day 9 after delivery. His blood ammonia rose rapidly to 1000.0 µg/ dl as revealed by liver biopsy. He died on day 10. The protocols were approved by the Ethic Committee of General Military Hospital of Beijing PLA. Acylcarnitine analysis Dried blood samples were prepared by using 25 µl blood, and then were placed to a filter paper. The acylcarnitine analysis of dried blood spots of each patient was performed using liquid chromatography-tandem mass spectrometry (LC-MS/MS) as previously described [9]. Urine metabolites analysis For the collection of urine sample, 2 ml urine was collected and prepared according to the 2657
previous report with slight modification. ULTRAISQ GC-MS instrument (Thermo Fisher Scientific Inc., Waltham, MA, USA) was used for the urine metabolites analysis as previously described by Song et al. In brief, the samples were mixed with urease at 37°C for 15 min. Then daturic acid (200 ppm) was added to the mixture and set as internal standard.
Specific primers targeted the human OTC gene were synthesized by Sangon Biotech (Shanghai, China). In total, 9 pairs of primers were generated targeting the 10 exons in OTC gene (Table 1). PCR reaction was performed in a total volume of 20 μL containing 10 μL 2 × mix, 0.5 μL of each primer, and 1 μL (50~100 ng/μL) DNA template. The PCR conditions used in the amplification were pre-denaturation at 94°C for 3 min, followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing at 56-60°C for 30 seconds, and extension at 72°C for 1 minute. Finally, a final extension was performed at 72°C for 5 minutes. The PCR products were separated in a 2% agarose gel. Sequencing The PCR products were purified and linked to a pUC18 vector. Sequencing was performed using ABI3130 automatic sequencer (Applied Biosystems, CA, USA). The sequencing results were analyzed using Chromas version 2.23. Results Blood metabolic profiling Table 2 summarized the metabolic profiling of the peripheral blood of the patients. The profiling pattern was similar for the amino acids analyzed. The citrulline concentration was near the lower limit of the normal range. In addition, significant increase was noted in the concentration of alanine, glutamine, glutamic acid, histidine, leucine/isoleucine, methionine, piperidine, proline, serine, and tryptophane compared with the normal ranges, respectively. Int J Clin Exp Med 2015;8(2):2656-2661
Novel OTC mutations in Chinese OCTD neonates in 2006 [5]. The latest updated data indicated that a total of 379 mutaAmino acid Case 1 Case 2 Case 3 Reference (μm) tions have been reported. The mutaCitrulline 1.81 1.95 2.67 1.79-15.0 tion of OTC gene was significantly hetAlanine 546.84 826.96 449.07 34.0-418.0 erogeneous between the races. In adGlutaminate 275.82 434.09 161.05 12.0-126.0 dition, the mutation profiling of the Glutamic acid 798.24 1073.30 332.10 43.0-428.0 OTC was remarkably different in variHistidine 254.81 275.62 165.43 25.0-116.0 ous geographical locations. To our knLeucine/isoleucine 231.84 238.10 253.84 28.0-216.0 owledge, only three neonates and five Methionine 99.61 79.00 69.00 8.0-40.0 late-onset children with OTCD have Piperidine 897.27 1376.09 554.07 38.0-523.0 been reported in China mainland [10]. What’s more, gene mutation analysis Proline 1847.03 3081.67 1647.20 273.0-1446.0 was performed in only one neonate Serine 161.98 147.69 133.27 24.0-131.0 and three late-onset children, which Tryptophan 98.83 113.79 24.08 4.0-22.0 revealed one nonsense mutation in Tyroine 164.98 176.94 96.66 6.0-87.0 the OTC gene at the exon 9 (C.958 C > T) causing an arginine to terminate Metabolite analysis of urea the code at position 320 of the protein (R320X). In addition, two other mutations were also The metabolite analysis of the urea indicated detected at intron 9 (C.1005 + 132 InsT) and that the concentration of orotate and uracil intron 5 (C.542 + 134 G > G/A). The authors coshowed remarkable increase compared with ncluded that the mutation of C.958 C > T in OTC the normal range. This indicated the urea cycles gene may occur during neonatal period, which may result in a very severe symptom, even sudwere aberrant in these cases (Figure 1). For the den death several days after birth especially in rest of the metabolites in urea, no statistical boys. difference was noted compared with the normal ranges (P > 0.05). OCT mutation has been considered to be extremely associated with OTC deficiency. To be Structure of mutations and gene analysis exact, neonatal onset patients usually showed significantly reduced or even no residual OTC In case 1, a 548A > G substitution in exon 6 enzyme activity, while patients with residual resulted in the replacement of cysteine by tyroOTC enzyme activity were tended to develop sine in codon 183 (Figure 2A). In case 2, a late-onset disease in childhood with repeated 1016T > G substitution in the exon 10 resulted vomiting or neurological defects or seizures in the replacement of lyophobic amino acid [11]. In Case 1, an A to G substitution was noted (valine) by a hydrophilic amino acid (glycine) in at the 548th base, which resulted in replacecodon 339 (Figure 2B). In addition, a heterozyment of cysteine by tyrosine in codon 183. This gous mutation was noted in the same position substitution resulted in reduced stability of in his mother (Figure 2C). In case 3, a 995G > C ornithine domain, which finally led to decreased was noted in exon 9, which resulted in misseactivity of OTC in neonates as previously desnse mutation of tryptophane to serine in codon cribed. In Case 2, a T to G substitution was no332 (Figure 2D). ted at the 1016nt position in exon 10, which resulted in a replacement of a lyophobic amino Discussion acid (valine) by a hydrophilic amino acid (glycine) in codon 339. In the previous report, a C Extensive studies have been carried out to to G substitution was noted at the 1015nt posiinvestigate the gene mutations resulting in OTC tion in exon 10, leading to a replacement of a deficiency. In our study, we report three misselyophobic amino acid (valine) by a hydrophilic nse mutations in Chinese neonates. Among thamino acid (leucine) in codon 339 [12]. In Case ese mutations, two novel mutations have never 3, a homozygous mutation of G to C was noted been reported previously. in the 995nt position in exon 9, leading to misAccording to the previous description, a total of sense mutation of tryptophane to serine in 341 mutations and 29 nondisease-causing mucodon 332. Previously, a G to A substitution was noted in the 996nt base in exon 9, which tations and polymorphisms have been reported Table 2. Blood metabolite analysis in three cases
2658
Int J Clin Exp Med 2015;8(2):2656-2661
Novel OTC mutations in Chinese OCTD neonates
Figure 1. Gas chromatographic analysis of the urine samples for case 1 (A), case 2 (B) and case 3 (C). Remarkable increase was noted in the expression of uracil and orotate. Chromatography of ions for the case 1 (D).
resulted in tryptophane into termination codon [13]. Thus, we proposed that two novel gene 2659
mutations, including 1016T > G and 995G > C, have never been reported previously. In this Int J Clin Exp Med 2015;8(2):2656-2661
Novel OTC mutations in Chinese OCTD neonates
Figure 2. Mutation analysis of OTC gene. 548A > G was noted in the exon 6 in case 1 (A). 1016T > G was noted in the exon 10 of OTC gene in case 2 (B) and the maternal origin (C). 995G > (C) was identified in exon 9 of OTC in case 3 (D). Arrow stands for the mutation site.
study, gene sequencing was also performed in 2 mothers, which revealed the mutated genes in Case 2 was inherited from his mother who was a carrier of heterozygous mutation with normal phenotype (Figure 2C). In conclusion, we report three OTC gene mutations in Chinese neonates with OTC deficiency. Among these mutations, two novel mutations are presented uniquely in our study. Our study could provide helpful information for the gene mutation analysis of OTC, and contribute to the diagnosis of OTC deficiency in clinical practices, as well as the screening of OTC gene mutation carriers, especially to the neonatal screening of those with family histories. Acknowledgements This work was supported by the National Natural Science Foundation of China (No. 30973210, 81170602 and 81300527). Disclosure of conflict of interest None. Address correspondence to: Dr. Mei Zhang, Department of Pharmacology, General Military Hospital of
2660
Beijing PLA, No. 5, Nanmencang, Dongcheng District, Beijing 100700, China. Tel: +86-10-66721926; Fax: +86-10-84043984; E-mail: zhangmeibj@sina. com
References [1]
[2]
[3]
[4]
Harada E, Nishiyori A, Tokunaga Y, Watanabe Y, Kuriya N, Kumashiro R, Kuno T, Kuromaru R, Hirose S, Ichikawa K and Yoshino M. Late-onset ornithine transcarbamylase deficiency in male patients: prognostic factors and characteristics of plasma amino acid profile. Pediatr Int 2006; 48: 105-111. Venkateswaran L, Scaglia F, McLin V, Hertel P, Shchelochkov OA, Karpen S, Mahoney D Jr and Yee DL. Ornithine transcarbamylase deficiency: a possible risk factor for thrombosis. Pediatr Blood Cancer 2009; 53: 100-102. Lindgren V, de Martinville B, Horwich AL, Rosenberg LE, Francke U. Human ornithine transcarbamylase locus mapped to band Xp21.1 near the Duchenne muscular dystrophy locus. Science 1984; 226: 698-700. Augustin L, Mavinakere M, Morizono H and Tuchman M. Expression of wild-type and mutant human ornithine transcarbamylase genes in Chinese hamster ovary cells and lack of dominant negative effect of R141Q and R40H mutants. Pediatr Res 2000; 48: 842-846.
Int J Clin Exp Med 2015;8(2):2656-2661
Novel OTC mutations in Chinese OCTD neonates [5]
[6]
[7]
[8]
[9]
Yamaguchi S, Brailey LL, Morizono H, Bale AE and Tuchman M. Mutations and polymorphisms in the human ornithine transcarbamylase (OTC) gene. Hum Mutat 2006; 27: 626-632. Ogino W, Takeshima Y, Nishiyama A, Okizuka Y, Yagi M, Tsuneishi S, Saiki K, Kugo M and Matsuo M. Mutation analysis of the ornithine transcarbamylase (OTC) gene in five Japanese OTC deficiency patients revealed two known and three novel mutations including a deep intronic mutation. Kobe J Med Sci 2007; 53: 229-240. Kim GH, Choi JH, Lee HH, Park S, Kim SS and Yoo HW. Identification of novel mutations in the human ornithine transcarbamylase (OTC) gene of Korean patients with OTC deficiency and transient expression of the mutant proteins in vitro. Hum Mutat 2006; 27: 1159. Yoo HW, Kim GH and Lee DH. Identification of new mutations in the ornithine transcarbamylase (OTC) gene in Korean families. J Inherit Metab Dis 1996; 19: 31-42. Tu WJ, Dai F, Wang XY and Ho JJ. Liquid chromatography-tandem mass spectrometry for analysis of acylcarnitines in dried blood specimens collected at autopsy from neonatal intensive care unit. Chin Med Sci J 2010; 25: 109-114.
2661
[10] Sun WH, Yang Y, Zhang YP, Li XT, Zhang M, Cao Y and Wang Y. Analysis of clinical features, biochemical analysis and gene mutations in one Chinese pedigree with neonatal-onset ornithine transcarbamylase deficiency. Zhonghua Er Ke Za Zhi 2011; 49: 356-360. [11] Summar ML, Dobbelaere D, Brusilow S and Lee B. Diagnosis, symptoms, frequency and mortality of 260 patients with urea cycle disorders from a 21-year, multicentre study of acute hyperammonaemic episodes. Acta Paediatr 2008; 97: 1420-1425. [12] Tuchman M, Morizono H, Rajagopal BS, Plante RJ and Allewell NM. Identification of ‘private’ mutations in patients with ornithine transcarbamylase deficiency. J Inherit Metab Dis 1997; 20: 525-527. [13] Matsuura T, Hoshide R, Kiwaki K, Komaki S, Koike E, Endo F, Oyanagi K, Suzuki Y, Kato I, Ishikawa K, et al. Four newly identified ornithine transcarbamylase (OTC) mutations (D126G, R129H, I172M and W332X) in Japanese male patients with early-onset OTC deficiency. Hum Mutat 1994; 3: 402-406.
Int J Clin Exp Med 2015;8(2):2656-2661
Original Article Two novel mutations of ornithine transcarbamylase gene identified from three Chinese neonates with ornithine transcarbamylase deficiency Jing Liu1*, Lei Dong2*, Yan Wang3*, Mei Zhang1 Department of Pharmacology, General Military Hospital of Beijing PLA, Beijing 100700, China; 2Department of Surgery and Laboratory of Surgical Oncology, Peking University People’s Hospital, Beijing 100044, China; 3BaYi Children’s Hospital, General Military Hospital of Beijing PLA, Beijing 100700, China. *Equal contributors. 1
Received September 18, 2014; Accepted November 24, 2014; Epub February 15, 2015; Published February 28, 2015 Abstract: We aim to analyze the blood metabolic profiling and the gene mutation of ornithine transcarbamylase (OTC) in three neonates with ornithine transcarbamylase deficiency (OTCD). Three neonates with OTCD were included in this study. The profiling of amino acids and acylcarnitine was determined using MS-MS assay. The OTC exons were amplified using PCR amplification. DNA sequencing was performed, based on which mutation analysis of OTC genes was carried out. For the clinical symptoms, all the three neonates showed poor reaction and feeding. In addition, convulsion and neonatal infection were noticed. A remarkable decrease of citrulline concentration was revealed by MS-MS assay. In case 1, a 548A > G substitution was identified in exon 6, which resulted in replacement of cysteine by tyrosine in codon 183. In case 2, a 1016T > G substitution was identified in exon 10, leading to replacement of valine by glycine in codon 339. In case 3, a 995G > C mutation was noted in exon 9, resulting in missense mutation of tryptophane to serine in codon332. Three types of OTC gene mutations were identified in Chinese neonates with OTC deficiency, among which two novel mutations, including 1016T > G and 995G > C, are presented uniquely in our study. Keywords: Ornithine transcarbamylase deficiency, mutation, ornithine transcarbamylase, MS-MS assay
Introduction Ornithine transcarbamylase deficiency (OTCD) refers to an X-linked genetic disorder of the urea cycle that resulted in elevated ammonia in blood due to decreased activity or complete elimination of ornithine transcarbamylase (OTC) [1, 2]. The presentation of OTCD in males is usually in the neonatal period with a rapidly progressive metabolic encephalopathy, which is characterized by poor feeling, irritability, lethargy, coma, and respiratory failure [2]. The human OTC gene, with a full length of 73 Kb containing 10 exons, is located on the short arm of the X chromosome within band Xp21.1 [3]. To date, mutations of OTC encoding genes have been considered as the main cause for the decrease or elimination of OTC activity [4]. To our knowledge, the phenotype of OTCD is extremely heterogeneous. Until now, more than 379 mutations of human OTC gene have been
identified. As confirmed using molecular methods, only approximately 80% of patients with OTC deficiency are found to have mutations [5]. Studies have been carried out to investigate the mutation of OTC gene in the residents in Asian countries, including Japan and Korea [6-8]. However, rare studies have been carried out to analyze the gene mutation of OTC in Chinese neonates. In this study, a mutation analysis of OTC gene was performed in three infants with OTC deficiency treated in our hospital. We present two newly identified gene mutations in OTC gene, which could add more information to the analysis of OTC polymorphism. Materials and methods Patients Case 1 was a male neonate born to healthy parents. Two days after delivery, the patient
Novel OTC mutations in Chinese OCTD neonates Table 1. Specific primers for the PCR amplification Primers (5’-3’) GAGTTTTCAAGGGCATAGAATCGTC AGGAATCATGGTGATGCATAAAACT CACCATAGTACATGGGTCTTTTCTGA GTTCCAGTTACTACCAGTCCCCTTTTT CACTTATTTGGGGGCTAGTTATTACTTA AAGAGAGGGATTGAAGGTGAAGAC GTTGAGATGATGGCCAATTCTTTGT CAAAGCTGATTTCAGAATCTGATGG GCATTATTAAGCATAATTATCTTAG TAATTCCTGACTTGCTTTAAGTGAA TGGATTTCATCTCCTTCATCCCGTG GAAACTAACCCCTCTCTTAAATCAC CCTAAATAAGATTTAAATTCCTTCCT ATGCTCTCTCAGGTTCATTAATTCC GCCACATATAATAGTCAAAAAGTGG TGGGGAAATAATAAGCAAGTGAGAT TCTAGGTCCCTAAGCAGACTGTCGCT TGTTCTTCAGTAACAGAATGAGTTG
Exon 1 2 3 4 5 6
DNA isolation Peripheral blood was obtained from three cases and two mothers. DNA was isolated using the TIANamp Blood DNA extraction Kit according to the manufacture’s instructions. PCR amplification
7, 8 9 10
showed intermittent convulsion, combined with progressive dyspnea. The blood ammonia was 1000.0 µg/dl. The patient was diagnosed with OTCD using liver biopsy. The patient was lost in the follow up period. Case 2 was a male neonate, who was admitted to our department due to poor reaction and convulsion on day 7 after delivery. His blood ammonia rose rapidly to 1000.0 µg/dl using liver biopsy. He died on day 11. Case 3 was a male neonate, who was admitted to our department due to neonatal pneumonia and convulsion on day 9 after delivery. His blood ammonia rose rapidly to 1000.0 µg/ dl as revealed by liver biopsy. He died on day 10. The protocols were approved by the Ethic Committee of General Military Hospital of Beijing PLA. Acylcarnitine analysis Dried blood samples were prepared by using 25 µl blood, and then were placed to a filter paper. The acylcarnitine analysis of dried blood spots of each patient was performed using liquid chromatography-tandem mass spectrometry (LC-MS/MS) as previously described [9]. Urine metabolites analysis For the collection of urine sample, 2 ml urine was collected and prepared according to the 2657
previous report with slight modification. ULTRAISQ GC-MS instrument (Thermo Fisher Scientific Inc., Waltham, MA, USA) was used for the urine metabolites analysis as previously described by Song et al. In brief, the samples were mixed with urease at 37°C for 15 min. Then daturic acid (200 ppm) was added to the mixture and set as internal standard.
Specific primers targeted the human OTC gene were synthesized by Sangon Biotech (Shanghai, China). In total, 9 pairs of primers were generated targeting the 10 exons in OTC gene (Table 1). PCR reaction was performed in a total volume of 20 μL containing 10 μL 2 × mix, 0.5 μL of each primer, and 1 μL (50~100 ng/μL) DNA template. The PCR conditions used in the amplification were pre-denaturation at 94°C for 3 min, followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing at 56-60°C for 30 seconds, and extension at 72°C for 1 minute. Finally, a final extension was performed at 72°C for 5 minutes. The PCR products were separated in a 2% agarose gel. Sequencing The PCR products were purified and linked to a pUC18 vector. Sequencing was performed using ABI3130 automatic sequencer (Applied Biosystems, CA, USA). The sequencing results were analyzed using Chromas version 2.23. Results Blood metabolic profiling Table 2 summarized the metabolic profiling of the peripheral blood of the patients. The profiling pattern was similar for the amino acids analyzed. The citrulline concentration was near the lower limit of the normal range. In addition, significant increase was noted in the concentration of alanine, glutamine, glutamic acid, histidine, leucine/isoleucine, methionine, piperidine, proline, serine, and tryptophane compared with the normal ranges, respectively. Int J Clin Exp Med 2015;8(2):2656-2661
Novel OTC mutations in Chinese OCTD neonates in 2006 [5]. The latest updated data indicated that a total of 379 mutaAmino acid Case 1 Case 2 Case 3 Reference (μm) tions have been reported. The mutaCitrulline 1.81 1.95 2.67 1.79-15.0 tion of OTC gene was significantly hetAlanine 546.84 826.96 449.07 34.0-418.0 erogeneous between the races. In adGlutaminate 275.82 434.09 161.05 12.0-126.0 dition, the mutation profiling of the Glutamic acid 798.24 1073.30 332.10 43.0-428.0 OTC was remarkably different in variHistidine 254.81 275.62 165.43 25.0-116.0 ous geographical locations. To our knLeucine/isoleucine 231.84 238.10 253.84 28.0-216.0 owledge, only three neonates and five Methionine 99.61 79.00 69.00 8.0-40.0 late-onset children with OTCD have Piperidine 897.27 1376.09 554.07 38.0-523.0 been reported in China mainland [10]. What’s more, gene mutation analysis Proline 1847.03 3081.67 1647.20 273.0-1446.0 was performed in only one neonate Serine 161.98 147.69 133.27 24.0-131.0 and three late-onset children, which Tryptophan 98.83 113.79 24.08 4.0-22.0 revealed one nonsense mutation in Tyroine 164.98 176.94 96.66 6.0-87.0 the OTC gene at the exon 9 (C.958 C > T) causing an arginine to terminate Metabolite analysis of urea the code at position 320 of the protein (R320X). In addition, two other mutations were also The metabolite analysis of the urea indicated detected at intron 9 (C.1005 + 132 InsT) and that the concentration of orotate and uracil intron 5 (C.542 + 134 G > G/A). The authors coshowed remarkable increase compared with ncluded that the mutation of C.958 C > T in OTC the normal range. This indicated the urea cycles gene may occur during neonatal period, which may result in a very severe symptom, even sudwere aberrant in these cases (Figure 1). For the den death several days after birth especially in rest of the metabolites in urea, no statistical boys. difference was noted compared with the normal ranges (P > 0.05). OCT mutation has been considered to be extremely associated with OTC deficiency. To be Structure of mutations and gene analysis exact, neonatal onset patients usually showed significantly reduced or even no residual OTC In case 1, a 548A > G substitution in exon 6 enzyme activity, while patients with residual resulted in the replacement of cysteine by tyroOTC enzyme activity were tended to develop sine in codon 183 (Figure 2A). In case 2, a late-onset disease in childhood with repeated 1016T > G substitution in the exon 10 resulted vomiting or neurological defects or seizures in the replacement of lyophobic amino acid [11]. In Case 1, an A to G substitution was noted (valine) by a hydrophilic amino acid (glycine) in at the 548th base, which resulted in replacecodon 339 (Figure 2B). In addition, a heterozyment of cysteine by tyrosine in codon 183. This gous mutation was noted in the same position substitution resulted in reduced stability of in his mother (Figure 2C). In case 3, a 995G > C ornithine domain, which finally led to decreased was noted in exon 9, which resulted in misseactivity of OTC in neonates as previously desnse mutation of tryptophane to serine in codon cribed. In Case 2, a T to G substitution was no332 (Figure 2D). ted at the 1016nt position in exon 10, which resulted in a replacement of a lyophobic amino Discussion acid (valine) by a hydrophilic amino acid (glycine) in codon 339. In the previous report, a C Extensive studies have been carried out to to G substitution was noted at the 1015nt posiinvestigate the gene mutations resulting in OTC tion in exon 10, leading to a replacement of a deficiency. In our study, we report three misselyophobic amino acid (valine) by a hydrophilic nse mutations in Chinese neonates. Among thamino acid (leucine) in codon 339 [12]. In Case ese mutations, two novel mutations have never 3, a homozygous mutation of G to C was noted been reported previously. in the 995nt position in exon 9, leading to misAccording to the previous description, a total of sense mutation of tryptophane to serine in 341 mutations and 29 nondisease-causing mucodon 332. Previously, a G to A substitution was noted in the 996nt base in exon 9, which tations and polymorphisms have been reported Table 2. Blood metabolite analysis in three cases
2658
Int J Clin Exp Med 2015;8(2):2656-2661
Novel OTC mutations in Chinese OCTD neonates
Figure 1. Gas chromatographic analysis of the urine samples for case 1 (A), case 2 (B) and case 3 (C). Remarkable increase was noted in the expression of uracil and orotate. Chromatography of ions for the case 1 (D).
resulted in tryptophane into termination codon [13]. Thus, we proposed that two novel gene 2659
mutations, including 1016T > G and 995G > C, have never been reported previously. In this Int J Clin Exp Med 2015;8(2):2656-2661
Novel OTC mutations in Chinese OCTD neonates
Figure 2. Mutation analysis of OTC gene. 548A > G was noted in the exon 6 in case 1 (A). 1016T > G was noted in the exon 10 of OTC gene in case 2 (B) and the maternal origin (C). 995G > (C) was identified in exon 9 of OTC in case 3 (D). Arrow stands for the mutation site.
study, gene sequencing was also performed in 2 mothers, which revealed the mutated genes in Case 2 was inherited from his mother who was a carrier of heterozygous mutation with normal phenotype (Figure 2C). In conclusion, we report three OTC gene mutations in Chinese neonates with OTC deficiency. Among these mutations, two novel mutations are presented uniquely in our study. Our study could provide helpful information for the gene mutation analysis of OTC, and contribute to the diagnosis of OTC deficiency in clinical practices, as well as the screening of OTC gene mutation carriers, especially to the neonatal screening of those with family histories. Acknowledgements This work was supported by the National Natural Science Foundation of China (No. 30973210, 81170602 and 81300527). Disclosure of conflict of interest None. Address correspondence to: Dr. Mei Zhang, Department of Pharmacology, General Military Hospital of
2660
Beijing PLA, No. 5, Nanmencang, Dongcheng District, Beijing 100700, China. Tel: +86-10-66721926; Fax: +86-10-84043984; E-mail: zhangmeibj@sina. com
References [1]
[2]
[3]
[4]
Harada E, Nishiyori A, Tokunaga Y, Watanabe Y, Kuriya N, Kumashiro R, Kuno T, Kuromaru R, Hirose S, Ichikawa K and Yoshino M. Late-onset ornithine transcarbamylase deficiency in male patients: prognostic factors and characteristics of plasma amino acid profile. Pediatr Int 2006; 48: 105-111. Venkateswaran L, Scaglia F, McLin V, Hertel P, Shchelochkov OA, Karpen S, Mahoney D Jr and Yee DL. Ornithine transcarbamylase deficiency: a possible risk factor for thrombosis. Pediatr Blood Cancer 2009; 53: 100-102. Lindgren V, de Martinville B, Horwich AL, Rosenberg LE, Francke U. Human ornithine transcarbamylase locus mapped to band Xp21.1 near the Duchenne muscular dystrophy locus. Science 1984; 226: 698-700. Augustin L, Mavinakere M, Morizono H and Tuchman M. Expression of wild-type and mutant human ornithine transcarbamylase genes in Chinese hamster ovary cells and lack of dominant negative effect of R141Q and R40H mutants. Pediatr Res 2000; 48: 842-846.
Int J Clin Exp Med 2015;8(2):2656-2661
Novel OTC mutations in Chinese OCTD neonates [5]
[6]
[7]
[8]
[9]
Yamaguchi S, Brailey LL, Morizono H, Bale AE and Tuchman M. Mutations and polymorphisms in the human ornithine transcarbamylase (OTC) gene. Hum Mutat 2006; 27: 626-632. Ogino W, Takeshima Y, Nishiyama A, Okizuka Y, Yagi M, Tsuneishi S, Saiki K, Kugo M and Matsuo M. Mutation analysis of the ornithine transcarbamylase (OTC) gene in five Japanese OTC deficiency patients revealed two known and three novel mutations including a deep intronic mutation. Kobe J Med Sci 2007; 53: 229-240. Kim GH, Choi JH, Lee HH, Park S, Kim SS and Yoo HW. Identification of novel mutations in the human ornithine transcarbamylase (OTC) gene of Korean patients with OTC deficiency and transient expression of the mutant proteins in vitro. Hum Mutat 2006; 27: 1159. Yoo HW, Kim GH and Lee DH. Identification of new mutations in the ornithine transcarbamylase (OTC) gene in Korean families. J Inherit Metab Dis 1996; 19: 31-42. Tu WJ, Dai F, Wang XY and Ho JJ. Liquid chromatography-tandem mass spectrometry for analysis of acylcarnitines in dried blood specimens collected at autopsy from neonatal intensive care unit. Chin Med Sci J 2010; 25: 109-114.
2661
[10] Sun WH, Yang Y, Zhang YP, Li XT, Zhang M, Cao Y and Wang Y. Analysis of clinical features, biochemical analysis and gene mutations in one Chinese pedigree with neonatal-onset ornithine transcarbamylase deficiency. Zhonghua Er Ke Za Zhi 2011; 49: 356-360. [11] Summar ML, Dobbelaere D, Brusilow S and Lee B. Diagnosis, symptoms, frequency and mortality of 260 patients with urea cycle disorders from a 21-year, multicentre study of acute hyperammonaemic episodes. Acta Paediatr 2008; 97: 1420-1425. [12] Tuchman M, Morizono H, Rajagopal BS, Plante RJ and Allewell NM. Identification of ‘private’ mutations in patients with ornithine transcarbamylase deficiency. J Inherit Metab Dis 1997; 20: 525-527. [13] Matsuura T, Hoshide R, Kiwaki K, Komaki S, Koike E, Endo F, Oyanagi K, Suzuki Y, Kato I, Ishikawa K, et al. Four newly identified ornithine transcarbamylase (OTC) mutations (D126G, R129H, I172M and W332X) in Japanese male patients with early-onset OTC deficiency. Hum Mutat 1994; 3: 402-406.
Int J Clin Exp Med 2015;8(2):2656-2661
