VIROLOGY

178,92-l

03 (1880)

Ubiquitous and Cell-Type-Specific Protein Interactions with Human Papillomavirus Type 16 and Type 18 Enhancers HARIKRISHNA NAKSHATRI, MARY M. PATER,’ AND ALAN PATER Division of Basic Medical Sciences, Faculty of Medicine,

Memorial

Received November

University

of Newfoundland,

St. John’s, Newfoundland

A 1B 3V6 Canada

3, 1989; accepted May 2, 1990

We have studied the protein-DNA interactions of human papillomavirus types 16 and 18 constitutive enhancer elements using DNasel footprinting experiments with nuclear extracts from four cervical carcinoma cell lines (C33A, HeLa, SiHa, and CaSki) and one fibroblast cell line (1438). Among nine footprints for the HPV 16 enhancer region, six footprints contain nuclear factor 1 (NFl) binding GCCAA motif. ln vitro competition experiments suggest that the same factors are shared by all six of these motifs. Two other sequence motifs have consensus sequences for transcription factor APl. Another sequence motif, for which uv crosslinking studies reveal interaction with four protein molecules, is a strong positive modulator of HPV 16 enhancer function in vivo and shares 100% homology to a sequence motif, GTmAA, in the tissue-specific enhancer of the c-mos oncogene. Footprints on the HPV 18 enhancer show five protected regions with homologies to NFl, APl , and EFII transcription factor binding motifs. One sequence motif of the HPV 18 enhancer has three repeats of a TFITA sequence contained within the c-mos sequence motif and interacts CI 1990Academic PWSS, IN. with at least four different individual polypeptides, as judged by uv crosslinking experiments.

Cripe et a/. 1987; Marshall et a/. 1989). Similar experiments with HPV 18 provided evidence for a 230 bp cell type specific enhancer (Gius et al. 1988; Marshall et al. 1989; Swift et a/. 1987). Moreover, DNase footprinting experiments have revealed the presence of several sequence motifs within the enhancer of these viruses (Garcia-Carranca, 1988; Gloss et a/. 1989a). In addition to these constitutive enhancer elements, inducible enhancer domains responsive to viral gene E2 products have also been identified (Cripe et a/. 1987; Gius et a/. 1988; Gloss et al. 1987; Garcia-Carranca et al. 1988). Another enhancer region distinct from the E2 inducible enhancer found in HPV 16 is also inducible by glucocorticoid hormones (Gloss et a/. 1987; Pater et a/. 1988). To further analyze the cell-type-specific expression by the enhancer of HPV 16 and 18, protein-DNA interactions in four epithelial cervical cell lines and a noncervital fibroblast cell line were examined. DNase protection experiments illustrated nine footprints within HPV 16 enhancer and five protected regions within the HPV 18 enhancer. The results of in vitro and in viva competition experiments for the unique protected regions in the enhancers of these viruses are discussed.

INTRODUCTION Human papillomavirus (HPV) types 16 and 18 have been found frequently in human genital cancers (Boshart et a/. 1984; Durst et al. 1983). The DNA and RNA transcripts of these viruses are detected in cervical tumours and tumour cell lines (Schwarz et al. 1985; Pater and Pater, 1985; Yee et al. 1985; Smotkin and Wettstein, 1986; Baker et a/. 1987; Pater and Pater, 1988). Their persistence in tumour cells and the transforming activity of the total genome or the E6-E7 region of HPV 16 and HPV 18 strongly suggest that their gene products play an important role in the process of malignant transformation (Bedell et al. 1987; Matlashewski et al. 1987; Pater et a/. 1988; Phelps et a/. 1988). Similar to a number of other HPV types, HPV 16 and HPV 18 have been found in human epithelial cells of diverse origin but HPV 16 and 18 virus growth and expression are most favourable in epithelial cells of the female and male genital region. Functional analyses of their genomes have provided evidence for epithelial cell specific promoter and enhancer elements which control the viral gene expression (Cripe et a/. 1987; Gius eta/. 1988; Gloss eta/. 1987; Marshall eta/. 1989; Swift et a/. 1987; Thierry eta/. 1987). Extensive deletion mutation analyses have identified a 224 nucleotide keratinocyte dependent enhancer of HPV 16 located upstream of E6 open reading frame (Gloss et a/. 1987;

MATERIALS Construction

0042.6822/90

$3.00

and assays of recombinant

clones

The construction of plasmids T-3 and T-81 containing the 554-bp Sspl-Hphl fragment of HPV 16 (nucleotides 7224 to 7778) and 230-bp Rsal fragment of HPV

’ To whom requests for reprints should be addressed.

Copyright 0 1990 by Academic Press, Inc. All rights of reproduction in any form reserved.

AND METHODS

92

DNase

PROTECTION

OF HPV 16 AND

18 (nucleotides 7508 to 7738), respectively, in the enhancerless-SV40 promoter-chloramphenicol acetyltransferase (CAT) vector is described elsewhere (Marshall et al. 1989). All cells were maintained in Dulbecco’s modified Eagle’s medium with 10% fetal calf serum. The calcium phosphate precipitation procedure was used for transfections. CAT assays were performed 48 hr post-transfection according to Gorman et al. (1982) and quantitated by liquid scintillation counting. Preparation

of probes

Enhancer fragments of HPV 16 (nucleotides 7224 to 7778) and HPV 18 (nucleotides 7508 to 7738) were first cloned into the Xbal site of pUC-19. The derivative plasmids were digested with either Sphl and Sal1 (HPV 16) or Smal and Sall (HPV 18) and enhancer fragments were separated on agarose gels and electroeluted. For DNasel footprinting, end-labelling at the Sal1 site was by reverse transcriptase. For labelling the noncoding strand, BarnHI- and WI-restricted fragments were used. For gel retardation and uv crosslinking experiments, probes were prepared by nick translation in the presence of [a-32PldCTP and 5-bromodeoxyuridine. Nuclear extracts

and DNasel footprinting

Nuclear extracts and DNasel footprinting were performed according to Hennighausen and Luban (1987). In competition experiments, the same enhancer fragments as the probes were used. A 323-bp Pvull fragment of pUC-19 DNA served as control. In all oligonucleotide footprint competition experiments, complementary strands of synthetic oligonucleotides were hybridized according to Kadonaga and Tjian (1986) and used directly in the binding reaction. An oligonucleotide, sequence 5’AAGGGAAGGGATGG3’, part of the JC virus (XV) enhancer (Frisque et a/. 1984) was used as a control. Gel retardation

and uv crosslinking

Ultraviolet crosslinking and gel retardation assays were performed as described by Chodosh et al. (1988) with the following modifications. The incubation reaction contained only poly(dl . dC) to reduce background. Binding reactions were exposed to uv light for 20 min prior to loading and gels were run at 4” with constant circulation of buffer. To determine the molecular weight sizes of interacting proteins, protein-DNA complexes in gel-shift bands were eluted, heated at 85” for 10 min in sodium dodecyl sulfate-polyacrylamide gel electrophoresis sample buffer, and then subjected to electrophoresis through 10% polyacrylamide-sodium

18 ENHANCERS

93 TABLE 1

ACTIVITY~OF HPV 16 AND HPV 18 CONSTITUTIVEENHANCERS IN CERVICALAND FIBROEIIJYST CELL LINES Plasmids

C33A

HeLa

StHa

CaSki

143B

pA1 Ocat pSV2cat T-3 T-81

1 .o (0.4) 893 (357) 4 0 (1.7) 35 (14.1)

l.O(O.1) 160 (15.80) 10.0 (1 .O) 19(1.9)

1 .o (0.7) 30 (20.7) 11 (7.9) 4 5 (3.0)

l.O(O.3) 13 (4.0) 1 .o (0.3) 1 .o (0.3)

l.O(O.3) 23 (6.9) 1 .o (0.3) 1 .o (0.3)

a 10 fig of test plasmid is used along wtth 10 pg of pUC-19 DNA. Cellular extracts were prepared 48 hr post-transfectlon. CAT actlvlty of pA1 Ocat IS normalized to 1 .O and fold activation above pA1 Ocat level by different enhancers IS presented. Numbers in parentheses are the actual percentages of conversion of substrates. Results are averages of duplicate experiments.

dodecyl sulfate gels along with “C-labelled weight protein markers.

molecular

RESULTS HPV 16 and 18 enhancer fibroblast cell lines

activities

in epithelial

and

Transient assays with plasmids, in which the reporter gene CAT is expressed from HPV enhancer, were used to measure the enhancer function. Assays were performed with the four cervical carcinoma cell lines, C33A, HeLa, SiHa, and CaSki, which contain and express, respectively, no HPV, HPV 18, HPV 16, and HPV 16 DNA (Pater and Pater, 1985) and one fibroblast cell line, 143B. The activity of the enhancerless SV40 promoter containing pA1 Ocat, from which HPV 16 enhancer plasmid T-3 and HPV 18 enhancer plasmid T81 were derived, was taken as the basal level of activity. Activity of HPV enhancers in different cell lines are presented in Table 1. To allow better comparisons between different cell types and to avoid ambiguity due to differences in plasmid uptake, SV40 enhancer--promoter construct pSV2cat was included as a positive control. In relation to pSVilcat, HPV 16 enhancer construct T-3 showed the highest level of activity in SiHa followed by HeLa and C33A cells. No increase in activity over pA1 O-cat levels was observed in CaSki or 143B cells. Similar experiments with HPV 18 enhancer construct T-81 showed the highest level of activities in C33A followed by HeLa and SiHa. As for the HPV 16 enhancer, HPV 18 enhancer did not increase pA1 Ocat activity in CaSki and 143B cell lines. The activity of pSV2cat is also low in CaSki and 143B in comparison to other cell types. To examine the possibility that the lower activity of pSV2cat might be due to lower transfection efficiency of the calcium phosphate coprecipltation procedure in these cell types, we repeated these

NAKSHATRI , PATER, AND PATER

FIG. 1. DNase protection analysis of HPV 16 constitutive enhancer. Probes were incubated with nuclear extracts from (A) C33A, (B) HeLa, (C) SiHa. (D) CaSki, and (E) 1438 cells and subjected to DNasel digestion. Chemical cleavage of purines are in lanes A/G. DNA treated with DNasel in the absence and presence of nuclear extracts are in lanes F and 6, respectively. Lanes 1 to 8 represent competition experiments in which nuclear extracts and probe were incubated with unlabeled competitor DNA before DNasel digestion. Competitors were HPV 11 DNA in lanes I and 2, HPV 16 DNA in lanes 3 and 4, HPV 18 DNA in lanes 5 and 6, and pUC-19 Pvull fragment (323 bp) control DNA in lanes 7 and 8. Oddnumbered lanes had 10 ng and even-numbered lanes had 50 ng of competitors. Protected regions are indicated by brackets labelled I to IX. A: HPV 16 enhancer was radioactively labelled on the coding strand. B: Label was on the noncoding strand.

experiments using the electroporation method. However, CAT activity was the same as when the calcium phosphate procedure had been used (data not shown). The lower level activity of HPV 16 enhancer in CaSki is surprising as the integrated HPV 16 DNA is expressed in this cell line. One possible explanation is that CaSki contains fewer transcription activation factors. This is supported by the DNAsel footprinting results of Figs. 1 A and 1 B, in that protection is weaker and competition

by the various HPV enhancer fragments is much more pronounced, even at low concentrations, for CaSki nuclear extracts as compared with the other nuclear extracts. Also, our preliminary results of gel retardation assays have shown relatively low levels of factors binding to oligonucleotide corresponding to some of the protected regions. Taken together, these results document cell-type variability of HPV 16 and 18 enhancer function even though all three HPV expressing cell

DNase

PROTECTION

OF HPV 16 AND 18 ENHANCERS

FIG. l-

lines were derived from human cervical were of epithelial origin.

cancer and

Protein-binding motifs within the constitutive enhancer of HPV 16 and 18 In order to study in more detail the HPV 16 and 18 enhancers’ cell-type specificity, we analyzed the cellular protein-DNA interactions by DNasel footprinting. Figure 1 documents footprints obtained for HPV 16 enhancer. Sequences within footprints numbered I to IX are presented in Table 2. Most of the protected regions for HeLa extracts were as reported by Gloss et a/. (1989a); although the protection of region I was not reported, protection of regions II through IX were, and were designated as fp2e, fp3e, fp4e, fp5e, fp6e, fp7e, fp8e, and fp9e, respectively. Regions II, III, V, and VII

95

Contmued

are protected in all five cell lines tested, although protection of region II was partial in SiHa and CaSki. Region Ill protection was extended in C33A (for the coding strand only; Fig. 1A) and region VII protection was a shorter distance towards the region VI proximal side in CaSki. Region I is protected completely only by C33A and 143B extracts (for the coding strand, but not the noncoding strand; compare Fig. 1A to 1 B), while region IV is protected completely in 143B and partially in CaSki cell extracts. Although the coding strand did not show any protection of region I by HeLa and CaSki nuclear extracts, a partial protection of this region is evident in the noncoding strand (Fig. 1 B). Closer observation of C33A and 143B footprints in Fig. 1B reveals that regions I and II are separated by only a single nucleotide in the noncoding strand. Region VI is protected in all cell lines except CaSki, while region VIII IS

96

NAKSHATRI,

PATER, AND PATER TABLE 2

SEQUENCESANDLOCATIONSOFHPV16 AND HPV18 PROTECTEDREGIONSANDCELLLINESFORWHICHPROTECTIONISOBSERVED Cell lines Regionsa HPV 16 I II Ill IV V VI VII VIII IX HPV 18 I II Ill IV V

Sequence@

TATGGTTTAAACTTGTACGTTTCCTG TGATACCAAATTTGAACATGCAAAGGA CCATGCGTGCCAAATCCCTGT GGTACGCACGGTT CTGCIACTGCT(TGCCAACCATTC(CATTGTTTTTAC)d G TGACGAACGGTTGGT CTGAATCACTATGTA ACTATGCGCCAAC TTGGCTTGTTTTAAC (AACC)eTAATTGCATATTTGGCATAAGGTTT TCTAAGWCTAAA GTAAAGGTTAGTCATACA

Nucleotide numbers’

7515-7540 7513-7542 7545-7565 7545-7557 7575-7595 7578-7593 7630-7643 7667-7679 7710-7724 7726-7754 7760-7775 7803-7820

CTTTTGGGC)ACTGCTICCTACA ACCCGTGACGAGGATGTA CCTCTm ACCGCGTATA [TGGTATITAGTCATTTTC ACCATAATCAGTA AACAATTGCTTGCATAACTATA --++---

7536-7556 7540-7557 7577-7586 7583-7592 7603-7619 7603-7615 7637-7658

AAEi%i$TJGGCACATATTTTAGTT

7673-7704

C33A

HeLa

SiHa

+ + + t (+ld

CaSki

1438

+ t + t +/+ (+I" + t t t t +I-

+

-

+/t t t +I-

-

-a Numerals I to IX In HPV 16 and I to V in HPV 18 are the same as the regions marked in Figs. 1 and 2, respectively. b NFl GCCAA motifs are underlined. Broken underlines indicate putative APl binding motifs. Palindromic sequences are above the arrows. An EFII motif in HPV 18 region IV is overlined. Repeated sequences TTTTA are double underlines. Sequences shared by HPV 18 regions I and V are boxed. Sequences in region Ill of HPV 18 and present in adenovirus ElA repressed enhancer elements are shown by square brackets. c Nucleotide numbers are according to Seedorf eta/. (1985) for HPV 16 and Cole and Danos (1987) for HPV 18. dThe sequences in parentheses were protected for C33A only in the coding strand but for all cell lines in the noncoding strand. e The sequences in parentheses were not protected for CaSki.

protected more completely in C33A (see also Fig. 3 for a darker B lane) and SiHa, poorly in HeLa and not detectably in CaSki and 143B. Region IX showed little or no protection in SiHa. The specificity of binding is confirmed by footprint competition experiments using unlabelled enhancer fragments of HPV 16. As presented in Figs. 1A and 1 B, homologous HPV 16 DNA competed for all protected regions, while control pUC-19 DNA failed to eliminate protection in regions II to IX. Protection for region I appears to be competed to a lesser extent by nonspecific competitor pUC-19 DNA. This could be due to homologous or related sequences present in pUC-19 DNA. Since this region shows celltype variability, we feel that region I represents specific DNA-protein interactions. A computer search of different HPV enhancer elements showed distinct blocks of homology among the enhancer sequences of HPV types 11,16, and 18. This

suggested to us that these three HPVs, which share cell specificity for epithelial tissues of the reproductive system, might also share similar mechanisms in enhancer activation. Therefore, we tested whether HPV 11 and 18 enhancers could compete for HPV 16 enhancer DNA-protein interaction. For this purpose, we used the 213-bp (nucleotides 7657-7876) constitutive enhancer element of HPV 11 (Hirochika et a/. 1988; Marshall et al. 1989) and the 230-bp enhancer fragment of HPV 18 (Marshall eta/. 1989; Swift eta/. 1987; Thierry et al. 1987). HPV 1 1 enhancer competed for all regions except I and IX in most of the cell lines, while HPV 18 enhancer competed for all regions tested in most of the cell lines (Fig. 1). The results of HPV 18 enhancer footprinting experiments is shown in Fig. 2. Nucleotide sequences of the protected region along with cell lines for which protection is observed are in Table 2. Protected regions III and

DNase

PROTECTION

OF HPV 16 AND

IV had been previously identified by Garcia-Carranca et al. (1988) and designated as sites V and VI, respectively. In addition to the five protected regions, three hypersensitive sites were also observed. Cell-type variability is evident among all protected regions All five regions are protected by C33A extracts. For HeLa, regions I, II, and III showed complete protection, while region IV showed only partial protection. No protection for region V is observed in this cell line. Regions I and II (partial in noncoding strand) are protected in SiHa, while region I (partial in both strands), II (in noncoding strand), III, and IV (partial in noncoding strand) are protected in CaSki. Only one of the three hypersensitive sites are observed in CaSki. Regions I, II, and Ill are protected in 143B cell lines. Addition of unlabelled HPV 18 DNA Into the binding reaction competed all of the protections, although some of the competition was more evident with noncoding strand footprints confirming the specificity of binding. Enhancer elements from the other two HPVs, types 11 and 16, were also used in competition experiments. HPV 11 enhancer competed for region I, mainly in HeLa (Fig. 2A). Similarly, protections were eliminated upon addition of unlabelled HPV 16 enhancer into the binding reaction. Hypersensitive sites were also frequently lost or diminished by competition by the three HPVs. No competition was observed for the control pUC-19 DNA, as shown in lane 8, Fig. 2A. Oligonucleotide competition DNase-protected regions

studies of

Among the nine footprints for the HPV 16 enhancer, regions II, III, V, VI, VII, and VIII contain nuclear factor 1 (NFl) binding consensus sequence 5’GCCAA3’ (Jones et al. 1988). To study whether the same or related factors bind to these regions, we performed footprint competition experiments with synthetic oligonucleotides corresponding to region III, region VI without the AGCCAA sequence, and region VII. C33A extracts were used, as they gave the strongest DNasel protection and gave least competition for NFl -containing regions (Fig. 1). These cells, thus, have the highest level of DNA binding factor(s). This higher level should allow a wider range for the detection of competitions by the three oligonucleotides which might have different binding affinities for factor(s). All three oligonucleotides competed mainly for regions containing GCCAA motifs that are protected by C33A extracts (regions II, III, V, VI, VII, and VIII; Fig. 3A, lanes 1, 2, and 3, and Table 3). However, there clearly were marked differences in the competition patterns for these three oligonucleotides. (1) Only the region VI oligonucleotide significantly affected the non-NFl-containing region I footprint. (2)

97

18 ENHANCERS

Complete competition of region II and III footprints by region III oligonucleotide exceeded that by region VII oligonucleotide, which in turn exceeded that by region VI oligonucleotide. (3) Comparable partial protection was observed by competition for regions V and VI for all three oligonucleotides. (4) Complete competition of region VII footprint by region III oligonucleotide compared with partial competition by the other two oligonucleotides. Competition experiments were also performed with oligonucleotide corresponding to region IX (Fig. 3B, lane 4), which does not contain the GCCAA motif. HeLa cell extract was used since it afforded weaker DNase protection and stronger competition than C33A (Fig. 1A), suggesting the sequences would be more efficiently competed by this oligonucleotide. Competition was effective only for the homologous region (Fig. 3B, lane 4). In all oligonucleotide competition experiments, control oligonucleotide, lane J, did not show any effect on footprints. Oligonucleotide competition experiments of HPV 18 enhancer are shown in Fig. 3C and summarized in Table 3. Region IV oligonucleotide competed for the homologous region and poorly to region V. Interesting results were obtained by the oligonucleotide for region V. In addition to competing for its homologous region, this oligonucleotide competed effectively for all the protected regions and the three hypersensitive sites. These competitions were stronger than with the total enhancer fragment (Fig. 2). This effect of region V oligonucleotide could be due to sharing of some transcription factors by this motif with other regions since we detected the Interaction of more than one protein in this region (see below). Characterization

of enhancer

binding factors

Ultraviolet crosslinking and the gel retardation assay for the sequence TGTTTTAA within the HPV 16 region VI motif yielded one DNA-protein complex (Fig. 4, I, left). This DNA-protein complex was eliminated upon addition of homologous but not heterologous competitor DNA, thus confirming the specificity of the DNAprotein interaction. The abundance and molecular weights of individual interacting proteins were obtained by electroelution of the DNA-protein complexes and subsequent analysis on an SDS-polyacrylamide gel (Fig. 4, I, lane a). Four major proteins of molecular weights 80, 59, 54, and 50 kDa appear to interact with this sequence motif. Our efforts to analyze the DNAprotein interaction on the other sequence motifs of HPV 16 by the same technique were unsuccessful. Possible requirement of both T and C residues of the DNA-protein contact point, to obtain both crosslinks and radioactive label, is one of the limitations of this

98

NAKSHATRI,

PATER, AND PATER

FIG. 2. DNasel footprinting of HPV 18 enhancer. HPV 18 enhancer DNA was used as probe. Nuclear extracts, competitors, as in Fig. 1. In addition to the five protected regions numbered I to V, three hypersensitive regions are indicated by arrows.

technique. This might explain why other HPV 16 sequence motifs could not be used successfully. The results of uv crosslinking and gel retardation experiments with monomeric oligonucleotide of region V of HPV 18 are presented in Fig. 4, II. A total of four DNA-protein complexes which were competed by homologous competitor DNA are shown in Fig. 4, II, left. DNA-protein complexes analyzed on the SDS gel indicate that three major proteins of molecular weights 54, 50, and 46 kDa and a minor protein of 80 kDa interact with this motif. It appears that for the four bands seen in the gel shift assay in Fig. 4, II, left, the slowest migrating species represents a complex of four distinct pro-

and labelling are

teins, the next slowest band is the same complex from which one particular protein has been dissociated, etc. Alternatively, the shift in the mobility could also arise from protein-protein interactions which are not detectable in this technique. In viva competition

for HPV 16 enhancer

motifs

To test the functional relevance of some of the protections observed in vitro, we performed in vivo competition experiments (Fig. 5). Cotransfection of a plasmid containing the sequences of the HPV 16 DNasel protection region III decreased expression from the HPV

DNase

PROTECTION

OF HPV 16 AND

E

99

18 ENHANCERS

APl binding motif, TGAGTCA, by one nucleotide, showed complete protection only for 143B, although others have obtained protection for this same region

C FB123JF

856

JF

r

FIG. 2--Contmued

16 enhancer CAT construct by up to 40%. Region IX plasmid had a similar effect, while a greater effect was observed for region VI plasmid. Thus, all three protected regions appear to bind transactivating protein factors. The same competitor plasmids had little or no effect on SV40 enhancer dependent pSV2cat expression, suggesting that few transcription factors are shared by the two enhancers. DISCUSSION We have provided evidence for DNA-protein interactions with the enhancer elements of the two oncogenic human papillomaviruses, types 16 and 18. The HPV 16 enhancer fragment contained nine DNasel-protected regions, of which six contained nuclear factor 1 (NFl) binding GCCAA motif (Table 2). Therefore, NFl could play an important role in the control of HPV expression. There are three protected regions which do not contain NFl-binding sequences. Among them, region I does not show homology to any known transcription factor motif. Region IV, containing the sequence, TGAATCA, which differs from the transcription factor

FIG. 3. Olrgonucleottde competrtron of footprints Lanes F are for DNase drgestion in the absence of protein or competitors, lanes B are for samples not treated with competitor olrgonucleotrdes, and lanes J are for the control JCV olrgonucleotrde. Competrtor olrgonu cleotrdes were for HPV 16, region Ill In lane 1, the TGTITTAA se quence of regron VI In lane 2. region VII In lane 3, and region IX 111 lane 4; competrtor olrgonucleotrdes for HPV 18 were region IV tn lane 5 and region V in lane 6. For panels A and R the probe was HPV 16 DNA and cell extracts were C33A and HeLa, respectrvely. while for panel C probe was HPV 18 DNA wrth C33A extract. For all olrgonucleotrdes, 100 ng was Incubated with extracts before the addrtron of probes

100

NAKSHATRI,

PATER, AND PATER

TABLE 3 SUMMARYOF OLIGONUCLEOTIDECOMPETITION OF DNASEI FOOTPRINTING

Competitor

oligonucleotides

HPV16 CTGCTTGCCAACCATT TGTFl’TAA AACCTAATTGCATATI-TGGCATAAGGTTT TAAAGGTTAGTCATACA HPV 18 AACAATrGCTTGCATAACTATA AATAAAACTGCl-flTAGGCACATATll-TAGlT Control AAGGGAAGGGATGG

Corresponding protected region in Figs. 1 and 2

Competed regions in Fig. 3

III VI VII

II, Ill, v, VI, VII, VIII I, Ill, v, VI. VII, VIII II, Ill, v. VII, VIII

IX

IX

IV

I, III

V

I, III, IV, V, and hypersensitive sites None

for HeLa cell extracts (Gloss et al. 1989a). Region IX, which contains a consensus sequence TTAGTCA for transcription factor API, acts as positive modulator of HPV 16 enhancer function in C33A cells (Fig. 5). Regions II, III, and VII, although protected in all cell types tested, show striking differences in the degree and extension of protection. These differences could be attributable to both quantitative and qualitative differences in factors which either bind DNA directly and/or influence the binding of other factors. In support of this, gel retardation assays using region VII oligonucleotide show two bands for C33A, HeLa and SiHa, but only one band for CaSki and 143B nuclear extracts (data now shown). This could explain why CaSki region VII protection is readily competed by low levels of HPV DNA (Fig. 1A). Similarly, region III shows extended protection and weakest competition for C33A extracts, suggesting that C33A contains more interacting factors than CaSki or 143B cells. The strength of the protection/competition for region VI of HPV 16 suggests that the levels of factors in cells can be ranked C33A, greater than HeLa, greater than SiHa and 143B, greater than CaSki. An interesting feature for region VI is that it contains two distinct motifs: GCCAA and GTfTTAA. As well as containing the llTTA sequence repeat of the HPV 16 region III and the HPV 18 region V(Table 2) the second motif is 100% homologous to a protected region of the enhancer element in the c-mos oncogene (van der Hoorn, 1987). Ultraviolet crosslinking experiments have indicated the interaction of four different proteins to this region (Fig. 4, I) and in viva competition experiments suggest that DNA-protein interactions in this re-

gion function as a strong positive modulator of enhancer function (Fig. 5). This region overlaps with T-l-TGGPylTfound in enhancer motifs of cytokeratin genes (Blessing et al. 1987). This cytokeratin motif has been thought to have a role in cell-type-specific gene expression (Blessing et a/. 1987; Cripe et a/. 1987). Although epithelial and fibroblast cell lines produced identical footprints in this region, it is possible that factors binding to this motif are functionally different in different cell types. Since more than one factor binds to this motif (Fig. 4) there may be analogy to the octomer motif of SV40 and immunoglobulin enhancers in which two factors can bind the same element, with only one conferring cell-type-specific function (Davidson et al. 1986; Gerster et a/. 1987; Schaff ner, 1989; Wirth et al. 1987). Oligonucleotides corresponding to three protected regions of HPV 16 containing NFl binding sites were tested for their ability to compete for enhancer binding factors. All three oligonucleotides competed for five or six of the six regions containing the GCCAA motif (Fig. 3A; Table 3). Similar results have been obtained by others using oligonucleotides corresponding to region III

II

I FECl

a

FBCJ

bcde

FIG. 4. Gel retardation and uv crosslinking. Oligonucleotides were nick translated in the presence of [32P]dCTP and 5’.bromodeoxyuridine and incubated with C33A extracts, uvirradiated, and then run by electrophoresis on native polyactylamide gels. Incubation was without extract or competitor oligonucleotides in lanes F, with 8 pg of C33Aextract in lanes B. with extract plus unlabelled HPV competitor oligonucleotides in lanes C, and with extract plus the JCV nonspecific competitor oligonucleotide in lanes J. In lanes a to e, the respective gel shift bands visualized in lanes B were subjected to SDS-polyacrylamide gel electrophoresis. (I) A 28mer oligonucleotide containing two direct repeats of the TGTTFTAA sequence within HPV 16 protected region VI was used. (II) Oligonucleotide was HPV 18 protected region V.

DNase r-3

LL

PROTECTION

OF HPV 16 AND

PSVZCAT

COM PESITd”R

FIG. 5. Competition for the HPV 16 enhancer dependent CAT expression in the C33A cell line. In the T-3 graph, 5 wg of HPV 16 CAT plasmrd, T-3, was cotransfected with 0, 5, 10, and 20 fig of competrtor pUC-19 plasmids contarning two drrectly repeated copies of DNasel protection regions Ill (A), VI (0) and IX (0). The activity of T-3 in the absence of any competitor IS 100%. In the pSV2cat graph, 5 fig of pSV2cat was cotransfected with the same competitor plasmrds as the control. Total quantrty of DNA used in transfection was adjusted to 25 pg by the additron of pUC-19 DNA. Results are averages of four and two experiments for T-3 and pSV2cat. respectrvely.

and the adenovirus NFl binding site (Gloss et al. 1989a,b). However, by using different oligonucleotides, we have been able to find marked differential effects. The competitions observed were quantitatively different for the oligonucleotides tested and regions competed. While oligonucleotides for protected regions III, VI, and VII have comparable effects on the protected regions V and VII, regions I, II, III, and VI are differentially affected. Only oligonucleotide for region VI significantly affects region I protection. Competition for regions II and III is greatest by oligonucleotide for region III, intermediate by oligonucleotide for region VII, and low by oligonucleotide for region VI. Competition for region VI was only by oligonucleotides for regions III and VI. The differential effect of oligonucleotides might be explained by one or more of the following mechanisms. (1) Binding of NF1 adjoining sequence specific factors differentially influences binding of common, GCCAA-specific factors. (2) Binding of NFl-specific common factors is influenced by the sequences adjoining the GCCAA sequences. (3)The factor(s) binding to GCCAA motif interacts cooperatively with factors binding to adjoining regions. The latter mechanism is supported by the observation by Gloss er al. (1989b) that for regions IV, V, and VI, with increased factor levels, protection on the noncoding strand is fused into one long protected stretch. Also, competition of GCCAA-motif-containing regions by region VI specific oli-

18 ENHANCERS

101

gonucleotide without its GCCAA motif could be due to cooperative interaction of some factor(s) other than NFl, consistent with our uv crosslinking studies which indicate the interaction of at least four proteins. The constitutive enhancer of HPV 18 contained five protected regions (Fig. 2). Region I, which is protected in four of the five cell types tested, contains the sequence GCACTGCTCC, which is identical to the central portion of the GAL4 binding site present in GAL1 0 gene of yeast (Wingender, 1988) and contains an interesting ACTGCT sequence discussed below. Extension of this protected region to a hypersensitive site (central arrow in Fig. 2) would include a sequence, TGCCCAA, which differs from an NFl binding motif by only one nucleotide. Furthermore, protection of this region is competed by the enhancer elements of HPV 11 and 16 enhancers which contain NFl binding motifs. Region II contains the NFI consensus motif, GCCAA. The sequence motif, TTAGTCA, present in the protected region Ill of HPV 18, is also a consensus sequence for API. The sequence protected in region III also has homology to a consensus sequence, GTGGTATG, present in enhancer elements repressed by the adenovirus Ela gene product. This could be important, since Swift et al. (1987) and Thierry et al. (1987) have shown that Ela gene products of adenovirus can repress the HPV 18 enhancer function. Region IV of HPV 18 contains the sequence, mATGCA, which is homologous to the EFII binding motif of Rous sarcoma virus LTR (Sealey and Chalkley, 1987). In addition, this region has homology to the responsive element for the TIF (trans-inducing factor) gene of herpesvirus type I (Kristie and Roizman, 1988). Gius and Laimins (1989) have shown that TIF can activate HPV 18 enhancer dependent expression in cells of epithelial origin and suggest that the effect could be mediated through sequences overlapping region IV. It is thus es sential to determine the importance of these sequences and their interacting proteins in TIF-mediated transactivation. Additionally, a recent report by GarciaCarranca et al. (1988) places HPV 18 region IV within the enhancer region responsible for tissue specific expression. Therefore, it will be of interest to mutate these sequences to assess therr functional significance. Ultraviolet crosslinking studies with oligonucleotides corresponding to region V, as observed for C33A cell extracts, indicate interactions with at least four proteins (Fig. 4, II). This oligonucleotide competed very effectively for all protected regions to a degree greater than the complete HPV 18 enhancer fragment (Fig. 3C and Fig. 2). A unique feature of region V is the inversely repeated sequence TTTTA, which is also present within protected regions Ill and VI of HPV 16. It is POSSI-

NAKSHATRI.

102

PATER. AND PATER

ble that some of the proteins interacting with these motifs may be same. The 50- and 54-kDa proteins identified in our uv crosslinking experiments are the likely candidates. The reason for general protection of the TllTA-motif-containing region VI of HPV 16 and C33Aspecific protection for HPV 18 region V (while extension of protection is observed for HPV 16 region Ill) could involve other cell-type-specific proteins (possibly the 46 kDa protein) and/or a higher level of proteins found only in C33A. Additionally, the llTTA and the adjacent ACTGCT sequences in HPV 18 region V show interesting correlations. (1) Neither sequence is present in the enhancer motifs of nononcogenic HPV 11 (Nakshatri, Pater, and Pater, unpublished observation). (2) Region V oligonucleotide of HPV 18, containing inverse copies of the llTTA sequence flanking the ACTGCT sequence, competed very effectively with the region I protected site which has homology only to the ACTGCT sequence of region V. An interesting possibility is that the mechanism by which the factor(s) binding HPV 18 region V functions is by interacting with all the other sites or the factors bound to them. Mutational analysis are required to assess the functional significance of these individual motifs.

ACKNOWLEDGMENTS We thank H. zur Hausen and L. Gissmann for HPV 16 and 18 DNAs and K. G. Ross for typing the manuscript. H. N. has been a predoctoral fellow of the Cancer Society Inc.. Montreal, Quebec, and more recently of the National Cancer Institute of Canada. This work is supported in part by MRC and NCI of Canada.

REFERENCES BAKER, C. C., PHELPS, W. C., LINDGREN, V., BRAUN, M. J., GONDA, M. A., and HOWLEY, P. M. (1987). Structural and transcriptional analysis of human papillomavirus type 16 sequences in cervical carcinoma cell lines. /. !I;ro/. 61, 1962-l 971. BEDELL, M. A., JONES,K. H., and LAIMINS, L. A. (1987). The E6 and E7 open reading frames of human papillomavirus type 18 are sufficient for transformation of NIH 3T3 and Rat-l cells. /. wrol. 61, 3635-3640. BLESSING,M., ZENTGRAF, M., and JORCANO,J. L. (1987). Differentially expressed bovine cytokeratin genes. Analysis of gene linkage and evolutionary conservation of 5’ upstream sequences. EM60 J. 6, 567-575. BOSHART,M., GISSMANN, L., IKENBERG,H., KLEINHEINZ,A., SCHEURLEN, W., and ZUR HAUSEN. H. (1984). A new type of papillomaviruses DNA, its presence in genital cancer biopsies and in cell lines derived from cervical cancer. EMBO/. 3, 1151-l 157. CHODOSH, L. A., BALDWIN, A. S., CARTHEW, R. W.. and SHARP, P. A. (1988). Human CCAAT-binding proteins have heterologous subunits. Cell 33, 1 l-24. COLE, S. T., and DANOS. 0. (1987). Nucleotide sequence and comparative analysis of the human papillomavirus type 18 genome. Phylogeny of papillomaviruses and repeated structure of the E6 and E7 gene products. /. Mol. Biol. 193, 599-608. GRIPE, T. P., HAUGEN, T. H., TURK, 1. P.. TABATABAI, F., SCHMID, P. G., DURST, M., GISSMANN, L.. ROMAN, A., and TUREK. L. P. (1987). Tran-

scriptional regulation of the human papillomavirus-16 E6-E7 promoter by a keratinocyte-dependent enhancer, and by a viral E2 trans-activator and repressor genes products: Implications for cervical carcinogenesis. EMBO/. 6, 3745-3753. DAVIDSON, I., FROMENTHAL,C., AUGERAU, P., WILDEMAN, A., ZENKE, M., and CHAMBON, P. (1986). Cell-type specific protein binding to the enhancer of simian virus 40 in nuclear extracts. Nature (London) 323,544-548. DURST. M., GISSMANN, L., IKENBERG,H., and ZUR HAUSEN. H. (1983). A papillomavirus DNA from a cervical carcinoma and its prevalence in cancer biopsy samples from different geographic regions. Proc. Nat/. Acad. Sci. USA 80, 3812-3815. FRISQUE,R. J., BREAM, G. L., and CANELLA, M. T. (1984). Human polyomavirus JC virus genome. I. Viral. 57,458-469. GARCIA-CARRANCA,A., THIERRY, F., and YANIV, M. (1988). Interplay of viral and cellular proteins along the long control region of human papillomavirus type 18. J. Viral. 62, 4321-4330. GERSTER,T., MA~HIAS, D., THALI, M., JIRICNY,J., and SCHAFFNER,W. (1987). Cell type specificity elements of the immunoglobulin heavy chain gene enhancer. EMBO J. 6,1323-l 330. GIUS, D., and L~IMINS, L. A. (1989). Activation of human papillomavirus type 18 gene expression by herpes simplex virus type 1 viral transactivators and a Phorbol ester. /. viral. 63, 555-563. GIUS, D., GROSSMAN, S., BEDELL, M. A., and LAIMINS. L. A. (1988). Inducible and constitutive enhancer domains in the non coding region of human papillomavirus type 18.1. Viral. 62, 665-672. GLOSS, B., BERNARD, H.-U., SEEDORF, K., and KLOCK, G. (1987). The upstream regulatory region of the human papilloma virus 16 contains an E2 protein-independent enhancer which is specific for cervical carcinoma cells and regulated by glucocorticoid hormones. EMBO J. 6,3735-3743. GLOSS, B., CHONG, T., and BERNARD, H.-U. (1989a). Numerous nuclear proteins bind the long control region of human papillomavirus type 16: A subset of 6 of 23 DNase l-protected segments coincides with the location of the cell-type-specific-enhancer. /. Viral. 63,1142-1152. GLOSS, B.. YEO-GLOSS, M.. MEISTERERNST,M., ROGGE,L., WINNACKER, E. L., and BERNARD,H.-U. (1989b). Clusters of nuclear factor I binding sites identify enhancers of several papillomaviruses but alone are not sufficient for enhancer function. Nucleic Acids Res. 17, 3519-3533. GORMAN, C. M., MOFFAT, L. F., and HOWARD, B. H. (1982). Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2, 1044-l 051. HENNIGHAUSEN.L., and LUBAN, H. (1987). Interaction of protein with DNA. In “Methods in Enzymology” (S. L. Berger and A. R. Kimmel, Eds.), Vol. 152, pp. 721-735. Academic Press, San Diego. HIROCHIKA, H., HIROCHIKA, R., BROKER,T. R., and CHOW, L. T. (1988). Functional mapping of the human papillomavirus type 11 transcriptional enhancer and its interaction with the transacting E2 proteins. Genes Dev. 2, 54-67. JONES, N. C., RIGBY. P. W. J., and ZIFF. E. B. (1988). Transacting protein factors and the regulation of eukaryotic transcription: Lessons from studies on DNA tumor viruses. Genes Dev. 2, 267-281. KADONAGA,J. T., and TJIAN, R. (1986). Affinity purification of sequence specific DNA binding proteins. Proc. Nat/. Acad. Sci. USA 83, 5889-5893. KRISTIE,T. M., and ROIZMAN, B. (1988). Differentiation and DNA contact points of host proteins binding at the cis site for virion mediated inductlon of (Y genes of herpes simplex virus 1. J. Viral. 62, 1145-1157. MARSHALL, T., PATER, A., and PATER, M. M. (1989). Trans.regulation and differential cell specificity of human papilloamvirus types 16. 18 and 1 1 cis-acting elements. /. bled. viral. 29, 1 15-l 26.

DNase

PROTECTION

OF HPV 16 AND

MATLASHEWSKI,G., SCHNEIDER,J., BANKS, L., JONES, N., MURRAY, A., and CRAWFORD,L. (1987). Human papillomavirus type 16 DNA cooperates with activated ras In transforming primary cells, EMBOI. 6, 1741-1746. PATER, M. M , and PATER, A. (1985). Human papillomavirus types 16 and 18 sequences in carcinoma cell lines of the cervix. Virology 145,313-318. PATER, M. M., and PATER,A. (1988). Expression of human papillomaviruses types 16 and 18 DNA sequences in carcinoma cell lines. J. Med. tirol. 26, 185- 195. PATER, M. M., HUGHES, G. A., HYSLOP, D. E., NAKSHATRI, H., and PATER. A. (1988). Glucocotiicoid-dependent oncogenic transformation by type 16 but not type 1 1 human papillomavirus DNA. Nature (London) 335,832-835. PHELPS,W. C., YEE. C. L.. MUNGER, K.. and HOWLEY,P. M. (1988). The human papillomavlrus type 16 E7 gene encode trans.activator and transformation functions stmilar to those of adenovirus Ela. Cell 53, 539-547. SCHAFFNER,W. (1989). How do different transcription factors binding the same DNA sequence sort out their jobs? Trends Genet 5,37-39. SCHWARZ. E., FREESE.LJ. K.. GISSMANN, L., MAYER, W., ROGGENBUCK. B., STREMLAU, A., and ZUR HAUSEN, H. (1985). Structure and transcnption of human papillomavirus sequences in cemical carclnoma cells. Nature (London) 314, 1 1 l-1 14. SEALEY, L., and CHALKLEY, R. (1987). At least two nuclear proteins bind specifically to the rous sarcoma virus long terminal repeat enhancer. Nlol. Ce//. Biol. 7,787-798.

18 ENHANCERS

103

SEEDORF,K., KRAMMER.G., DURST, M.. SUHAI, S.. and ROWKAMP,W. G. (1985). Human papillomavirus type 16 DNA sequence. I/iro/ogy 145,181-185. SMOTKIN, D.. and WE~STEIN, F. 0. (1986). Transcription of human papillomaviruses type 16 early genes in a cervical and a cancerderived cell line and identification of the E7 protein. Proc. Nat/. Acad. Sci. USA 83,4680-4684. SWIFT, F. V., BOAT, K., YOUNGHUSBAND,B , and HAMADA, H. (1987). Characterization of a cell-specific enhancer found in the human papillomavirus type 18 genome. EMBOi. 6. 1339-l 344. THIERRY, F., HEARD, J. M., DARTMANN, K., and YANIV, M. (1987). Characterizatlon of a transcnptional promoter of human papillomavirus 18 and modulation of its expression by simian virus 40 and adenovirus early antigens. /. Viral. 61 I 134.. 142. VAN DER HOORN, F A. (1987). C-mos upstream sequence exhibits species-specific enhancer activity and binds munne-specific nuclear proteins. /. AJo/. Biol. 193, 255-266. WINGENDER. E. (1988). Compilation of transcnptlon regulating proteins. Nuc/e/cAcids Res. 16, 1879--l 902. WIRTH, T.. STAUDT, L., and BALTIMORE,D. (1987). An octomer oligonucleotide upstream of a TATA motif IS sufflclent for lymphoid-speclfic promoter activity. Nature (London) 329, 174-l 78. YEE, C., KRISNAN-HEWLE~, I., BAKER,C. C.. SCHLEGELR., and HOWLEY, P. M. (1985). Presence and expresslon of human paplllomavirus sequence In human ceNlcal carcinoma cell lines. Amer. /. Pafhoi 119,361-366.