Unraveling the evolutionary history of the Chilostoma Fitzinger, 1833 (Mollusca, Gastropoda, Pulmonata) lineages in Greece.

Accepted Manuscript Unraveling the evolutionary history of the Chilostoma Fitzinger, 1833 (Mollusca, Gastropoda, Pulmonata) lineages in Greece Nikolaos Psonis, Katerina Vardinoyannis, Moisis Mylonas, Nikos Poulakakis PII: DOI: Reference:

S1055-7903(15)00162-1 http://dx.doi.org/10.1016/j.ympev.2015.05.019 YMPEV 5207

To appear in:

Molecular Phylogenetics and Evolution

Received Date: Revised Date: Accepted Date:

17 December 2014 8 May 2015 22 May 2015

Please cite this article as: Psonis, N., Vardinoyannis, K., Mylonas, M., Poulakakis, N., Unraveling the evolutionary history of the Chilostoma Fitzinger, 1833 (Mollusca, Gastropoda, Pulmonata) lineages in Greece, Molecular Phylogenetics and Evolution (2015), doi: http://dx.doi.org/10.1016/j.ympev.2015.05.019

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Unraveling the evolutionary history of the Chilostoma Fitzinger, 1833 (Mollusca, Gastropoda, Pulmonata) lineages in Greece.

Nikolaos Psonis a,*, Katerina Vardinoyannis b, Moisis Mylonas a, b, Nikos Poulakakis a, b a

Biology Department, University of Crete, Vassilika Vouton, P.O.Box 2208, GR-71409, Irakleio,

Crete, Greece b

Natural History Museum of Crete, University of Crete, Knossos Av., P.O.Box 2208, GR-71409,

Irakleio, Crete, Greece

*Corresponding author Nikolaos Psonis Tel. +30 2810393282 E-mail address: [email protected]

Abstract The land snails of the genus Chilostoma Fitzinger, 1833 that includes, in Greece, the (sub)genera Cattania, Josephinella and Thiessea, are highly diversified and present high levels of endemism. However, their evolutionary history is unknown and their taxonomy is complex and continuously revised. The aim of this study is to investigate the phylogenetic relationships of the lineages of the genus Chilostoma distributed in Greece based on partial DNA sequences of two mitochondrial DNA (16S rRNA and COI) genes. Partial sequences of one nuclear gene (ITS1) representing the major mitochondrial lineages were also analysed. The phylogenetic trees revealed three distinct major clades that correspond to the three (sub)genera. Several taxonomical incongruencies were made obvious, thus, raising questions about the “true” number of species in each clade, while rendering a taxonomic re-evaluation necessary. From a phylogeographic point of view, it seems that the three major phylogenetic clades were separated in the late Miocene. They started differentiating into distinct species during the Pliocene and Pleistocene through several vicariance and dispersal events.

Key words: dispersal, mitochondrial and nuclear DNA, phylogeny, phylogeography, vicariance

1. Introduction

The family Helicidae (Rafinesque, 1815) is among the four richest families of pulmonate molluscs in Greece (Vardinoyannis et al., 2009) and it is represented by two subfamilies; Ariantinae (Mörch, 1864) and Helicinae (Rafinesque, 1815). Although there are numerous studies of European Ariantinae based either on external and/or internal morphology (Pintér and Subai, 1980; Schileyko, 2013, 2006; Subai, 2012, 2002, 1997, 1996, 1995, 1990b, a; Subai and Fehér, 2006; Welter-Schultes, 2012), or even, by using genetic data (Cadahía et al., 2014; Däumer et al., 2012; Greve et al., 2012; Greve et al., 2010; Groenenberg, 2012; Groenenberg et al., 2011; Haase et al., 2013; Haase and Misof, 2009), their taxonomy remains unclear and is continuously revised due to the substantial morphological intraspecific variability. According to the most recent classification, which is also followed in the present study, the subfamily Ariantinae consists of 21 genera (Schileyko, 2013). The genus Chilostoma is one of the two (the other being Liburnica) distributed in Greece and it comprises 13 subgenera, three of which are found in the Greek territory. However, two recent studies concerning the molecular phylogeny of Ariantinae used different classifications. The first study by Groenenberg (2012) proposes 19 genera and 11 subgenera. His study was initially based on the classification of Zilch (1960) where Ariantinae are represented by seven genera and 14 subgenera. The second one, that of Cadahía et al. (2014), was based on the taxonomy of Fauna Europaea (Bank, 2012), in which nine genera and 12 subgenera are listed. Nevertheless, both studies also used provisional names based on a taxonomic revision of the Balkan Ariantinae by Subai (in prep.). The three Chilostoma (sub)genera found in Greece are Cattania Brusina, 1904, Josephinella F. Haas, 1936, and Thiessea Kobelt, 1904, with all three of them presenting high levels of endemism (92% in both Josephinella and Thiessea, and 50% in Cattania). Thiessea

contains 16 species; 15 species are distributed in Greece with only one of them being non endemic. The subgenus is found in Greece (southeastern Greece, northeastern Peloponnisos, on the Aegean Islands) and Turkey. Josephinella includes 20 species; 14 of them are distributed in Greece with only two being non endemic and their distribution includes South Albania, FYROM, mainland Greece and Peloponnisos, as well as the Ionian Islands. Cattania consists of five species with two of them distributed in Greece; one is endemic in Greece, whereas the other is distributed in south Europe (northeast Balkans, Carpathians, Serbia, Bulgaria, FYROM, East Montenegro, northeast Albania and northern Greece (Schileyko, 2013) (see Fig. 1 for the Greek distribution). In total, 31 Chilostoma species are present in Greece, 25 of which are included in the Red Data Book of Threatened animals of Greece as Least Concerned (Vardinoyannis et al., 2009). It is worth noting that an extinct species of the genus, C. (T.) pieperi, has been described from Kasos island (southeastern Aegean), on the basis of a subfossil (Subai, 1996). Although land snails have been considered as ideal organisms for studies of biogeography and phylogeography over a wide range of spatial scales, since they are characterized by low active dispersal ability and live in patchy habitats that are likely to promote geographical structuring (Giokas et al., 2010), very few genera (Codringtonia, Helix, Xerocrassa, Albinaria, Mastus, and Zonites) distributed in Greece have been studied phylogenetically and/or phylogeographically (Poulakakis et al., 2014 and references therein; Uit de Weerd et al., 2004). Only three of these studies are related to species of the family Helicidae, and none of them are dealing with the subfamily Ariantinae. One refers to the mitochondrial phylogeny and biogeographic history of the genus Codringtonia (Kotsakiozi et al., 2012), the other to the taxonomy of Helix cincta and H. nucula using mtDNA data (Psonis et al., 2015) and the last one to the taxonomy of the Italian endemic Helix straminea and its congenerics with inclusion of

several taxa distributed in Greece (Korábek et al., 2014). In the first study, the phylogeny of the seven species of Codringtonia is partially congruent with the latest taxonomic review of the genus, while their history was estimated to start in the late Miocene (7.6 Mya) or early Pliocene (4.56 Mya), depending on whether C. neocrassa is consider to be, according to the authors, in the same genus or a separate one. In the second study, the mitochondrial tree contradicts with current taxonomy of H. cincta and H. nucula, thus rendering a full taxonomic revision needful. In the third study, H. straminea was elevated to species level, with a distinct trans-Adriatic range and its closest relatives in the western Balkans. All these studies provide some first insights on how the southern Balkans (and especially the area of Greece) have shaped the evolutionary history of helicid snails, creating a high variety of species and high levels of endemism. The paleogeography of the area, alongside with the climate shifting during Neogene, have played a major role by actuating speciation events, either by vicariance or by dispersal. On the other hand, there are several other studies dealing with the phylogeny and evolutionary history of Helicinae (e.g. Däumer et al., 2012; Elejalde et al., 2008; Goodacre et al., 2006; Greve et al., 2012; Greve et al., 2010; Mumladze et al., 2013; Puizina et al., 2013; Riel et al., 2005) or Ariantinae from other areas (Murella muralis; Fiorentino et al., 2013; Fiorentino et al., 2010; Marmorana and Tyrrheniberus; Fiorentino et al., 2008; and Arianta arbustorum; Gittenberger et al., 2004; Haase et al., 2013; Haase and Misof, 2009). The lack of studies on Ariantinae from southern Balkans shows that there is an urgent need to focus on that area and, by including endemic species, to explore the phylogeny and the phylogeography of the representative species groups there, resulting in a more robust and complete scenario for the evolutionary history of the Ariantinae family.

As mentioned above, the phylogenetic relationships of the Ariantinae genera were approached in two recent studies (Cadahía et al., 2014; Groenenberg, 2012). According to these studies, although they included very few samples from the Greek area [i.e. only five specimens in Cadahía et al. (2014)], the Balkan Ariantini form a monophyletic group, in which, the subgenus Thiessea (treated as genus in their studies) has a sister group relationship with the subgenus Josephinella (treated as genus in their studies),whereas these two are subsequently clustering with the subgenus Cattania (being represented by Cattania faueri in their studies). The inclusion of more representative species (especially stenoendemics) belonging to these (sub)genera can be proved very useful in order to examine the above phylogenetic pattern. Despite the high levels of diversity and endemism of the genus Chilostoma in Greece, no work has been done so far on its phylogeny and phylogeography. The study at issue is the first phylogenetic approach of Chilostoma found in Greece. Therefore, the main goals of this phylogeneticapproach on Chilostoma lineages in Greece are: a) to infer their phylogenetic relationships using sequence data originating from one nuclear (nDNA) and two mitochondrial (mtDNA) genes, b) to estimate the times of divergence, and c) to propose, within this phylogenetic framework, a phylogeographic scenario accounting for the current distribution of lineages.

2. Material and Methods 2.1. Specimens, DNA extraction, amplification and sequencing In total, 57 individuals were used, belonging to 17 species (eight Josephinella, one Cattania, and eight Thiessea species) from 53 localities. For each species 1-14 populations were included in this study. The identification of the specimens (Appendix A) was based on shell

morphology and anatomy of the genitalia. Total genomic DNA was isolated from foot muscle of specimens deposited in the Natural History Museum of Crete that were either frozen (−20°C) or ethanol (75% or absolute) preserved. To overcome problems of polymerase chain reaction (PCR) inhibition by mucopolysaccharides, DNA was extracted using the CTAB 2x (hexadecyltrimethyl-ammonium bromide) protocol of (Winnepenninckx et al., 1993) as described in (Parmakelis et al., 2003). The sampling localities are shown in Figure 1 and the specimens are listed in Appendix A. Double-stranded PCR was used to amplify partial sequences of two mitochondrial genes (mtDNA) encoding the large subunit ribosomal RNA (16S rRNA) and the cytochrome oxidase subunit I (COI), as well as one nuclear gene (nDNA) encoding the internal transcribed spacer I (ITS1). Primers and conditions used in PCR amplifications and in cycle sequencing reactions are given in Table 1. For the ITS1, the sequencing was done after cloning with TOPO TA cloning kit (Invitrogen ®) following the manufacturer’s instructions. PCR products were purified using classical ammonium acetate DNA purification method. Single stranded sequencing of the PCR product was performed using the Big-Dye Terminator (v3.1) Cycle Sequencing kit ® on an ABI377 automated sequencer following the manufacturer’s protocol. Primers used in cycle sequencing were in the same as for PCR amplification. Sequences were viewed and edited using CodonCode Aligner v. 3.7.1 (CodonCode Corporation ®). The authenticity of the mtDNA sequences and the homology to the targeted mtDNA genes were evaluated with a BLAST search in the NCBI genetic database (http://blast.ncbi.nlm.nih.gov/Blast.cgi). All newly determined sequences have been deposited in GenBank (accession numbers will be provided; Appendix A). Several sequences from Cadahía et al. (2014) were retrieved from GenBank (see Appendix A for the gene sampling and the

corresponding accession numbers) and included in the phylogenetic analyses. The sequences of C. (T.) cf. sphaeriostoma, C. (C.). cf. faueri, C. (C.). trizona var. haberhaueri (treated as species not as a variety by them), C. (J.) hemonica, C. (J.) byshekensis, C. (Dinarica) pouzolzi, Liburnica cf. dunjana, L. setosa setosa, and Vidovicia coerulans were included in the ingroup of the two mtDNA loci dataset, whereas Kosicia intermedia and K. ziegleri were used as outgroups. Sequences from Kotsakiozi et al. (2012) representing seven Codringtonia species (C. codringtonii, C. elisabethae, C. eucineta, C. helenae, C. intusplicata, C. gittenbergeri, and C. parnassia) were used in the chronophylogenetic analysis for the tree calibration.

2.2. Alignment and data analyses The alignment of the sequences was performed separately for each gene with MAFFT (v.7; Katoh and Standley, 2013) with default parameters and FFT-NS-1 algorithm. Alignment gaps were inserted to resolve length differences between sequences. COI sequences were translated into amino acids prior to analysis, and did not show any stop codons. Sequence divergences were estimated based on Tamura & Nei’s (1993) model of evolution (TrN) in MEGA(v.6; Tamura et al., 2013). The alignment used is available on request.

2.3. Gene tree estimation on mtDNA Phylogenetic trees were constructed using Neighbor Joining (NJ) (Saitou and Nei, 1987), Maximum Parsimony (MP), Maximum Likelihood (ML) and Bayesian Inference (BI). Neighbor Joining analysis was performed in MEGA with the TrN model of evolution. Bootstrapping with 1,000 pseudo-replicates was used to examine the robustness of clades in the resulting tree (Felsenstein, 1985). Maximum Parsimony analysis was performed with PAUP* (v.4.0b10;

Swofford, 2002) with heuristic searches using stepwise addition and performing tree-bisectionreconnection (TBR) branch swapping (Swofford et al., 1996). Confidence in the nodes was assessed by 1,000 bootstrap replicates, with the random addition of taxa. Maximum Likelihood analysis was performed with RAxML (v.7.2.8; Stamatakis, 2006) under the Generalized timereversible + gamma (+G) model. To ensure that the inferred ML tree was not a local optimum, 20 ML searches for each dataset were conducted. The confidence of the branches of the best ML tree was further assessed based on 1,000 rapid bootstrap replicates (under the GTRCAT model). Parameters were estimated independently for each partition (i.e., gene fragment). The evolutionary models used for the BI analysis [HKY (Hasegawa et al., 1985) + G for both 16S and COI genes] were selected using jModelTest (v.2.1.3; Darriba et al., 2012; Guindon and Gascuel, 2003) based on the Bayesian information criterion (BIC; Schwarz, 1978), ignoring the models that include both gamma distribution and invariable sites (Yang, 2006). Bayesian Inference was performed in MrBayes (v.3.2.1; Ronquist et al., 2012), with four runs and eight chains for each run for 107 generations, and the current tree was saved to file every 100 generations. In order to confirm that the chains had achieved stationarity, we evaluated “burn-in” by plotting log-likelihood scores and tree lengths against generation number using Tracer (v.1.6; Rambaut et al., 2013). The –lnL stabilized after approximately 106 generations and the first 25% of the trees were discarded by default, as a conservative measure to avoid the possibility of including random sub-optimal trees. A majority rule consensus tree (“Bayesian” tree) was then produced from the posterior distribution of trees, and the posterior probabilities were calculated as the percentage of samples recovering any particular clade, where probabilities ≥ 95% indicate significant support.

2.4. Divergence times on mtDNA Chronophylogenetic analysis was conducted under the Bayesian framework implemented in BEAST (v.1.8.1; Drummond et al., 2012) using a fully partitioned, by gene fragment, dataset. This strategy permits the simultaneous estimation of divergence times, tree topology, and rates of molecular evolution. The input file was formatted with the BEAUti utility included in the software package. A normal prior distribution for the calibration point was used (Mean: 4.56, stdev: 0.705). As for the priors, the Tree Prior category was set to Yule Process and the uncorrelated lognormal model was used to describe the relaxed clock. Model parameters were unlinked across partitions. The analysis was run for 108 generations with a 1,000-step thinning. Results were analyzed in Tracer to assess convergence and effective sample sizes (ESSs) for all parameters. The –lnL was stabilized prior to 108, and the first 10% of the 100,000 sampled generations were discarded as recommended by Tracer. The final tree with divergence estimates was computed in TreeAnnotator v.1.8.1. Trees were visualized using the software FigTree v.1.4.2. The divergence times for the phylogenetic clades of the studied species were estimated by using an “external” calibration age constraint, which was the divergence time of the genus Codringtonia (according to the authors, C. neocrassa, might represent a separate genus) at 4.57 (3.4 - 5.7) Mya (Kotsakiozi et al., 2012).

2.5. Nuclear DNA data and gene tree on concatenated dataset (mt and nDNA) Mitochondrial genetic clusters that represent "independently evolving" entities were selected using the method of Zhang et al. (2013), which identifies genetic clusters using a Poisson Tree Processes (PTP) model. Identical sequences were omitted for this analysis. For the

phylogenetic analysis at the species level, at least one exemplar representing each PTP group (genetic cluster) in the mtDNA analysis was selected for sequencing of nuclear marker (ITS1) and statistical parsimony networks were constructed in TCS (v. 1.8.0_11; Clement et al., 2000). In addition, all phylogenetic (NJ, MP, ML and BI) analyses were performed on a concatenated dataset as in mtDNA data, containing the two mitochondrial (16S and COI) and the nuclear gene (ITS1). This dataset included only those specimens (22 in total, accounting only the newly sequenced), representing 12 morphologically identified species, for which all three genes were amplified, with the exception of two specimens (sample codes 32 and 35), for which the COI gene failed to be amplified. Also, it contained the mtDNA sequences of C. (D.) pouzolzi, L. cf. dunjana, L. s. setosa, and V. coerulans that were used in the mtDNA dataset, as mention in section 2.1. The analyses were performed as previously described following the same procedure. Models applied were as follows: 16S - GTR+G; COI - HKY+G; and ITS1 - K80+G.

2.6. Biogeographic analyses The produced mtDNA trees from the BI analysis (see section 2.3) and the BEAST tree (see section 2.4) were turned into NEWICK format and used in the biogeographic analyses. In the BEAST tree the outgroup (Codringtonia spp.) was removed to match the taxa included in the BI tree. In order to determine the broad scale geographic evolution of the genus, two alternative reconstruction methods were used: (i) Statistical Dispersal - Vicariance Analysis (S-DIVA; Yu et al., 2010) implemented in the computer software Reconstruct Ancestral States in Phylogenies (RASP; Yu et al., 2013) and, (ii) the dispersal-extinction-cladogenesis analysis (DEC) implemented in the computer program LAGRANGE (Ree et al., 2005; Ree and Smith, 2008). We considered species/subspecies/populations to be distributed within six broad areas : a)

Peloponnisos (P) including all the specimens distributed in the namesake area, b) continental Greece and Albania (cGA) comprising all the specimens distributed in central continental Greece, on Evvoia Island, on Sporades Islands and in western/north-western Greece, as well as, in Albania, c) Cyclades (C) consisting of all the specimens distributed in the namesake area, d) northern Greece (nG) that includes all the specimens distributed in central and eastern Macedonia and Thraki, e) western Balkans (wB) including all the specimens distributed in Serbia, Croatia, Slovenia and Montenegro, and finally f) central Europe (cE) consisting of all the specimens distributed in Austria and Italy.

3. Results 3.1. Mitochondrial data For phylogenetic analyses, a concatenated data set including 77 individuals (52 unique haplotypes) was used. Seventy-three of them constitute the ingroup (Appendix A), whereas another four belong to the outgroup (Kosicia spp.). A total of 1,034 base pairs (16S rRNA 379 bp and COI 655 bp) were aligned, with 437 (42.3%) alignment sites being variable and 404 (39.1%) parsimony informative (438 and 414, respectively, when outgroups were included in the analysis). The length of the sequences produced in the present study varied from 221 to 371 bp for the 16S rRNA gene and from 376 to 613 bp for the COI gene (except four sequences with length 146-219 bp due to sequence editing). Sequence divergence ranged from 0 to 47.1% for the 16S rRNA gene and from 0 to 30.3% for the COI gene. Table 2 shows the genetic distances among and within the major lineages revealed by the phylogenetic analyses.

All phylogenetic analyses (NJ, MP, ML, and BI) produced trees with very similar topologies. Unweighted parsimony analysis produced more than 10,000 equally parsimonious trees with a length of 2,038 steps (consistency index CI=0.379, retention index RI=0.811). The large number of equally parsimonious solutions was largely due to terminal branch swapping. Maximum likelihood analysis resulted in a topology with lnL=−9782.01 (final parameter estimates for 16S rRNA: base frequencies A=0.34, C=0.14, G=0.21, T=0.31, shape value (a)=0.30, A/C=0.85, A/G=3.17, A/T=1.32, C/G=0.000017, C/T=3.83 and G/T=1 and for COI: A=0.24, C=0.15, G=0.20, T=0.41, shape value (a)=0.19, A/C=0.55, A/G=10.18, A/T=1.20, C/G=1.63, C/T=10.73 and G/T=1). Bayesian inference resulted in a topology with mean lnL=−9,882.27. Identical topologies were recovered for each of the four runs with the full dataset, and the 50% majority-rule consensus tree of the 75 x 103 trees remaining after burn-in is presented in Figure 2. According to this tree, the specimens of the genus Chilostoma distributed in Greece that were included in the present study are divided into three major clades (clades I, II, and III) with very good statistical support. Note that from hereinafter very good support equals to values above 0.95 for BI (posterior probabilities), above 70% for ML (bootstrap values) and above 8090% for MP, NJ (bootstrap values). Clade I consists of all the C. (Thiessea) spp. used in this study, excluding one [C. (T.) cf. hymetti] and is subdivided into two subclades (subclade II has low statistical support in BI and ML analyses). The species C. (T.) sphaeriostoma, C. (T.) cf. sphaeriostoma, C. (T.) euboeae and C. (T.) cyclolabris from Evvoia island group, Sporades island group and eastern Central Greece constitute the first subclade, whereas C. (T.) amorgia, C. (T.) bacchica and C. (T.) fuchsiana from several islands of eastern Cyclades form the second subclade. Within subclade I several

minor clusters are recognized, but their relationships are unresolved. Regarding subclade II, the intra-subclade phylogenetic relationships could be considered, also, as unresolved. However, it seems that C. (T.) fuchsiana is monophyletic, despite the low statistical support. Clade II includes all the specimens belonging to the species of the subgenus Josephinella that were included in the present study, and C. (T.) cf. hymetti. Five subclades, statistically very well supported, might be distinguished within this clade. Subclade I includes three minor clusters: C. (T.) cf. hymetti (Mainalo Mountain, central Peloponnisos) groups with C. (J.) comephora (Mavromati, southwestern Peloponnisos), C. (J.) argentellei (Erymanthos Mountain, northwestern Peloponnisos) clusters with C. (J.) eliaca (Panachaiko Mountain, northwestern Peloponnisos), and finally, C. (J.) conemenosi (Skollis Mountain and Santomeri, northwestern Peloponnisos) forms a separate group. The last two minor clusters have sister-group relationship. Subclade II comprises C. (J.) subzonata (Vardousia Mountain and Platanovrysi, northwestern Peloponnisos), with unresolved phylogenetic relationships among the specimens. Subclade III consists of C. (J.) phocaea (Gkiona and Vardousia Mountains, central Greece) and C. (J.) vikosensis (Vikos gorge, northwestern Greece) with their phylogenetic relationships considered to be also unresolved. Nevertheless, C. (J.) phocaea appears monophyletic, though with low statistical support (but see section 3.4). Subclade IV contains two minor clusters; one includes C. (J.) subzonata lineages from northwestern Greece and C. (C.) hemonica from northwestern and northcentral Greece, and the other consists of C. (J.) byshekensis from Albania. None of them have resolved phylogenetic relationships among the specimens. Finally, subclade V includes C. (J.) krueperi and C. (J.) argentellei from southern Peloponnisos. The specimens of the latter species are monophyletic within this subclade. It should be noted that among the above five subclades only one cluster can be detected including the subclades IV and V.

Finally, clade III comprises all the specimens of C. (C.) trizona as well as of C. (C.) faueri from northern Greece, and is partitioned into two very-well supported subclades. Subclade I includes specimens from western Macedonia and Thessalia whereas subclade II from eastern Macedonia and Thraki, as well as from Serbia. The intra-subclade phylogenetic relationships in both subclades could be considered as unresolved. In PTP analysis 10 distinct evolutionary entities were identified (logLnull=175.97, logLMAX=212.62, p=0.000***). Up to three specimens from each evolutionary entity (Supplementary Fig. 1 & Appendix A) were chosen and sequenced for the nuclear marker (ITS1).

3.2. Divergence times on mtDNA In the estimation of the divergence times, high effective sample sizes were observed for all parameters in the BEAST analysis (posterior ESS values > 2708), and convergence in the chosen chronophylogenetic analyses was reached prior to 108 generations (lnL=−11,850.14). According to the inferred dates (Fig. 3) the diversification of the Chilostoma clades distributed in Greece dates back to the middle Miocene (10.54 Mya). Considering the three major clades (clades I-III), the diversification of each one seems to have occurred during the late Miocene and the Pliocene (3.94, 4.48, and 5.92 Mya, respectively).

3.3. Phylogenetic analysis on nDNA The produced haplotype network (Supplementary Fig. 2) produced three major groups of haplotypes, corresponding to clades I, II and III of the mtDNA tree, respectively. The sample of C. (J.) cf. subzonata from Aspropotamos (sample code 06) is an exception, since it exhibits high diversification (16 mutation steps from all other Josephinella specimens).

3.4. Gene tree estimation on the concatenated dataset (mt and nDNA) For the ITS1 gene a total of 699 bp were aligned, with 207 (29.6%) alignment sites being variable and 70 (10.0%) parsimony informative. Sequence divergence ranged from 0 to 20.8% (Supplementary Table 2). The length of the sequences produced in the present study varied from 584 to 635 bp. All phylogenetic (NJ, MP, ML, and BI) analyses of the concatenated dataset (16S 375 bp, COI 655 bp, and ITS1 686 bp) produced phylogenies (Supplementary Fig. 3) that are in agreement with the mitochondrial ones (Fig. 2) with lnL=−8,936.76 for ML and lnL=−9,288.04 for BI. Two significant topological differences between the two datasets are that in the concatenated dataset Cattania is branched off first and Thiessea has sister-group relationship with Josephinella, and C. (J.) phocaea and C. (J.) vikosensis form distinct clusters.

3.5. Biogeographic analysis Biogeographic reconstructions for 31 major nodes are presented in Figure 2. The inferred ancestral areas at internal nodes, estimated using S-DIVA, largely correspond to the results obtained from the DEC reconstruction. In addition, the results produced using the mtDNA tree do not differ compared to the ones using the BEAST tree regarding the focal (sub)genera. The

ancestral of the ingroup was reconstructed as to have been located in western Balkans and central Europe, whereas the ancestor of clades I and II to have been located in continental Greece and Albania. The ancestor of clade I was reconstructed as to have been located in the area that includes continental Greece, Albania, and Cyclades, whereas the ancestor of clade II was inferred to have originated from the area that comprises continental Greece, Albania and Peloponnisos, and the ancestor of clade III from the area that consist of continental Greece, Albania and North Greece. In general, it seems that the biogeographical history of Chilostoma in the region is the result of recurring vicariance and dispersal events.

4. Discussion 4.1. Phylogenetic relationships and taxonomic implications The observed phylogenetic relationships revealed several taxonomic incongruences with morphological species (Pintér and Subai, 1980; Schileyko, 2013, 2006; Subai, 1996, 1990b, a; Subai and Fehér, 2006; Welter-Schultes, 2012), rendering an extensive taxonomical reevaluation essential. The present taxonomic situation is already too confused to propose definite changes based only to the phylogenetic relationships revealed in the present study. However, in the cases that the authors are in favor of a taxonomic revision a notice is made. The levels of mtDNA (16S rRNA and COI) divergences recorded among and within the major mitochondrial lineages are extremely high (i.e., 40.2% in 16S rRNA between Josephinella subclade I and Thiessea subclade II). Comparing with other Mediterranean Helicidae, they are slightly higher than Codringtonia (up to 27.6% for concatenated data of 16S rRNA, COI, and COII genes; Kotsakiozi et al., 2012) and Helix [up to 24.5% for concatenated data of 16S rRNA and COI genes; (Psonis et al., 2015), whereas 7.3% for 16S and 11.8% for COI between H.

straminea and H. vladika (Korábek et al., 2014)]. Moreover, the corresponding divergence in nuclear DNA is also high among the major lineages, reaching 4.6% [C. (Thiessea) subclade I and C. (Cattania) subclade I]. From a phylogenetic point of view, due to lack of statistical support among the internal nodes, the phylogenetic status of the genus Chilostoma cannot be discussed. Cadahía et al. (2014) and Groenenberg (Groenenberg, 2012) have highlighted the existence of a taxonomic problem regarding the monophyly of the genus. All the phylogenetic analyses in the present study produced a topology indicating that all the specimens recognized morphologically as Thiessea, Josephinella, and Cattania, grouped in three distinct phylogenetic clades that correspond to these three (sub)genera. The phylogenetic relationships among them could be considered as unresolved due to the low statistical support (Fig. 2). However, previously studies on the phylogeny of Ariantinae (Cadahía et al., 2014; Groenenberg, 2012) have shown that Cattania is branched off first and Thiessea has sister-group relationship with Josephinella. The above topological pattern is also supported from our concatenated dataset (Sup. Fig. 3) and the BEAST tree (Fig. 3). This incongruence compared to mtDNA tree of Figure 2 is probably due to the different dataset used in each analysis. Within each of these three clades, the tree topology revealed several incongruences between the phylogenetic relationships of the lineages and the morphological species (Table 3). Considering the clade of Josephinella (II), two species seem to be polyphyletic [C. (J.) argentellei and C. (J.) subzonata] raising questions about their taxonomic status. C. (J.) argentellei appears in two subclades (I and V) of clade II, with non-sister group relationship. The first subclade (I) includes also C. (J.) conemenosi, C. (J.) eliaca, C. (J.) comephora, and C. (T.) cf. hymetti and all are characterized by shell similarity and very low interspecies genetic

distances (Table 2). Thus, either the specimen of C. (J.) argentellei in this subclade is a different taxon or all the specimens of this subclade belong to a single species. In the second case, the taxa C. (J.) eliaca, C. (J.) conemenosi, and C. (J.) argentellei from Erymanthos [the latter was initially described by Kobelt (1893) from this mountain as C. (J.) ampylaea peritricha (var.) erymanthia] should be considered as synonyms of C. (J.) comephora Bourguignat, 1857. The other subclade (V) comprises C. (J.) argentellei from southeast Peloponnisos (Taygetos Mountain area) and only one specimen of C. (J.) krueperi from the same region. Given their phylogenetic affinity, they could be considered as a single species, yet, because only one specimen of C. (J.) krueperi was included in this study, we cannot reach safe conclusions. Of particular note is the presence of C. (T.) cf. hymetti (sample code 48) within the clade of Josephinella in sister group relationship with C. (J.) comephora in subclade I. This specimen presents a complicated morphology; the reproductive system is the same as in C. (T.) hymetti, whereas the shell is a C. (J.) argentellei one (Vardinoyannis in prep.). Its position on the tree suggests that, from a phylogenetic point of view, this specimen belongs to the subgenus Josephinella and not to Thiessea. Considering that only one specimen and only the mtDNA was available, the aforementioned results are in agreement with other scientists who claim that mucous glands (number, shape) are not a valid taxonomic character (Hesse, 1931; Schileyko, 2013), and this lineage is, most probably, a member of Josephinella clade. However, more data are necessary to elucidate the hypothesis at issue. In the case of C. (J.) subzonata, its representatives form two distinct subclades (II and IV) within the clade II. The first (subclade II) includes specimens from Peloponnisos (Platanovrysi) and Sterea Ellada (central Greece). The second one (subclade IV) comprises individuals from Ipeiros and Thessalia (continental Greece). Morphologically, three subspecies of C. (J.)

subzonata are found in Greece; the nominal, C. (J.) subzonata pindica (Boettger, 1886) and C. (J.) subzonata distans (Martens, 1876). In order to avoid the polyphyly of C. (J.) subzonata, someone could suggest the elevation of the subspecies to species level. However, although this solution would resolve the issue of polyphyly in C. (J.) subzonata, it wouldn’t deal with the taxonomic problem within the subclade IV, in which the specimens of C. (J.) subzonata from Ipeiros and Thessalia are very close related to C. (J.) hemonica, rendering the latter as paraphyletic species in regards to C. (J.) subzonata. The data for C. (J.) hemonica were retrieved from GenBank, preventing any morphological comparison with C. (J.) subzonata. However, the very close phylogenetic affinity of these two taxa is an indication that either C. (J.) hemonica is not a different species, a fact that can also be supported by the very high morphological variability of C. (J.) hemonica (Pintér and Subai, 1980), or the used taxonomic characters are insufficient for species identification. It is worth noting here that in subclade II the two specimens (sample codes 70 & 71) from Platanovrysi were found syntopically and their striking difference was the presence or not of hairs on the shells (see Supplementary Fig. 4). Due to the zero genetic difference (Tables S1 in Supp. Info) they should be placed in the same species and the presence or not of hairs to be a labile taxonomic character, which has already been proposed by Knipper (1939), but has been ignored thereafter. The phylogenetic position of C. (J.) vikosensis within the subclade III (Josephinella) with C. (J.) phocaea is quite interesting. C. (J.) vikosensis has been placed in different genera or subgenera by many authors; Superba vikosensis (Subai and Fehér, 2006), Liburnica vikosensis (Subai, 2012), Chilostoma (Josephinella) vikosensis (Schileyko, 2013), and Josephinella vikosensis (Groenenberg, 2012). The relatively low genetic distance (5.9% 16S, 9.0% COI, 1.0% ITS1) between C. (J.) phocaea and C. (J.) vikosensis could be an indication of the presence of a

single species, but because only one C. (J.) vikosensis specimen was included in this study, we cannot be decisive for its status. Consequently, a future analysis of more specimens could clarify this confusion. Finally, there are two more Josephinella species in Greece, C. (J.) reischuetzi and C. (J.) albanograeca that were not included in our analyses because tissue material was not available in the collections of the NHMC. According to Groenenberg (data of COI from Groenenberg, 2012), the first species is more closely related to C. (J.) vikosensis (data of COI from Groenenberg, 2012) which, here, appears to be more related to C. (J.) phocaea. Based on the same study, C. (J.) albanograeca clusters within the genus Liburnica, indicating the presence of this Ariantin genus in Greece. However, because the sequences of these species are still not available in GenBank, we could not include them in our analyses, although their inclusion would shed more light on their phylogenetic position and status. Clade III consists of two distinct subclades with unambiguous phylogenetic and geographic discrimination. The first subclade is distributed in western Macedonia and Thessalia (Olympos, Pieria, and Ossa Mountains), and the second one in eastern Macedonia and Thraki, as well as in Serbia. Although their morphological differentiation is low (Vardinoyannis in prep.), their phylogenetic distance (20.3%, 14.1%, and 2.1% for COI, 16S, and ITS1, respectively and ~5.92 Mya of divergence) could reflect two different species, namely Cattania olympica (Boettger, 1885) - the earliest described Ariantinae (Helix olympica, Boettger, 1885) from Olympos Mountain - and Cattania trizona. Additionally, Subai (1990b) claimed the presence of C. (C.) faueri all over the Pangaio Mountain (eastern Macedonia). In the present study, the sample 35 was collected from the peak of this mountain and was identified as C. (C.) trizona because it presented no shell or anatomical differences with the latter species. Moreover, C. (C.)

cf. faueri from the study of Cadahía et al. (2014) clusters within subclade II exhibiting very low genetic difference (Supplementary Tables S1 & S2) from the rest specimens of the subclade. These results, coupled with the very low interspecific genetic distance of subclade II bring the validity of C. (C.) faueri into question. Overall, Cattania has its vast radiation in the Balkan Peninsula, with three additional currently recognized species (C. petrovici A.Wagner 1914, C. maranajensis A.Wagner 1914, and ?C. renschi Knipper, 1939). A future inclusion of more populations from the rest of the distribution of this (sub)genus might shed more light to its taxonomy supporting or opposing the findings at issue. Finally, clade I comprises six different species - C. (T.) sphaeriostoma, C. (T.) cyclolabris, and C. (T.) euboeae (subclade I), and C. (T.) fuchsiana, C. (T.) amorgia, and C. (T.) bacchica (subclade II). Although the extremely low genetic distances among these species raise questions concerning their taxonomic status, the unresolved phylogenetic relationships do not allow any conclusive statement regarding their status. We believe that inclusion of more samples from the above species and the rest of C. (Thiessea) taxa from more Aegean Islands, such as C. (T.) arcadica, C. (T.) nympha, and C. (T.) posthuma, in the future will clarify the phylogenetic relationships in this clade. It is clear that the results of the present study can contribute to the identification of several taxonomic problems within Ariantinae especially within the three focal (sub)genera. However, the incomplete sampling may have affected, at some point, the obtained results, e.g. by producing unresolved relationships among lineages (possibly the case of Thiessea), or by presenting only a fragment of the whole phylogenetic “picture” (this could be the cases of Cattania and/or Josephinella).

4.2. Phylogeography and Divergence times An important problem concerning the phylogeography of Chilostoma is the absence of reliable data (fossil records and/or paleogeographic events) that can be used to calibrate a molecular clock. The fossil records are scarce and albeit they have been used for dating (e.g.; Groenenberg, 2012), the produced results have been disputed (Cadahía et al., 2014). Although it is not considered ideal, in cases like that it is common to follow a dating approach based on a fixed substitution rate (e.g. Harris et al., 2013). Here, the substitution rate that is used has been estimated on a member of Helicidae (genus Codringtonia). Keeping that in mind, the results of the chronophylogenetic analysis should be handled with caution, until more reliable data will be available for the estimation of the divergence times. It is important to notice here that in some cases (such as nodes viii and xiv in Fig.2), the biogeographic analyses support a specific biogeographic event. However these nodes are not statistical supported. Thus no safe conclusions can be made and the results of the biogeographic analyses should be considered with caution should be questioned. According to the biogeographic analyses the ancestor of clades I and II originated from the area covering continental Greece (western or/and central Greece) and Albania during the late Miocene (~9.25 Mya). These clades are distributed mainly in the east (clade I; Thiessea) and west (clade II; Josephinella) of the Pindos Mountain range, indicating that it constituted a barrier shaping their current distribution. Pindos Mountain appears to have played an important role in the shaping of the Greek herpetofauna (Lymberakis and Poulakakis, 2010; Sagonas et al., 2014). Although in several other phylogenetic studies [Alopiinae (Uit de Weerd et al., 2004), Dolichopoda (Allegrucci et al., 2009), Codringtonia (Kotsakiozi et al., 2012), Pelophylax epeirotica (Lymberakis et al., 2007), and Vipera ammodytes (Ursenbacher et al., 2008)], the

produced phylogenetic trees supported a clear distinction of western Greece (including part of Peloponnisos), the Pindos Mountain range was never considered as one of the causes that led to the current distribution of these species. Yet, there are cases of Chilostoma species that have crossed the barrier and colonized the area east of Pindos, such as C. (J.) subzonata. At the time of divergence of clade I from clade II (at ~9.25 Mya), in the area of southern Greece there were two large peninsulas separated by the mountain range of Hellenides (at present Pindos Mountain); one peninsula in the southeast, which nowadays corresponds to the area of southeast continental Greece and Aegean Islands, and another one in the southwest, which at present corresponds to the area of western continental Greece, Peloponnisos and Crete. This geological information fits well with the molecular phylogeny of Chilostoma, assuming that the clades I and II evolved in the aforementioned areas, respectively, producing the present Thiessea complex in eastern continental Greece and Aegean Islands, and Josephinella in western continental Greece and Peloponnisos. The above scenario has been also proposed to describe the biogeographic history of the wall lizards of the genus Podarcis (P. erhardii, P. peloponnesiacus, and P. cretensis) (Hurston et al., 2009; Lymberakis et al., 2008; Poulakakis et al., 2003; Poulakakis et al., 2005b). Yet, our estimation is significantly different from that of Groenenberg (2012), who estimated that this event occurred in the early Miocene (20.5 Mya). The subsequent diversification of clade I into two subclades (subclade I; southeastern continental Greece and Sporades island group, and subclade II; Cyclades and Dodekanisa island groups) seems to be the result of a vicariance event that occurred in the Pliocene (3.94 Mya). Cyclades were isolated from continental Greece in Pliocene (Anastasakis and Dermitzakis, 1990). The effect of this isolation has already been detected in the distribution patterns of Podarcis erhardii (Hurston et al., 2009; Poulakakis et al., 2003; Poulakakis et al., 2005b). The

low genetic distances between the Ariantin taxa of the subclade II from different islands could be explained by the fact that these islands were connected by land-bridges in the Pleistocene during the glacial maxima (Perissoratis and Conispoliatis, 2003). This scenario is also supported by the biogeographic analyses that do not point out any dispersal or vicariance, but only duplication events. The diversification of clade II into five subclades is more complicated. It remains unclear what the actual events were that caused the divergence in western, central Greece and Peloponnisos. However, our data support that both several vicariance and dispersal events occurred. The divergence started in the Pliocene ( 4.48 Mya) and continued during the Pleistocene. Peloponnisos was an island, isolated from continental Greece during the Pliocene (Dermitzakis, 1989), affecting the distribution patterns of several animal species [Codringtonia (Kotsakiozi et al., 2012), Ablepharus kitaibeli (Poulakakis et al., 2005a), Podarcis peloponnesiacus (Poulakakis et al., 2003; Poulakakis et al., 2005b), Lacerta trilineata (Sagonas et al., 2014), and Talpa stankovici (Tryfonopoulos et al., 2010). In the Pleistocene, Peloponnisos re-connected with mainland Greece (Perissoratis and Conispoliatis, 2003; Shackleton et al., 1984), a fact that could justify the affinity of some populations from Peloponnisos and Sterea Ellada, such as the phylogenetic relationship of the populations from Platanovrysi and Vardousia Mountain into subclade II. This is also supported by our biogeographic analyses indicating that the above clustering is a result of dispersal probably from Peloponnisos to Sterea Ellada (continental Greece). The effects of this reconnection between Peloponnisos and continental Greece have also been mentioned in the cases of Ligidium (Klossa-Kilia et al., 2006) and Trachelipus (Parmakelis et al., 2008) and used as one of the main factors to explain the phylogenetic pattern of Codringtonia (Kotsakiozi et al., 2012).

The distribution of the ancestor of clade III (Catania) cannot be estimated with statistical significance. Despite this, in the late Miocene (5.92 Mya) clade III split, through vicariance, into subclade I distributed in continental Greece and Albania (represented in the dataset by specimens from the broader area of Olympos Mountain), and subclade II distributed in northern Greece. The broader area of Olympos Mountain was separated by large lakes that existed then (Dermitzakis, 1990), confining subclade I to that area. Beyond the historical factors, the climatic oscillations of the early Pliocene to Pleistocene could also have played a significant role in the diversification of Chilostoma. The climate was warm in the early Miocene becoming cooler in the Pliocene until the prevailing of the typical Mediterranean climate in the Plio-Pleistocene (Axelrod, 1973; Velitzelos et al., 2014). Notably, at that time (3.5 - 2.5 Mya) the climate in south Mediterranean shows increased temperatures, but unchanged precipitation (Salzmann et al., 2008). This led to drier environmental conditions causing cold/humid adapted species to colonize higher altitudes in the south, a scenario that has also been proposed for the land snails of the genus Codringtonia (Kotsakiozi et al., 2012).

5. Conclusions According to the present study, no classification that has already been proposed for this genus reflects its evolutionary history, thus, a thorough taxonomic revision on all levels – genera, subgenera, and species - is needed. Our findings for the genus in Greece support the presence of three (sub)genera in the area - Cattania, Josephinella, and Thiessea -yet, each one needs to be reexamined, especially at the species level. The lineages distributed in Greece and representing these (sub)genera were separated in the middle Miocene and started to differentiate into distinct

species since the late Miocene, Pliocene, and Pleistocene through several vicariance and dispersal events. Our data comes to support numerous studies that due to the incongruence between morphology-based taxonomy and molecular phylogeny, have critically assessed the importance of several morphological characters (such as the presence or absence of hairs in shell, shape and number of mucous glands etc.) in land snail taxonomy (Elejalde et al., 2008; and references therein). Hence, the emergence of new diagnostic (not only morphological) characters on all taxonomic levels is essential for an advisable taxonomy.

Acknowledgements We wish to express our gratitude to Konstantinos Triantis and Sinos Giokas for providing us two, hard-to-find, samples, as well as, Dr. Apostolos Trichas for the snail photographs, Mina Trikali for helping in our finding paleogeography literature, Elisavet Georgopoulou for assisting in specimens identification, Maria Koutraki (English Tutor EEP, School of Sciences & Engineering) for the linguistic support of the text, as well as, to the editor and two anonymous reviewers for providing comments that significantly improved an earlier version of the manuscript. This project has been partially funded by the State Scholarships Foundation (Greece) in the frame of the Operational Program "Education and Lifelong Learning” within the National Strategic Reference Framework, NSRF 2007-2013" and the European Social Fund (ESF).

Appendix A. Alphabetically ordered by taxon name list of specimens examined in the present study with their corresponding unique sample codes (only for newly sequenced specimens), taxon names, voucher numbers, locality names (detailed only where available), collection date, and accession numbers in GenBank. Asterisks indicate the selected samples representing the entities that have been identified by PTP analysis. Italics in Accession numbers indicate gene amplification using Pyr (16S rRNA) and Hgona (COI) primer sets. Sample Code -

Taxon Name

Voucher Numbers

Longitude

Latitude

C. (Cattania) cf. faueri C. (Cattania) cf. faueri

21

C. (Cattania) trizona

22*


24


25*


26


27


28


29


30*


31


NHMC 50.16350 NHMC 50.29558 NHMC 50.29549 NHMC 50.29479 NHMC 50.29528 NHMC 50.30702 NHMC 50.33312 NHMC 50.16321 NHMC 50.30750 NHMC 50.16793-

24,0219

41,2955

22,2852

40,1234

22,3218

40,1033

22,3362

40,072

22,2802

40,0695

22,6862

39,8089

22,1592

Locality & Region

Collection Date (DD/MM/YYYY)

Accession Numbers (16S/COI/ITS1)

Agio Pnevma

KF596830/KF596877/-

Agio Pnevma

KF596831/KF596878/-

Falakro Mountain - Thraki

06/07/1996

To be provided/-/-

04/06/2007

To be provided/TBP/TBP

03/06/2007

To be provided/TBP/-

02/06/2007


02/06/2007


Ossa Mountain - Thessalia

02/07/2001


40,2306

Pieria Mountain - Flampouro peak - Macedonia

20/06/2009


24,1725

41,4212

Potamoi – Thraki

07/07/1996

To be provided/-/-

24,7884

41,1036

Stena Nestou - Thraki

29/05/2005


41,2947

41,2947

Falakro Mountain (1300m) Thraki

19/06/1999


Kokkinopilos - Olympos Mountain - Macedonia Olympos Mountain (1375m) Macedonia Olympos Mountain (2500m) Macedonia Olympos Mountain (2000m) Macedonia

32*


33


34


35*


02 04 55*

C. (Cattania) trizona var. haberhaueri C. (Cattania) trizona var. haberhaueri C. (Josephinella) argentellei C. (Josephinella) argentellei C. (Josephinella) argentellei

67

C. (Josephinella) argentellei

68*

C. (Josephinella) argentellei

06* 74* 69

C. (Josephinella) byshekensis C. (Josephinella) byshekensis C. (Josephinella) cf. subzonata C. (Josephinella) comephora C. (Josephinella) conemenosi

72

C. (Josephinella) conemenosi

73*

C. (Josephinella)

1 NHMC 50.16829 NHMC 50.16330 NHMC 50.167932 NHMC 50. 28282

NHMC 50.2403 NHMC 50.14674 NHMC 50.556 NHMC 50.370962 NHMC 50.370961

NHMC 50.30590 NHMC 50.37088 NHMC 50.37099 NHMC 50.371202 NHMC

24.577700

41.159300

Lekani - Kechrokampos - Thraki

22/06/1999

To be provided/-/TBP

24,1086

41,2967


06/07/1996

To be provided/-/-

41,2947

41,2947


11/05/2002


24,108

40,9105

Pangaio Mountain - Thraki

22/09/1999

To be provided/-/TBP

Serbia

KF596849/KF596893/-

Serbia

KF596850/KF596894/-

22,3781

36,6378

Katafygi cave - South of Sparti Peloponnisos

18/02/1994


22,3639

36,9536

Taygetos Mountain - Peloponnisos

09/05/1991


22,3034

36,8895

Taygetos Mountain (1000m) Peloponnisos

10/05/1999


21,7661

37,9521

Erymanthos Mountain Peloponnisos

29/10/2011


21,7661

37,9521

Erymanthos Mountain Peloponnisos

29/10/2011


Albania

KF596861/KF596905/-

Albania

KF596862/KF596906/To be provided/TBP/TBP To be provided/TBP/TBP

21,2182

39,6358

Aspropotamos - Thessalia

27/06/2004

21,929

37,1837

Mavrommati - Peloponnisos

29/10/2011

21,5872

38,0006

Skollis Mountain - Peloponnisos

28/10/2011


21,5768

37,9887

Santomeri - Peloponnisos

28/10/2011


21,5768

37,9887

Santomeri - Peloponnisos

28/10/2011

To be

C. (Josephinella) eliaca C. (Josephinella) krueperi

50.371201 NHMC 50.39224 NHMC 50.36201

21,8621

38,2028

Panachaiko Mountain Peloponnisos

Unknown

22,1716

36,9997

Kato Verga - Peloponnisos

06/03/2011

C. (Josephinella) phocaea

NHMC 50.31768

22,3135

38,6461

C. (Josephinella) phocaea C. (Josephinella) phocaea

NHMC 50.31788 NHMC 50.31833

22,2736

38,5979

22,2622

38,6544

C. (Josephinella) phocaea

NHMC 50.30786

22,1441

38,6816

C. (Josephinella) subzonata C. (Josephinella) subzonata C. (Josephinella) subzonata

NHMC 50.35668 NHMC 50.22637 NHMC 50.35730

21,1474

39,8233

20,6415

05*

C. (Josephinella) subzonata

NHMC 50.31030

70*


71


conemenosi 76* 09* 10 11* 12* 13 15* 16 17*

75* 38 39 42 48

C. (Josephinella) vikosensis C. (Thiessea) amorgia C. (Thiessea) amorgia C. (Thiessea) bacchica C. (Thiessea) cf.

NHMC 50.371461 NHMC 50.371462 NHMC 50.39454 NHMC 50.10284 NHMC 50.13776 NHMC 50.2676 NHMC

provided/TBP/TBP

Gkiona Mountain (1965m) - below Paliovouni peak at Makrylakoma Sterea Ellada (Central Greece) Gkiona Mountain - Profitis Ilias Sterea Ellada(Central Greece) Gkiona Mountain - Pyramida peak - Sterea Ellada(Central Greece) Vardousia Mountain - Korakas peak - Sterea Ellada(Central Greece)

04/07/2008 05/07/2008 15/06/2008

To be provided/TBP/TBP To be provided/TBP/TBP To be provided/TBP/To be provided/TBP/TBP To be provided/TBP/TBP

04/06/1997


Aoos artificial lake - Ipeiros

22/06/2010


40,0654

Bourazani - Ipeiros

14/04/1981


21,2453

39,8134

Portas Petra cave - Thessalia

21/06/2010


22,1694

38,7097

Vardousia Mountain - Athanasios Diakos - Sterea Ellada (Central Greece)

23/06/1997


21,7608

38,1343

Platanovrysi - Peloponnisos

28/10/2011


21,7608

38,1343

Platanovrysi - Peloponnisos

28/10/2011


20,753

39,8859

Vikos gorge - Ipeiros

Unknown


25,9116

36,8466

Profitis Ilias Mountain – Amorgos - Cyclades

04/12/1979

To be provided/-/-

25,4427

37,0516

Avlonitsa - Naxos - Cyclades

19/04/1993

To be provided/-/-

25,3437

36,7445

Palaiokastro - Ios - Cyclades

27/10/1979

To be provided/-/-

22,2677

37,639

Mainalo Mountain - Peloponnisos

05/07/1978


43* 44 45 46 77 78 79* 80 57 58 59 60 61 62* 64 65

hymetti C. (Thiessea) cf. sphaeriostoma C. (Thiessea) cf. sphaeriostoma C. (Thiessea) cyclolabris C. (Thiessea) cyclolabris C. (Thiessea) cyclolabris C. (Thiessea) euboeae C. (Thiessea) fuchsiana C. (Thiessea) fuchsiana C. (Thiessea) fuchsiana C. (Thiessea) fuchsiana C. (Thiessea) hemonica C. (Thiessea) hemonica C. (Thiessea) sphaeriostoma C. (Thiessea) sphaeriostoma C. (Thiessea) sphaeriostoma C. (Thiessea) sphaeriostoma C. (Thiessea) sphaeriostoma C. (Thiessea) sphaeriostoma C. (Thiessea) sphaeriostoma C. (Thiessea)

50.11109

NHMC 50.29639 NHMC 50.20357 NHMC 50.20368 NHMC 50.36270 NHMC 50.23921 NHMC 50.24066 NHMC 50.24140 NHMC 50.23830

NHMC 50.31265 NHMC 50.31963 NHMC 50.30759 NHMC 50.30773 NHMC 50.31653 NHMC 50.25694 NHMC 50.21152 NHMC

Evvoia

KF596865/KF596909/-

Evvoia

KF596866/KF596910/19/06/1999


13/05/2002


10/05/2002


Piperi islet - Sporades

04/07/1978


36,5361

Kounoupoi islet - Astypalaia Dodekanisa

27/02/2005


26,3168

36,571

Astypalaia - Dodekanisa

07/09/2000

To be provided/-/-

26,225

36,5562

01/03/2005


26,4006

36,5654

24/02/2005

To be provided/-/-

24,4332

38,8251

24,6146

38,8241

24,5122

38,7897

24,3222

39,3432

26,4684

24,0599

38,192

23,9447

39,2206

22,9093

39,339

22,9036

38,4339

22,8744

38,4303

24,1682

38,1867

24,1617 24,1489

Erinia islet - Skyros - Sporades Kochylas Mountain - Skyros Sporades Mesa Diavatis islet - Skyros Sporades

Pontikousa islet - Astypalaia Dodekanisa Chondros islet - Astypalaia Dodekanisa Veroia - Macedonia

KF596829 / KF596876 /-

Ipeiros

Kf596840 / - / -

Agia Marina - Sterea Ellada(Central Greece) Agios Dimitrios - Alonnisos Sporades

12/04/1979

To be provided/-/-

09/05/2003

To be provided/-/-

04/04/2003


01/03/1989

To be provided/-/-

06/04/1988


Megalo Kouneli islet - Evvoia

13/04/2006


38,151

Petousi islet - Evvoia

14/05/2005


38,2092

Tigani islet - Evvoia

14/05/2005


Volos – Alykes - Thessalia Leivadia - Sterea Ellada(Central Greece) Leivadia gorge - Sterea Ellada(Central Greece)

-

sphaeriostoma Codringtonia codringtonii Codringtonia elisabethae Codringtonia eucineta Codringtonia gittenbergeri Codringtonia helenae Codringtonia intusplicata Codringtonia parnassia Kosicia intermedia Kosicia intermedia Kosicia intermedia Kosicia ziegleri Liburnica cf. dunjana Liburnica setosa setosa Vidovicia coerulans Vidovicia coerulans Vidovicia coerulans

50.21189 Chrysokelaria monastery Peloponnisos Achladokampos to Argos Peloponnisos Kalavryta to Lagovouni Peloponnisos Agios Ioannis to Meligou Peloponnisos Tripoli to Mainalo Mountain – Peloponnisos Gkiona Mountain – Sterea Ellada(Central Greece) Italy Austria Austria Slovenia

JQ240089 / -JQ239920 /JQ240097 / JQ239928/JQ240103 / JQ239934/JQ240110 / JQ239941 / JQ240137 / JQ239969/JQ240146 / JQ239978 / JQ240157 / JQ239989 / KF596842/KF596886/KF596843/KF596887/KF596844/KF596888/KF596845/KF596889/-

Albania

KF596859/KF596903/-

Croatia

KF596860/KF596904/-

Croatia Croatia Croatia

KF596868/KF596912/KF596867KF596911//KF596869/KF596913/-

Diakofto - Peloponnisos

Appendix B. Supplementary Material Supplementary data associated with this article can be found in an online version.

References Allegrucci, G., Rampini, M., Gratton, P., Todisco, V., Sbordoni, V., 2009. Testing phylogenetic hypotheses for reconstructing the evolutionary history of Dolichopoda cave crickets in the eastern Mediterranean. J. Biogeography 36, 1785-1797. Anastasakis, G.C., Dermitzakis, D.M., 1990. Post-Middle-Miocene paleogeographic evolution of the region. Its possible influence on the distribution of the Quaternary mammals of the Kyklades Islands. Neues Jahrbuch für Geologie und Paläontologie-Abhandlungen 1, 1-16. Axelrod, D., 1973. History of the Mediterranean Ecosystem in California. In: di Castri, F., Mooney, H. (Eds.), Mediterranean Type Ecosystems, Origin and Structure. Springer-Verlag, Berlin Heidelberg, pp. 225-277. Bank,

R.,

2012.

Gastropoda.

Fauna

Europaea

version

2.5.

Available

from

http://www.faunaeur.org. Cadahía, L., Harl, J., Duda, M., Sattmann, H., Kruckenhauser, L., Fehér, Z., Zopp, L., Haring, E., 2014. New data on the phylogeny of Ariantinae (Pulmonata, Helicidae) and the systematic position of Cylindrus obtusus based on nuclear and mitochondrial DNA marker sequences. J. Zool. Syst. Evol. Res. 52, 163-169. Clement, M., Posada, D., Crandall, K.A., 2000. TCS: a computer program to estimate gene genealogies. Molecular Ecology 9, 1657-1659. Darriba, D., Taboada, G.L., Doallo, R., Posada, D., 2012. jModelTest 2: more models, new heuristics and parallel computing. Nat Meth 9, 772-772.

Däumer, C., Greve, C., Hutterer, R., Misof, B., Haase, M., 2012. Phylogeography of an invasive land snail: natural range expansion versus anthropogenic dispersal in Theba pisana pisana. Biol. Invasions 14, 1665-1682. Dermitzakis, D.M., 1989. The colonisation of Aegean islands in relation with the paleogeographic evolution (in greek). Biologia Gallo-Hellenica 14, 99-121. Dermitzakis, D.M., 1990. Paleogeography, Geodynamic Processes and event Stratigraphy during the Late Cenozoic of the Aegean area. Atti Convegni Lincei 85, 263–288. Drummond, A.J., Suchard, M.A., Xie, D., Rambaut, A., 2012. Bayesian Phylogenetics with BEAUti and the BEAST 1.7. Molecular Biology and Evolution 29, 1969-1973. Elejalde, M.A., Madeira, M.J., Arrebola, J.R., Munoz, B., Gomez-Moliner, B.J., 2008. Molecular phylogeny, taxonomy and evolution of the land snail genus Iberus (Pulmonata : Helicidae). J. Zool. Syst. Evol. Res. 46, 193-202. Felsenstein, J., 1985. Confidence-Limits on Phylogenies - an Approach Using the Bootstrap. Evolution 39, 783-791. Fiorentino, V., Manganelli, G., Giusti, F., Tiedemann, R., Ketmaier, V., 2013. A question of time: the land snail Murella muralis (Gastropoda: Pulmonata) reveals constraints on past ecological speciation. Mol Ecol 22, 170-186. Fiorentino, V., Salomone, N., Manganelli, G., Giusti, F., 2008. Phylogeography and morphological variability in land snails: the Sicilian Marmorana (Pulmonata, Helicidae). Biol. J. Linnean Soc. 94, 809-823. Fiorentino, V., Salomone, N., Manganelli, G., Giusti, F., 2010. Historical biogeography of Tyrrhenian land snails: The Marmorana–Tyrrheniberus radiation (Pulmonata, Helicidae). Mol. Phyl. Evol. 55, 26-37.

Folmer, O., Black, M., Hoeh, W., Lutz, R., Vrijenhoek, R., 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Marine Biol. Biotechnol. 3, 294-299. Giokas, S., Thomaz, D., Douris, V., lecanidou, R., Rodakis, G.C., 2010. 5000 years of molecular evolution in a population of the land snail Albinaria caerulea transported by humans. J. Mollusc. Stud. 76, 49-56. Gittenberger, E., Piel, W.H., Groenenberg, D.S.J., 2004. The Pleistocene glaciations and the evolutionary history of the polytypic snail species Arianta arbustorum (Gastropoda, Pulmonata, Helicidae). Mol. Phyl. Evol. 30, 64-73. Goodacre, S.L., Thomaz, D., Davies, E.K., 2006. Mitochondrial gene diversity in Cepaea – population structure, history and positive selection. Biol. J. Linnean Soc. 87, 167-184. Greve, C., Gimnich, F., Hutterer, R., Misof, B., Haase, M., 2012. Radiating on Oceanic Islands: Patterns and Processes of Speciation in the Land Snail Genus Theba (Risso 1826). PLoS ONE 7, e34339. Greve, C., Hutterer, R., Groh, K., Haase, M., Misof, B., 2010. Evolutionary diversification of the genus Theba (Gastropoda: Helicidae) in space and time: A land snail conquering islands and continents. Mol. Phyl. Evol. 57, 572-584. Groenenberg, D., 2012. Molecular taxonomy and natural history collections. Netherlands Centre for Biodiversity Naturalis, Faculty of Science. Leiden University, Leiden, Netherlands, p. 256. Groenenberg, D.S.J., Neubert, E., Gittenberger, E., 2011. Reappraisal of the “Molecular phylogeny of Western Palaearctic Helicidae s.l. (Gastropoda: Stylommatophora)”: When poor science meets GenBank. Mol. Phyl. Evol. 61, 914-923.

Guindon, S., Gascuel, O., 2003. A Simple, Fast, and Accurate Algorithm to Estimate Large Phylogenies by Maximum Likelihood. Systematic Biology 52, 696-704. Haase, M., Esch, S., Misof, B., 2013. Local adaptation, refugial isolation and secondary contact of Alpine populations of the land snail Arianta arbustorum. J. Molluscan Studies 79, 241-248. Haase, M., Misof, B., 2009. Dynamic gastropods: stable shell polymorphism despite gene flow in the land snail Arianta arbustorum. J. Zool. Syst. Evol. Res. 47, 105-114. Harris, D.J., Crandall, K.A., 2000. Intragenomic Variation Within ITS1 and ITS2 of Freshwater Crayfishes (Decapoda: Cambaridae): Implications for Phylogenetic and Microsatellite Studies. Mol. Biol. Evol. 17, 284-291. Harris, D.J., Ferreira, A.F., De Frias Martins, A.M., 2013. High levels of mitochondrial DNA diversity within oxychilid land snails (subgenus Drouetia Gude, 1911) from São Miguel island, Azores. J. Mollusc. Stud. 79, 177-182. Hasegawa, M., Kishino, H., Yano, T.-a., 1985. Dating of the human-ape splitting by a molecular clock of mitochondrial DNA. J. Mol. Evol. 22, 160-174. Hatzoglou, E., Rodakis, G.C., Lecanidou, R., 1995. Complete Sequence and Gene Organization of the Mitochondrial Genome of the Land Snail Albinaria coerulea. Genetics 140, 1353-1366. Hesse, P., 1931. Anatomie und Systematik palaearktischer Stylommatophoren. Zoologica 81, 1118. Hurston, H., Voith, L., Bonanno, J., Foufopoulos, J., Pafilis, P., Valakos, E., Anthony, N., 2009. Effects of fragmentation on genetic diversity in island populations of the Aegean wall lizard Podarcis erhardii (Lacertidae, Reptilia). Mol. Phyl. Evol. 52, 395-405. Katoh, K., Standley, D.M., 2013. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 30, 772-780.

Klossa-Kilia, E., Kilias, G., Tryfonopoulos, G., Koukou, K., Spyros, S., Parmakelis, A., 2006. Molecular phylogeny of the Greek populations of the genus Ligidium (Isopoda, Oniscidea) using three mtDNA gene segments. Zool. Scr. 35, 459-472. Knipper, H., 1939. Systematische, anatomische, oekologische und tiergeographische Studien an sudosteuropaeischen Heliciden. Moll. Pulm., Archiv f. Naturgesch., 8, 327-517. Korábek, O., Juřičková, L., Petrusek, A., 2014. Resurrecting Helix straminea, a forgotten escargot with trans-Adriatic distribution: first insights into the genetic variation within the genus Helix (Gastropoda: Pulmonata). Zool. J. Linnean Soc. 171, 72-91. Kornilios, P., Poulakakis, N., Mylonas, M., Vardinoyannis, K., 2009. The phylogeny and biogeography of the genus Zonites Montfort, 1810 (Gastropoda: Pulmonata): preliminary evidence from mitochondrial data. J. Mollusc. Stud. 75, 109-117. Kotsakiozi, P., Parmakelis, A., Giokas, S., Papanikolaou, I., Valakos, E.D., 2012. Mitochondrial phylogeny and biogeographic history of the Greek endemic land-snail genus Codringtonia Kobelt 1898 (Gastropoda, Pulmonata, Helicidae). Mol. Phyl. Evol. 62, 681-692. Lymberakis, P., Poulakakis, N., 2010. Three Continents Claiming an Archipelago: The Evolution of Aegean’s Herpetofaunal Diversity. Diversity 2, 233-255. Lymberakis, P., Poulakakis, N., Kaliontzopotilou, A., Valakos, E., Mylonas, M., 2008. Two new species of Podarcis (Squamata; Lacertidae) from Greece. Syst. Biodivers. 6, 307-318. Lymberakis, P., Poulakakis, N., Manthalou, G., Tsigenopoulos, C.S., Magoulas, A., Mylonas, M., 2007. Mitochondrial phylogeography of Rana (Pelophylax) populations in the Eastern Mediterranean region. Mol. Phyl. Evol. 44, 115-125.

Mumladze, L., Tarkhnishvili, D., Murtskhvaladze, M., 2013. Systematics and Evolutionary History of Large Endemic Snails from the Caucasus (Helix buchii and H. goderdziana) (Helicidae). Am. Malacol. Bull. 31, 1-10. Parmakelis, A., Klossa-Kilia, E., Kilias, G., Triantis, K.A., Sfenthourakis, S., 2008. Increased molecular divergence of two endemic Trachelipus (Isopoda, Oniscidea) species from Greece reveals patterns not congruent with current taxonomy. Biol. J. Linnean Soc. 95, 361-370. Parmakelis, A., Spanos, E., Papagiannakis, G., Louis, C., Mylonas, M., 2003. Mitochondrial DNA phylogeny and morphological diversity in the genus Mastus (Beck, 1837): a study in a recent (Holocene) island group (Koufonisi, south-east Crete). Biol. J. Linnean Soc. 78, 383-399. Perissoratis, C., Conispoliatis, N., 2003. The impacts of sea-level changes during latest Pleistocene and Holocene times on the morphology of the Ionian and Aegean seas (SE Alpine Europe). Mar. Geol. 196, 145-156. Pintér, L., Subai, P., 1980. Ueber Helicigona (Josephinella) hemonica (THIESSE) (Pulmonata: Helicidae). Arch. Moll. 110, 173-177. Poulakakis, N., Kapli, P., Lymberakis, P., Trichas, A., Vardinoyannis, K., Sfenthourakis, S., Mylonas, M., 2014. A review of phylogeographic analyses of animal taxa from the Aegean and surrounding regions. J. Zool. Syst. Evol. Res. 53, 18-32. Poulakakis, N., Lymberakis, P., Antoniou, A., Chalkia, D., Zouros, E., Mylonas, M., Valakos, E., 2003. Molecular phylogeny and biogeography of the wall-lizard Podarcis erhardii (Squamata : Lacertidae). Mol. Phyl. Evol. 28, 38-46. Poulakakis, N., Lymberakis, P., Tsigenopoulos, C.S., Magoulas, A., Mylonas, M., 2005a. Phylogenetic relationships and evolutionary history of snake-eyed skink Ablepharus kitaibelii (Sauria: Scincidae). Mol. Phyl. Evol. 34, 245-256.

Poulakakis, N., Lymberakis, P., Valakos, E., Zouros, E., Mylonas, M., 2005b. Phylogenetic relationships and biogeography of Podarcis species from the Balkan Peninsula, by bayesian and maximum likelihood analyses of mitochondrial DNA sequences. Mol. Phyl. Evol. 37, 845-857. Psonis, N., Vardinoyannis, K., Mylonas, M., Poulakakis, N., 2015. Evaluation of the taxonomy of Helix cincta (Muller, 1774) and Helix nucula (Mousson, 1854); insights using mitochondrial DNA sequence data. J. Nat. History 49, 383-392. Puizina, J., Fredotović, Ž., Šamanić, I., T., Š., Kekez, L., Cukrov, D., Plesli, G., 2013. Phylogeography of the land snail Eobania vermiculata (OF Müller, 1774) (Gastropoda: Pulmonata) along the Croatian coast and islands. J. Entomol. Zool. Studies 1, 23-31. Rambaut, A., Suchard, M.A., Xie, W., Drummond, A.J., 2013. MCMC Trace Analysis Tool. Version v1.6.0, 2003-2013. Ree, R.H., Moore, B.R., Webb, C.O., Donoghue, M.J., Crandall, K., 2005. A likelihood framework for inferring the evolution of geographic range on phylogenetic trees. Evolution 59, 2299-2311. Ree, R.H., Smith, S.A., 2008. Maximum Likelihood Inference of Geographic Range Evolution by Dispersal, Local Extinction, and Cladogenesis. Syst. Biol. 57, 4-14. Riel, P.V., Jordaens, K., Houtte, N.V., Martins, A.M.F., Verhagen, R., Backeljau, T., 2005. Molecular systematics of the endemic Leptaxini (Gastropoda: Pulmonata) on the Azores islands. Mol. Phyl. Evol. 37, 132-143. Ronquist, F., Teslenko, M., van der Mark, P., Ayres, D.L., Darling, A., Höhna, S., Larget, B., Liu, L., Suchard, M.A., Huelsenbeck, J.P., 2012. MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice across a Large Model Space. Syst. Biol. 61, 539-542.

Sagonas, K., Poulakakis, N., Lymberakis, P., Parmakelis, A., Pafilis, P., Valakos, E.D., 2014. Molecular systematics and historical biogeography of the green lizards (Lacerta) in Greece: Insights from mitochondrial and nuclear DNA. Mol. Phyl. Evol. 76, 144-154. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406-425. Salzmann, U., Haywood, A.M., Lunt, D.J., Valdes, P.J., Hill, D.J., 2008. A new global biome reconstruction and data-model comparison for the Middle Pliocene. Global Ecol. Biogeogr. 17, 432-447. Schileyko, A.A., 2006. Part 13. Helicidae, Pleurodontidae, Polygyridae, Ammonitellidae, Oreohelicidae, Thysanophoridae. Treatise on Recent Terrestrial Pulmonate Molluscs. Ruthenica, Supplement, pp. 1765-1906. Schileyko, A.A., 2013. Family Helicidae excluding Helicinae (Gastropoda Pulmonata): morphology, taxonomy, and a catalogue of taxa. Ruthenica 23, 127-162. Schwarz, G., 1978. Estimating the dimension of a model. The Annals of Statistics 6, 461-464. Shackleton, J.C., Andel, T.H., Runnels, C.N., 1984. Coastal Paleogeography of the Central and Western Mediterranean during the Last 125,000 Years and Its Archaeological Implications. J. Field Archaeol. 11, 307-314. Stamatakis, A., 2006. RAxML-VI-HPC: Maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22, 2688-2690. Subai, P., 1990a. Beitraege zur Molluskenfauna des Epirus, I. Zwei neue Chilostoma-Arten aus Nord-Epirus (Gastropoda: Ariantinae). Ann. Naturhistor. Mus. Wien 91, 243-247.

Subai, P., 1990b. Beschreibung einer neuen Chilostoma aus Griechisch-Makedonien (Gastropoda: Pulmonata: Ariantinae). Archiv für Molluskenkunde der Senckenbergischen Naturforschenden Gesellschaft 120, 115-118. Subai, P., 1995. Beitrag zur Kenntnis albanischer und griechischer Ariantinae (Gastropoda: Helicidae). Ann. Naturhistor. Mus. Wien 97, 75-94. Subai, P., 1996. Revision der Ariantinae. 1. Die Helicigona-Untergattung Thiessea (Gastropoda: Pulmonata: Helicidae). Arch. Moll. 126, 1-49. Subai, P., 1997. Beitrag zur Kenntnis albanischer und montenegrinischer Ariantinae (Gastropoda: Helicidae). Ann. Naturhistor. Mus. Wien 99, 521-534. Subai, P., 2002. Revision der Ariantinae. 2. Die Helicigona-Untergattung Liburnica (Gastropoda: Pulmonata: Helicidae). Arch. Moll. 131, 1-65. Subai, P., 2012. Ergaenzungen zur Revision der Ariantinae (Gastropoda: Pulmonata: Helicidae). Schr. Malakozool. 27, 35-46. Subai, P., Fehér, Z., 2006. Revision of the Ariantinae, 3. Superba n.gen., with the description of three new species (Gastropoda: Pulmonata: Helicicdae). Arch. Moll. 135, 205-223. Swofford, D.L., 2002. PAUP*. Phylogenetic analysis using parsimony (*and other methods). Version 4. Sinauer Associates, Sunderland, MA. Swofford, D.L., Olsen, G.J., Waddel, P.J., Hillis, D.M., 1996. Phylogenetic inference. In: Hillis, D.M., Moritz, C., Mable, B.K. (Eds.), Molecular Systematics. Sinauer, Sunderland, MA, pp. 407-514. Tamura, K., Nei, M., 1993. Estimation of the Number of Nucleotide Substitutions in the Control Region of Mitochondrial-DNA in Humans and Chimpanzees. Mol. Biol. Evol. 10, 512-526.

Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol. Biol. Evol. 30, 2725-2729. Tryfonopoulos, G.A., Thanou, E.G., Fraguedakis-Tsolis, S.E., Chondropoulos, B.P., 2010. New data on the distribution and genetic structure of Greek moles of the genus Talpa (Mammalia, Talpidae). J. Zool. Syst. Evol. Res. 48. Uit de Weerd, D.R., Piel, W.H., Gittenberger, E., 2004. Widespread polyphyly among Alopiinae snail genera: when phylogeny mirrors biogeography more closely than morphology. Mol. Phyl. Evol. 33, 533-548. Ursenbacher, S., Schweiger, S., Tomovic, L., Crnobrnja-Isailovic, J., Fumagalli, L., Mayer, W., 2008. Molecular phylogeography of the nose-horned viper (Vipera ammodytes, Linnaeus (1758)): Evidence for high genetic diversity and multiple refugia in the Balkan peninsula. Mol. Phyl. Evol. 46, 1116-1128. Vardinoyannis, K., Giokas, S., Mylonas, M., 2009. Terrestrial gasteropods. The Red Data Book of the Threatened Animals of Greece. Hellenic Zoological Society, Athens, pp. 436-454. Velitzelos, D., Bouchal, J.M., Denk, T., 2014. Review of the Cenozoic floras and vegetation of Greece. Review of Palaeobotany and Palynology 204, 56-117. Welter-Schultes, F., 2012. European non-marine molluscs, a guide for species identification. Planet Poster Editions, Göttingen. Winnepenninckx, B., Backeljau, T., Wachter, R., 1993. Extraction of high molecular weight DNA from molluscs. Trends Genet. 9, 407. Yang, Z., 2006. Computational Molecular Evolution. Oxford University Press. Yu, Y., Harris, A.J., He, X.-J., 2013. RASP (Reconstruct Ancestral State in Phylogenies) 2.1 beta. Available at http://mnh.scu.edu.cn/soft/blog/RASP.

Yu, Y., Harris, A.J., He, X., 2010. S-DIVA (Statistical Dispersal-Vicariance Analysis): A tool for inferring biogeographic histories. Mol. Phyl. Evol. 56, 848-850. Zhang, J., Kapli, P., Pavlidis, P., Stamatakis, A., 2013. A general species delimitation method with applications to phylogenetic placements. Bioinformatics 29, 2869-2876. Zilch, A., 1960. Gastropoda: Euthyneura. Bornträger.

Legends of figures

Fig. 1. Maps showing the localities of the samples used in this study; Chilostoma (Josephinella) (A and B), Chilostoma (Thiessea) (C and D), and Chilostoma (Cattania) (D). The numbers on the maps correspond to the sample code of Appendix A. All the morphological species of the three (sub)genera found in Greece are presented in theses maps with different shapes and shadows.

Fig. 2. Bayesian Inference tree based on the mtDNA dataset. The posterior probabilities (>0.95) and bootstrap support (>50%) for each major lineage are given on branches (no values and dashes mean low or no support). Colors and abbreviations in the nodes indicate reconstruction of ancestral distribution: Peloponnisos (P), continental Greece and Albania (cGA), Cyclades (C), northern Greece (nG), western Balkans (wB), and central Europe (cE). The probability of the ancestral area reconstruction of the node iii is: cGA 91.5%, cGA/P 8.5%; of the node iv: cGA/P 67.7%, P 32.3%; of the node v: cGA/P 50%, P 50%; of the node ix: wB 50%, wB/cGA 50%; of the node x: cGA 33.3%, wB/cGA 33.3%, wB 33.3%; of the node xi: cGA 26.8%, nG/cE 24.6%, cGA/nG/wB 24.6%, cGA/wB 24%; of the node xii: cGA/nG 97.5%, undetermined (indicated

with *) 2.5%, of the node xiii: nG 97.5%, undetermined 2.5%, of the node xvi: cGA/nG/wB/cE 50%, cGA/wB/cE 25%; for all other nodes 100% for the area depicted. These values correspond to the S-DIVA results; the DEC values were similar. The biogeographic events (d – dispersal, v – vicariance, e – extinction) and their probability (p) according to S-DIVA are given in the upper left corner as an inlaid table.

Fig. 3. Molecular timescale for the Chilostoma species in Greece. Ultrametric phylogenetic tree constructed by BEAST. The numbers on branches are the estimated time of divergences (in Mya) from the mtDNA and 95% highest posterior densities (HPD) are given in parenthesis. Asterisk indicates the calibration point, whereas black dots indicate posterior probabilities equal to 1.0 (maximum statistical support). The clades without dots are not well supported with values varied from 0.67 to 0.75 (low statistical support). Individuals of one species are collapsed into one terminal branch.

Table 1. Primers and conditions used in PCR amplificationsa and in cycle sequencing reactions.

Gene 16S rRNA

COI

ITS-1 a

Primers 16S-1 16S-2 PyrFor PyrRev1 LCO1490 HCO2198 Hgona_FCOI Hgona_RCOI ITS1FOR ITS1REV

Sequence (5΄ - 3΄) CGACTGTTTA(AT)CAAAAACAT GGTCTGAACTCAGATCATGT GCCTTAATCCAACATCGAGGT GCCGCAGTACATTGACTGTGC GGTCAACAAATCATAAAGATATTGG TAAACTTCAGGGTGACCAAAAAATCA TAATTGGHGGKTTTGGWAATTG GTRTTAAAATTTCGATCYG GTAAAAGTCGTAACAAGG TCCTCCGCTWAWTGATATGC

using single Taq DNA polymerase (Applied Biosystems ®)

Size

Conditions

Reference

o

~ 420 bp ~ 320 bp ~650 bp ~390 bp

o

3mM MgCl, 94 C/1min, 52.9 C/1min, 72oC/1min x35 cycles 3mM MgCl, 94oC/1min, 47oC/1min, 72oC/1min x35 cycles 3mM MgCl, 94oC/1min, 42oC/1min, 72oC/1min x35 cycles As above o

~500 bp

(Hatzoglou et al., 1995) (Kornilios et al., 2009) (Folmer et al., 1994) (Psonis et al., 2015)

o

3mM MgCl, 94 C/1min, 55 C/1min, 72oC/1min x 35 cycles

(Harris and Crandall, 2000)

Table 2. Genetic distances (Tamura & Nei model of evolution) of the 16S rRNA and COI (within brackets) genes(below diagonalleft) and ITS1 gene (above diagonal-right) among the major clades and subclades. Values in diagonal (italics) are within lineages sequence divergence for the three loci, whereas dashes indicate the absence of the taxon from the nDNA dataset, and n.a. indicate inability to compute inter-lineage divergence due to unitary representative of the lineage. CLADE 1. Josephinella SUBCLADE I

1 6.4 (7.6) /0.6

2

3

4

5

6

7

8

9

10

11

12

13

0.6

0.7

1.4

0.3

3.1

3.0

3.7

4.0

-

-

-

-

2. Josephinella SUBCLADE II

10.3 (13.5)

1.6 (3.5) /0.6

0.7

1.4

0.3

2.9

2.9

3.5

3.8

-

-

-

-

3. Josephinella SUBCLADE III

13.4 (17.5)

10.6 (12.0)

2.9 (4.2) /0.9

1.5

0.5

3.1

3.0

3.7

3.9

-

-

-

-

4. Josephinella SUBCLADE IV

14.3 (17.8)

13.4 (14.6)

13.1 (16.7)

1.8 (4.6) /2.3

1.2

3.4

3.4

3.8

3.8

-

-

-

-

5. Josephinella SUBCLADE V

15.4 (15.8)

11.3 (14.3)

13.5 (15.3)

9.4 (13.9)

3.1 (6.0) /0.0

2.9

2.7

3.2

3.3

-

-

-

-

6. Thiessea SUBCLADE I

37.0 (22.7)

35.6 (19.6)

38.0 (21.1)

34.9 (22.2)

34.9 (20.1)

5.2 (10.1) /1.6

1.5

4.6

4.2

-

-

-

-

7. Thiessea SUBCLADE II

40.2 (20.3)

39.6 (19.6)

38.1 (21.7)

33.8 (21.2)

36.8 (18.5)

11.5 (15.7)

2.6 (1.4) /n.a

4.5

4.4

-

-

-

-

8. Cattania SUBCLADE I

27.1 (24.1)

27.8 (20.8)

29.0 (22.4)

27.3 (21.9)

27.0 (20.7)

28.2 (24.4)

30.6 (19.3)

0.8 (2.6) /0.2

2.1

-

-

-

-

9. Cattania SUBCLADE II

28.5 (23.0)

28.8 (22.3)

30.2 (23.1)

30.1 (22.2)

29.3 (21.6)

28.5 (23.9)

29.5 (22.2)

14.1 (20.3)

2.5 (5.1) /0.7

-

-

-

-

10. Dinarica

29.0 (22.3)

29.1 (21.6)

27.8 (22.8)

26.9 (21.4)

31.6 (22.0)

33.0 (21.3)

34.3 (18.2)

28.3 (23.3)

26.4 (24.2)

n.a (n.a.) /-

-

-

11. Liburnica

29.9 (26.4)

30.7 (24.4)

31.0 (27.5)

30.0 (25.5)

32.3 (22.7)

36.8 (25.4)

31.7 (23.0)

26.5 (23.4)

21.8 (22.2)

23.1 (22.7)

-

-

3.1 (5.7) /-

12. Vidovicia

25.0 (22.1)

24.6 (21.2)

26.8 (23.1)

28.0 (21.1)

30.8 (20.6)

31.7 (20.7)

33.3 (17.9)

24.0 (20.2)

23.5 (21.4)

17.1 (19.9)

22.3 (18.1)

0.0 (0.0) /-

-

13. Kosicias

25.5 (21.0)

26.8 (20.6)

27.2 (20.7)

27.6 (20.9)

31.1 (20.0)

34.6 (23.6)

38.2 (18.6)

28.3 (21.7)

26.5 (21.1)

29.5 (22.1)

29.3 (20.3)

20.6 (19.0)

1.7 (4.4) /-

Table 3. Genera and subgenera taxonomic status of the taxa used in the present study according to various authors. Taxon name (used in this study)

Clade / Subclade (in this study)

sphaeriostoma

I/I

cyclolabris

I/I

euboeae

I/I

fuchsiana

I/II

amorgia

I/II

bacchica

I/II

conemenosi

Subai various papers (Date below)

Schileyko, 2006

Chilostoma (Thiessea) (1996) Chilostoma (Thiessea) (1996) Chilostoma (Thiessea) (1996) Chilostoma (Thiessea) (1996) Chilostoma (Thiessea) (1996) Chilostoma (Thiessea) (1996)

Helicigona (Thiessea) Helicigona (Thiessea) Helicigona (Thiessea) Helicigona (Thiessea) Helicigona (Thiessea) Helicigona (Thiessea)

II/I

---

argentellei

II/I & II/V

eliaca

Groenenberg, 2012

Welter- Schultes, 2012

Thiessea

Helicigona

---

Helicigona

Thiessea

Helicigona

---

Helicigona

----

Helicigona

----

Helicigona

Campylaea

Josephinella

Helicigona

---

Campylaea

Josephinella

Helicigona

II/I

---

Campylaea

----

Helicigona

comephora

II/I

---

Campylaea

---

Helicigona

cf. hymetti

II/I

---

Campylaea

---

Helicigona

subzonata

II/II & II/IV

---

Campylaea

Josephinella

Helicigona

vikosensis

II/III

Superba (2006) Liburnica (2012)

Campylaea

Josephinella

Helicigona

phocaea

II/III

---

Campylaea

Josephinella

Helicigona

hemonica

II/IV

---

Campylaea

---

Helicigona

krueperi

II/V

---

Campylaea

Josephinella

Helicigona

trizona

III/I & III/II

---

Campylaea

Cattania

Helicigona

trizona (Pangaio peak)

III/II

---

Campylaea

Cattania

Helicigona

Schileyko, 2013 Main text; according to (sub)genera distribution patterns Chilostoma (Thiessea) Chilostoma (Thiessea) Chilostoma (Thiessea) Chilostoma (Thiessea) Chilostoma (Thiessea) Chilostoma (Thiessea) Chilostoma (Josephinella) Chilostoma (Josephinella) Chilostoma (Josephinella) Chilostoma (Josephinella) Chilostoma (Thiessea) Chilostoma (Josephinella) Chilostoma (Josephinella) Chilostoma (Josephinella) Chilostoma (Josephinella) Chilostoma (Josephinella) Chilostoma (Cattania) Chilostoma (Josephinella)

Schileyko, 2013 Appendix Chilostoma (Thiessea) Chilostoma (Thiessea) Chilostoma (Thiessea) Chilostoma (Thiessea) Chilostoma (Thiessea) Chilostoma (Thiessea)

Cadahía et al., 2014 Thiessea -----------

?Liburnica

---

Chilostoma (?Josephinella)

---

?Drobacia

---

Unclassified (Helicigona) Chilostoma (Thiessea)

-----

Bank, 2014 (Fauna Europaea) Chilostoma (Thiessea) Chilostoma (Thiessea) Chilostoma (Thiessea) Chilostoma (Thiessea) Chilostoma (Thiessea) Chilostoma (Thiessea) Chilostoma (Josephinella) Chilostoma (Josephinella) Chilostoma (Josephinella) Chilostoma (Josephinella) Chilostoma (Thiessea) Chilostoma (Josephinella)

Drobacia

---

Chilostoma (Josephinella) Chilostoma (Josephinella) Chilostoma (Josephinella)

---

Superba

---

Chilostoma (Josephinella) Chilostoma (Josephinella) Chilostoma (Josephinella)

Josephinella

?Campylaea

---

Chilostoma (Cattania) Chilostoma (Josephinella)

---

Cattania

Cattania

Chilostoma (Josephinella)

• • • •

No classification system reflects the systematics of Chilostoma lineages in Greece. There is incongruence between morphology-based taxonomy and molecular phylogeny. The diversification in the Greek area occurred during the Upper Miocene/Pliocene. Vicariance and dispersal events influenced the Chilostoma differentiation in Greece.

Annotated type catalogue of the Bulimulidae (Mollusca, Gastropoda, Orthalicoidea) in the Natural History Museum, London.

Neurosecretion in the basommatophoran snail Bulinus truncatus (Gastropoda, Pulmonata).

Annotated type catalogue of the Megaspiridae, Orthalicidae, and Simpulopsidae (Mollusca, Gastropoda, Orthalicoidea) in the Natural History Museum, London.

Complete mitochondrial genome of Peronia verruculata (Gastropoda: Pulmonata: Systellommatophora: Onchidiidae).

Identification of muramyl derivatives in Mollusca Gastropoda tissue.

Diversity of Indo-West Pacific Siphonaria (Mollusca: Gastropoda: Euthyneura).

Systematics of the family Plectopylidae in Vietnam with additional information on Chinese taxa (Gastropoda, Pulmonata, Stylommatophora).

The Bulimulidae (Mollusca: Pulmonata) from the Región de Atacama, northern Chile.

Review of the genus Endothyrella Zilch, 1960 with description of five new species (Gastropoda, Pulmonata, Plectopylidae).

Unraveling the Evolutionary Determinants of Sleep.

The Vermetidae of the Gulf of Kachchh, western coast of India (Mollusca, Gastropoda).

Distinct Viral Lineages from Fish and Amphibians Reveal the Complex Evolutionary History of Hepadnaviruses.

Granopupa in Iran, monophyly, and the fossil Granariinae (Gastropoda, Pulmonata, Chondrinidae).

Six new species of Australocosmica Köhler, 2011 from the Kimberley Islands, Western Australia (Mollusca: Pulmonata: Camaenidae).

The venomous cocktail of the vampire snail Colubraria reticulata (Mollusca, Gastropoda).

Reconstructing the Evolutionary History of Powdery Mildew Lineages (Blumeria graminis) at Different Evolutionary Time Scales with NGS Data.

Unraveling the Population History of Indian Siddis.

The Neotropical land snails (Mollusca, Gastropoda) collected by the 'Comisión Científica del Pacífico'.

Unusual micrometric calcite-aragonite interface in the abalone shell Haliotis (Mollusca, Gastropoda).

Mitochondrial DNA hyperdiversity and its potential causes in the marine periwinkle Melarhaphe neritoides (Mollusca: Gastropoda).

Ontogeny and morphological variability of shell in populations of Leptinaria unilamellata (d'Orbigny, 1835) (Mollusca, Pulmonata, Subulinidae).

The family Plectopylidae (Gastropoda, Pulmonata) in Laos with the description of two new genera and a new species.

Taxonomic revision of the rock-dwelling door snail genus Montenegrina Boettger, 1877 (Mollusca, Gastropoda, Clausiliidae).

Effects of ammonium chloride on microbicidal activity in hemocytes of Biomphalaria glabrata (Mollusca: Pulmonata).