RESEARCH ARTICLE

Unusual Angiogenic Factor Plays a Role in Lizard Pregnancy but is Not Unique to Viviparity CAMILLA M. WHITTINGTON1*, GEORGES E. GRAU2, CHRISTOPHER R. MURPHY2, AND MICHAEL B. THOMPSON1 1

School of Biological Sciences, University of Sydney, Sydney, New South Wales, Australia School of Medical Sciences, Bosch Institute, University of Sydney, Sydney, New South Wales, Australia 2

ABSTRACT

J. Exp. Zool. (Mol. Dev. Evol.) 324B:152–158, 2015

Angiogenesis (blood vessel growth), a key process of mammalian pregnancy, facilitates gas exchange and nutrient transport between the mother and the embryo and is regulated by a suite of growth factors. Vascular endothelial growth factor (VEGF) is crucial to this process in pregnant mammals and potentially pregnant squamates (lizards and snakes), as we investigate here. VEGF111, an unusual and potent angiogenic splice variant of VEGF, increases its expression during pregnancy in the uterus of a viviparous lizard, in parallel with similar increases in uterine angiogenesis during gestation. However, we also find that VEGF111 is expressed in oviparous skinks, and is not ubiquitous among viviparous skinks. Thus, different mechanisms of uterine angiogenesis during pregnancy may evolve concurrent with viviparity in different lizard lineages. J. Exp. Zool. (Mol. Dev. Evol.) 324B:152–158, 2015. © 2015 Wiley Periodicals, Inc. How to cite this article: Whittington CM, Grau GE, Murphy CR, Thompson MB. 2015. Unusual angiogenic factor plays a role in lizard pregnancy but is not unique to viviparity. J. Exp. Zool. (Mol. Dev. Evol.) 324B:152–158.

Viviparity (live birth) has evolved independently from oviparity (egg-laying) more than 150 times in vertebrates (Blackburn, 2014). Understanding the physiology of pregnancy across a broad range of taxa is important to allow broad conclusions to be drawn about the evolution of viviparity. Angiogenesis, the growth of new blood vessels from existing vascularisation, is a central process occurring during mammalian pregnancy (Reynolds et al., 2006), but little is known about its role in pregnancy in nonmammalian taxa. Angiogenesis is required for mothers to support internally developing embryos by facilitating gas exchange and in some species, nutrient transport (Zygmunt et al., 2003). The importance of angiogenesis during pregnancy is illustrated by the enormous blood vessel growth in the human placenta that is required to support the developing fetus, and the gestational diseases related to abnormal vasculogenesis and angiogenesis (Zygmunt et al., 2003; Reynolds et al., 2006). Vascular endothelial growth factor A (VEGF-A) is a key mediator of angiogenesis (Vempati et al., 2014). VEGF-A is encoded by a single gene that undergoes alternative splicing during transcription to yield splice variants (isoforms) of differing lengths. Splice variants are named according to the

length of their amino acid sequences, with variants such as VEGF189, VEGF165, and VEGF121 (human nomenclature) commonly expressed in a variety of tissues (Vempati et al., 2014). Various VEGF variants are also differentially expressed in the uterus during pregnancy in mammals (Vuorela et al., '97; Halder

Abbreviations: ACTB, beta-actin; PCR, polymerase chain reaction; RTqPCR, real-time quantitative PCR; VEGF, vascular endothelial growth factor; VEGF111, vascular endothelial growth factor splice variant 111. Grant sponsor: Australian Research Council; grant number: DP120100649. Conflicts of interest: None. Additional supporting information may be found in the online version of this article at the publisher’s web-site.
Correspondence to: Camilla M. Whittington, School of Biological Sciences, Heydon-Laurence A08, The University of Sydney, Camperdown, New South Wales 2006, Australia. E-mail: [email protected] Received 27 November 2014; Accepted 18 January 2015 DOI: 10.1002/jez.b.22615 Published online in Wiley Online Library (wileyonlinelibrary.com).

© 2015 WILEY PERIODICALS, INC.

VEGF111 IN LIZARD PREGNANCY et al., 2000; Ancelin et al., 2002) and lizards (Murphy et al., 2010a). Recently, an unusually short VEGF splice variant, VEGF111, was discovered in cultures of DNA-damaged human cells (Mineur et al., 2007). This variant is missing the domains that undergo proteolysis and that bind to the extracellular matrix in longer splice variants. VEGF111 is thus resistant to proteolysis, highly bioavailable, and its small size makes it highly diffusible (Mineur et al., 2007). Consequently, VEGF111 is a potent mediator of the angiogenesis implicated in human cancers. VEGF111 is not expressed in normal human and mouse tissues (Mineur et al., 2007); the only whole animal model known to express this variant is Saiphos equalis (Australian three-toed skink; Grey) (Murphy et al., 2010a). Saiphos equalisis one of only three lizard species in which reproductive bimodality is firmly established, with viviparous northern high altitude populations and egg-laying populations in the southern lowlands (Smith and Shine, '97). VEGF111 is expressed in the uterus of pregnant viviparous S. equalis, suggesting a role for VEGF111 in lizard pregnancy. Qualitative measures suggest that VEGF111 expression is higher during pregnancy than in non-reproductive individuals (Murphy et al., 2010a). Since some populations of this species are oviparous, S. equalis represents a very recent transition from oviparity to viviparity (Stewart et al., 2010). Squamate reptiles (lizards and snakes) have independently made the transition to viviparity multiple times, and represent important models for studying the evolution of live birth (Van Dyke et al., 2014). Expression of VEGF111 in viviparous S. equalis suggests that this potent angiogenic factor may play an important role in the evolution of lizard viviparity. Viviparity evolves from oviparity via increasing the length of egg retention (Packard et al., '77; Shine, '83). The uterus presents a significant barrier to respiratory gas diffusion in internally incubated embryos compared to eggs incubated in the external environment. As low oxygen conditions constrain embryonic development in squamates and other taxa (e.g., Black and Snyder, '80; Seymour et al., 2000; Andrews, 2002; Woods and Hill, 2004; Parker and Andrews, 2006), increasing egg retention must be accompanied by adaptations to facilitate gas exchange, such as reduced thickness of egg coverings, haemoglobin with high oxygen affinity, and increased uterine vascularisation (Guillette and Jones, '85; Andrews, 2002; Parker and Andrews, 2006). If increased vascularization of the uterus is essential to the evolution of viviparity, it is possible that VEGF111 expression is a key adaptation allowing the evolution of viviparity in S. equalis. Next-generation sequencing techniques can often be leveraged to examine the gene expression of the many genes underlying a complex novel trait such as viviparity. However, these are inappropriate for characterizing VEGF111 expression, as the poor read depth of an existing S. equalis uterine transcriptome (Brandley and Thompson, unpublished data) confounded our attempts to quantify lowly expressed genes and splice variants such as VEGF111. Thus, a candidate gene approach

153 is the only practicable alternative. We used this approach to test the hypothesis that VEGF111 is important in the evolution of viviparity by first quantifying VEGF111 gene expression in viviparous S. equalis pregnancy to determine whether VEGF111 increases during pregnancy in line with blood vessel growth, and second, analysing gene expression in targeted Australian skink species to determine whether VEGF111 expression is unique to S. equalis and/or viviparous skinks.

MATERIALS AND METHODS Sample Collection All research was approved by the University of Sydney Animal Ethics Committee (L04/10-2011/35/607). We collected skinks from both the Eugongylus and Sphenomorphus clades (Table S1) under National Parks and Wildlife Service collection permit SL100401, Tasmanian Department of Primary Industries and Water permit 8343/07, South Australian National Parks and Wildlife Service Permits to Undertake Scientific Research G24407 and Y24248, and South Australian Department for Environment and Heritage Export Protected Animal Permit E12594. Species collected were Lampropholis guichenoti (Duméril & Bibron), Niveoscincus ocellatus (Grey), Pseudemoia entrecasteauxii (Duméril & Bibron) (Eugongylus group), and Anomalopus leuckartii (Weinland), Calyptotis ruficauda (Greer), Ctenotus taeniolatus (White), Eulamprus tympanum (Lönnberg & Andersson), Hemiergis peronii (Gray), Lerista bougainvillii (Gray), Saiphos equalis (Sphenomorphus group). We collected reproductively mature females between 2006 and 2013 from the locales listed in Table S1, and maintained these animals under standard laboratory conditions as previously described (Parker et al., 2010) to sample reproductive tissues at different stages of pregnancy. Euthanasia was by intra-abdominal injection of an overdose of sodium pentobarbitone (6 mg/mL). Using a light microscope we collected the entire uterus of non-reproductive animals, and the uterine regions immediately surrounding embryos in gravid/pregnant animals. Tissues were immediately fixed in RNAlater (Sigma– Aldrich, St Louis, MO, USA) following standard protocols, with final storage at 80°C. We fixed excised embryos in 10% neutral buffered formalin for 24 h and stored them in 70% ethanol for staging based on the method of Dufaure and Hubert ('61). RNA Extraction and cDNA Synthesis Uterine samples were disrupted and homogenised using the 3 mm steel bead TissueLyser II system (Qiagen, Hilden Germany) and QiaShredder (Qiagen). Total RNA was extracted using an RNeasy Plus Mini Kit (Qiagen), which includes an in-built DNAse treatment. RNA concentration and integrity were assessed using a Bioanalyzer (Agilent, Santa Clara, CA, USA) and only high quality RNA (RIN>7.5) was used for downstream qPCR analysis. cDNA was synthesised with SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad, CA, USA) and J. Exp. Zool. (Mol. Dev. Evol.)

154 combined OligodT and random hexamer priming, following the manufacturer’s instructions for 20 mL reaction volumes. Endpoint PCR for Presence/Absence of VEGF111 The gene encoding beta-actin (ACTB) was used as the positive control to ensure uniform amplification for each tissue (intronspanning primers sense: 50 -CTGGCCTCACTGTCCACCTT; antisense 50 -GGGCCGGACTCATCGTACT; 65 bp amplicon). Gene of interest primers were designed to span the unique exon junction of VEGF111 (Genbank accession number GQ183876.1; sense: 50 CATGAACTTTCTGCTCACTTGG in Exon 1; antisense: 50 TCGGTTTTTCACATCTGCATT across the Exon 4/8 junction; 406 bp amplicon) (Murphy et al., 2010a). PCR reactions were carried out using recombinant Invitrogen Taq DNA polymerase (Life Technologies, Mulgrave, Victoria) as follows: 10 mL total volume containing 1 buffer, 1.5 mM MgCl2, 0.2 mM dNTPs, 0.2 mM of each primer, 0.5 mL template, and 0.5 units Taq polymerase. The thermal cycling profile was 94°C for 3:00, then 36 cycles of 94°C for 0:30, 56°C for 1:20, and 72°C for 1:30, followed by 72°C for 10:00. PCR products were subjected to electrophoresis at 110 V for 25 min in 1.2% TBE agarose gels run with a 100 bp–1.5 kb DNA ladder as size standard (Bio Basic, Canada), stained with SybrSafe (Life Technologies), and visualised using a blue light illumination system (Maestrogen, Las Vegas, NV, USA). Resulting VEGF111 bands were excised and purified using an UltraClean GelSpin DNA extraction kit (Mo Bio, Carlsbad, CA, USA). Purified PCR product was dye-termination sequenced at the Australian Genome Research Facility (Sydney) to confirm sequence identity. Bands were successfully sequenced for all species with a VEGF111sized band (406 bp), except for E. tympanum for which multiple attempts to sequence were unsuccessful. All sequences were checked to ensure that they spanned the unique VEGF111 exon junction. RT-qPCR RT-qPCR was carried out in uterine samples from viviparous S. equalis individuals (the only species for which we had sufficient sample size for analysis). cDNA samples constructed from ~400 ng of RNA from 17 individuals at three different stages of pregnancy. Pregnancy stages were defined as non-reproductive (N ¼ 5; skinks with no embryos), late pregnant (N ¼ 6; embryonic stage 36 (Dufaure and Hubert, '61), and near-term (N ¼ 6; embryonic stage 39/40 (Dufaure and Hubert, '61), which corresponds to the stages used in a previous study of uterine angiogenesis in the same species (Parker et al., 2010). Primers were designed using Primer3 software (Rozen and Skaletsky, 2000) with selection forced across the unique VEGF111 exon junction. Primer sequences were: sense 50 -TCATCAGGGCCAGCACTTA; antisense 50 -TCGGTTTTTCACATCTGCATTC, amplifying a 64 bp amplicon. Although Beacon Designer primer analysis (Premier Biosoft) indicated the potential for primer dimerization, J. Exp. Zool. (Mol. Dev. Evol.)

WHITTINGTON ET AL. the need to have primers spanning the unique VEGF111 exon junction meant we had little choice in primer site. VEGF111 primers were validated using end-point PCR and dye-termination sequencing as described above. The gene encoding beta-actin (ACTB) was used as a reference gene, with the same primers as used for endpoint PCR. These primers have been validated previously for use in skink uterus (Griffith et al., 2013). RT-qPCR analysis was carried out using the QuantiFast SYBR Green PCR protocol (Qiagen) and a Rotor-Gene 6000 machine (Qiagen). PCR reactions were set up manually in 20 mL total, with a cDNA equivalence of 5 ng of RNA and primer concentration of 0.5 mM. The thermal cycling profile was 95°C for 10:00 followed by 40 cycles of (95°C for 0:15 and 60°C for 0:30 with fluorescence signal acquisition). Triplicate reactions were run for each sample. Melt curve analysis (72–95°C) was carried out at the end of every run to confirm amplification of a single product in each reaction. Due to the restrictions on primer design and the low expression of VEGF111 in some samples, the VEGF111 primers stochastically formed dimers, as evidenced by peaks at incorrect sizes in the no template control melt curves and multiple peaks in the melt curve analysis in some sample replicates. These replicates were excluded from the analysis, with the reactions re-run until we had obtained reactions with a single amplicon of the correct size (406 bp, corresponding to ~80°C peak in melt curve; this was confirmed by running the product on an agarose gel as above and sequencing) in at least triplicate for every sample. No template controls were included in every run. No-RT qPCR negative control reactions were run in duplicate for each sample; those with a peak in the melt curve at the expected size were below the linear dynamic range for the assay. Standard curves were generated using serial 1:4 dilutions of a composite sample containing equal parts of cDNA samples generated from 11 different S. equalis uterus RNAs. All dilutions were run in triplicate. qPCR analysis was carried out using RotorGene 6000 Series Software v1.7 (Qiagen), with Cq determined automatically (the R value is maximised to most closely approach 1.0). The standard curves for ACTB (slope ¼ 3.095, y intercept ¼ 24.619; Fig. S1) and VEGF111 (slope ¼ 3.377, y intercept ¼ 33.948; Fig. S2) had an R2 > 0.985 and contained at least four dilutions from the dilution series, and had PCR efficiencies of 0.98 and 1.1, respectively. The ACTB standard curve had a linear dynamic range (LDR) of three orders of magnitude, whilst the VEGF111 standard curve had a LDR of two orders of magnitude; it was not possible to increase the VEGF111 LDR due to the preferential amplification of primer dimers at low template concentration. All Cq values for unknowns fell within the linear quantifiable range of the appropriate standard curve. VEGF111 expression values were normalised to ACTB expression. Three groups were defined based on pregnancy stage as outlined above. Normalized VEGF111 expression data were loge transformed to conform to a normal distribution (Shapiro–Wilk normality test; P > 0.05) and equivalent variance among groups

VEGF111 IN LIZARD PREGNANCY (Levene’s test; P > 0.05). An ANOVA was used to determine whether reproductive stage has a significant effect on VEGF111 expression. Post-hoc pairwise comparisons between groups were made using Tukey’s multiple comparisons of means test. Statistical analyses were performed with R version 2.15.3 in RStudio (Version 0.98.507, RStudio Inc.), except for the Levene’s test, which was performed in XLSTAT (Version 2014.3.04, Addinsoft).

RESULTS Phylogenetic Distribution of VEGF111 VEGF111 is expressed in all Australian Sphenomorphus group species that we investigated (Fig. 1, Table S1), but not in any Eugongylus group species. Presence or absence of VEGF111 was not correlated with parity mode. Where multiple individuals from the same species were sequenced, amino acid sequences were monomorphic within a species, including in bimodally reproductive taxa, and did not show any viviparity-specific amino acid substitutions that might indicate differential activities in species with different parity modes (Fig. 2). All sequences are publicly available on GenBank (accession numbers: KM597481KM597487). VEGF111 Expression Across Pregnancy Reproductive stage had a significant effect on VEGF111 gene expression (ANOVA F2,14 ¼ 5.132, P ¼ 0.0213), with near-term pregnant lizards having significantly higher VEGF111 expression than non-reproductive individuals (Padj ¼ 0.018). VEGF111 ex-

Figure 1. Phylogeny of Australian Eugongylus and Sphenomorphus group skinks, based that of Reeder (2003). Check marks indicate species with uterine expression of VEGF111 and crosses indicate species without uterine expression of VEGF111.

155 pression in late pregnant and non-reproductive individuals and near-term and late pregnant individuals was not significantly different (Padj ¼ 0.40 and Padj ¼ 0.17, respectively, Fig. 3).

DISCUSSION Uterine VEGF111 expression increases during pregnancy in viviparous S. equalis, which parallels a significant increase in uterine vascular density in near-term pregnant mothers in response to the rapidly increasing metabolic demands of the latestage embryo (Parker et al., 2010). Thus, VEGF111, a potent angiogenic factor, likely plays a role in uterine angiogenesis during pregnancy in viviparous S. equalis. Reproductive hormones such as oestrogen and progesterone increase VEGF expression in the human and rodent reproductive tract (e.g., Hyder and Stancel, '99; Ancelin et al., 2002; Sugino et al., 2002) and may drive increased VEGF expression in the pregnant skink uterus. The increase in VEGF111 expression and angiogenesis in near-term viviparous S. equalis may also be driven by low oxygen partial pressure in the uterus. Hypoxia is an inducer of VEGF expression that potently drives angiogenesis (e.g., Shweiki et al., '92; Liu et al., '95), which would help to alleviate hypoxia. Metabolic rates and embryonic mass in squamate eggs and viviparous embryos show an exponential increase in oxygen consumption throughout development (e.g., DeMarco, '93, Thompson and Stewart, '97; Robert and Thompson, 2000; Murphy et al., 2010b; Van Dyke and Beaupre, 2011). Although hypoxia does not induce VEGF111 expression in DNA-damaged human cell cultures (Mineur et al., 2007), this may not be indicative of in vivo activity, as hypoxia induces expression of other VEGF splice variants (Dibbens et al., '99). We speculate that the increasing demands for gas exchange in near-term viviparous S. equalis embryos may induce short-term reductions in uterine oxygen partial pressure, followed by subsequent VEGF111 expression to promote angiogenesis and maintain oxygen concentration. Unexpectedly, we found that VEGF111 is also expressed in oviparous S. equalis individuals. Furthermore, uterine VEGF111 expression is not unique to S. equalis, or indeed to viviparous skinks. Instead, VEGF111 is expressed in all species of the Sphenomorphus clade of Australian skinks that we investigated, regardless of parity mode. The ubiquity of VEGF111 in Sphenomorphus skinks suggests that this splice variant is a product of phylogenetic position rather than a signature of viviparity. Expression of VEGF111 alone does not necessarily contribute to a switch in parity mode, and VEGF111 sequences do not show any viviparity-specific mutations that could cause functional changes to the peptide. Alternative splice variants of VEGF (VEGF185, VEGF161) or expression of other angiogenic genes may produce uterine angiogenesis in viviparous Eugongylus group skinks that do not express VEGF111 (Murphy et al., 2010a). VEGF111-induced angiogenesis in Sphenomorphus group skinks can be considered a different mechanism to angiogenesis J. Exp. Zool. (Mol. Dev. Evol.)

156

WHITTINGTON ET AL.

Figure 2. Alignment of VEGF111 amino acid sequences of oviparous (O) and viviparous (V) skinks. Dots indicate amino acids that are identical to viviparous Saiphos equalis VEGF111. X denotes amino acids encoded by ambiguous nucleotides.

produced by other VEGF isoforms, because VEGF111 undergoes a specific pattern of alternative splicing to form a structure with unique properties, namely resistance to proteolysis, high bioavailability, and potent initiation of angiogenesis (Mineur et al., 2007). The absence of VEGF111 in viviparous Eugongylus group skinks parallels expression of the tight junctional protein occludin in the uterus of Eugongylus, but not Sphenomorphus group skinks (Biazik et al., 2007). These results suggest that different mechanisms of angiogenesis and other processes of pregnancy such as nutrient transport may evolve with each independent origin of viviparity. The same mechanisms may also be utilized in multiple transitions to viviparity in some lineages, as seen here in the multiple transitions to viviparity in VEGF111expressing Sphenomorphus group species (Fig. 1). Despite the lack of viviparity-specific VEGF111 expression or sequence, we do not rule out a role for VEGF111 in the evolution of viviparity in Sphenomorphus group skinks. Regulation of gene

expression, rather than the emergence of novel genes, is increasingly thought to underpin the evolution of new functions and phenotypes (Levine and Tjian, 2003). Regulation of VEGF111 expression during pregnancy, rather than sequence or presence alone, may differ between oviparous and viviparous skinks. Future qPCR experiments in gravid and non-gravid oviparous skinks should examine this possibility. Bimodally reproductive species such as S. equalis provide an ideal model for such comparisons, allowing assessment of animals that differ by parity mode but are very similar in other respects (Smith et al., 2001). In conclusion, here we show that expression of VEGF111, a potent angiogenic factor, increases during pregnancy in a viviparous lizard, in parallel with increasing uterine angiogenesis. We suggest that VEGF111 expression is driven in part by low oxygen partial pressures in the pregnant uterus. This unusual splice variant is not unique to viviparous species and it is not ubiquitous in viviparous skinks, suggesting that different

Figure 3. Boxplot of relative uterine expression of VEGF111 at different stages of pregnancy in viviparous female S. equalis. Whiskers span the minimum and maximum values for each group, whilst boxes enclose the first to third quartiles; the bold line inside each box represents the group median.

J. Exp. Zool. (Mol. Dev. Evol.)

VEGF111 IN LIZARD PREGNANCY molecules may promote uterine angiogenesis each time viviparity evolves.

ACKNOWLEDGMENTS The authors thank S. Parker for providing Niveoscincus, Lampropholis, Eulamprus, and Ctenotus samples, M. Greenlees for Calyptotis and J. McKenna for Anomalopus and Hemiergis collection, K. Hendrawan and O. Griffith for providing Pseudemoia samples, M. Brandley for providing Lerista samples, J. Herbert for field work and laboratory assistance, and M Laird, J. Van Dyke and the Thompson Lab for field work assistance and helpful comments on early versions of this manuscript. The authors are grateful to M. Olsson for sharing his molecular laboratory space and equipment. RNA integrity analysis was carried out in the Bosch Molecular Biology Facility at the University of Sydney. This study was funded by Australian Research Council grant DP120100649 to MBT, CRM, and GEG. Ethical approval All applicable international, national, and/or institutional guidelines for the care and use of animals were followed. All procedures performed in studies involving animals were in accordance with the ethical standards of the University of Sydney.

LITERATURE CITED Ancelin M, Buteau-Lozano H, Meduri G, et al. 2002. A dynamic shift of VEGF isoforms with a transient and selective progesterone-induced expression of VEGF(189) regulates angiogenesis and vascular permeability in human uterus. Proc Natl Acad Sci USA 99:6023– 6028. Andrews RM. 2002. Low oxygen: a constraint on the evolution of viviparity in reptiles. Physiol Biochem Zool 75:145–154. Biazik JM, Thompson MB, Murphy CR. 2007. The tight junctional protein occludin is found in the uterine epithelium of squamate reptiles. J Comp Physiol B Biochem Syst Environ Physiol 177:935– 943. Black CP, Snyder GK. 1980. Oxygen transport in the avian egg at high altitude. Am Zool 20:461–468. Blackburn DG. 2014. Evolution of vertebrate viviparity and specializations for fetal nutrition: a quantitative and qualitative analysis. J Morphol DOI: 10.1002/jmor.20272 DeMarco V. 1993. Metabolic rates of female viviparous lizards (Sceloporus jarrovi) throughout the reproductive cycle: do pregnant lizards adhere to standard allometry? Physiol Zool 66:166–180. Dibbens JA, Miller DL, Damert A, et al. 1999. Hypoxic regulation of vascular endothelial growth factor mRNA stability requires the cooperation of multiple RNA elements. Mol Biol Cell 10:907–919. Dufaure J, Hubert J. 1961. Table de developpement du lezard civipareLacerta (Zootoca) vivipara Jacquin. Archives D Anatomie Microscopique Et De Morphologie Experimentale 50:409–436.

157 Griffith OW, Ujvari B, Belov K, Thompson MB. 2013. Placental lipoprotein lipase (LPL) gene expression in a placentotrophic lizard, Pseudemoia entrecasteauxii. J Exp Zool B 320:465–470. Guillette LJ, Jones RE. 1985. Ovarian, oviductal, and placental morphology of the reproductively bimodal lizard, Sceloporus aeneus. J Morphol 184:85–98. Halder JB, Zhao X, Soker S, et al. 2000. Differential expression of VEGF isoforms and VEGF(164)-specific receptor neuropilin-1 in the mouse uterus suggests a role for VEGF(164) in vascular permeability and angiogenesis during implantation. Genesis 26:213–224. Hyder SM, Stancel GM. 1999. Regulation of angiogenic growth factors in the female reproductive tract by estrogens and progestins. Mol Endocrinol 13:806–811. Levine M, Tjian R. 2003. Transcription regulation and animal diversity. Nature 424:147–151. Liu Y, Cox SR, Morita T, Kourembanas S. 1995. Hypoxia regulates vascular endothelial growth factor gene expression in endothelial cells: identification of a 50 enhancer. Circ Res 77:638–643. Mineur P, Colige AC, Deroanne CF, et al. 2007. Newly identified biologically active and proteolysis-resistant VEGF-A isoform VEGF111 is induced by genotoxic agents. J Cell Biol 179:1261–1273. Murphy BF, Belov K, Thompson MB. 2010a. Evolution of viviparity and uterine angiogenesis: vascular endothelial growth factor (VEGF) in oviparous and viviparous skinks. J Exp Zool B 314B:148–156. Murphy BF, Parker SL, Murphy CR, Thompson MB. 2010b. Angiogenesis of the uterus and chorioallantois in the eastern water skink Eulamprus quoyii. J Exp Biol 213:3340–3347. Packard GC, Tracy CR, Roth JJ. 1977. The physiological ecology of reptilian eggs and embryos and the evolution of viviparity within the class Reptilia. Biol Rev 52:71–105. Parker SL, Andrews RM. 2006. Evolution of viviparity in Sceloporine lizards: in utero pO2 as a developmental constraint during egg retention. Physiol Biochem Zool 79:581–592. Parker SL, Manconi F, Murphy CR, Thompson MB. 2010. Uterine and placental angiogenesis in the Australian skinks, Ctenotus taeniolatus, and Saiphos equalis. Anat Rec 293:829–838. Reeder TW. 2003. A phylogeny of the Australian Sphenomorphus group (Scincidae: Squamata) and the phylogenetic placement of the crocodile skinks (Tribolonotus): Bayesian approaches to assessing congruence and obtaining confidence in maximum likelihood inferred relationships. Mol Phylogenet Evol 27:384–397. Reynolds LP, Caton JS, Redmer DA, et al. 2006. Evidence for altered placental blood flow and vascularity in compromised pregnancies. J Physiol 572:51–58. Robert KA, Thompson MB. 2000. Energy consumption by embryos of a viviparous lizard, Eulamprus tympanum, during development. Comp Biochem Physiol A Comp Physiol 127:481–486. Rozen S, Skaletsky HJ. 2000. Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, editor. Bioinformatics methods and protocols: methods in molecular biology. Totowa, NJ: Humana Press. p 365–386. J. Exp. Zool. (Mol. Dev. Evol.)

158 Seymour RS, Roberts JD, Mitchell NJ, Blaylock AJ. 2000. Influence of environmental oxygen on development and hatching of aquatic eggs of the Australian frog, Crinia georgiana. Physiol Biochem Zool 73:501–507. Shine R. 1983. Reptilian viviparity in cold climates: testing the assumptions of an evolutionary hypothesis. Oecologia 57:397–405. Shweiki D, Itin A, Soffer D, Keshet E. 1992. Vascular endothelial growth factor induced by hypoxia may mediate hypoxia-initiated angiogenesis. Nature 359:843–845. Smith SA, Shine R. 1997. Intraspecific variation in reproductive mode within the scincid lizard Saiphos equalis. Aust J Zool 45:435–445. Smith SA, Austin CC, Shine R. 2001. A phylogenetic analysis of variation in reproductive mode within an Australian lizard (Saiphos equalis, Scincidae). Biol J Linn Soc 74:131–139. Stewart JR, Mathieson AN, Ecay TW, et al. 2010. Uterine and eggshell structure and histochemistry in a lizard with prolonged uterine egg retention (Lacertilia, Scincidae, Saiphos). J Morphol 271:1342– 1351. Sugino N, Kashida S, Karube-Harada A, Takiguchi S, Kato H. 2002. Expression of vascular endothelial growth factor (VEGF) and its receptors in human endometrium throughout the menstrual cycle and in early pregnancy. Reproduction 123:379–387.

J. Exp. Zool. (Mol. Dev. Evol.)

WHITTINGTON ET AL. Thompson MB, Stewart JR. 1997. Embryonic metabolism and growth in lizards of the genus Eumeces. Comp Biochem Physiol A Comp Physiol 118:647–654. Van Dyke JU, Beaupre SJ. 2011. Bioenergetic components of reproductive effort in viviparous snakes: costs of vitellogenesis exceed costs of pregnancy. Comp Biochem Physiol Part A Mol Integr Physiol 160:504–515. Van Dyke JU, Brandley MC, Thompson MB. 2014. The evolution of viviparity: molecular and genomic data from squamate reptiles advance understanding of live birth in amniotes. Reproduction 147: R15–R26. Vempati P, Popel AS, Mac Gabhann F. 2014. Extracellular regulation of VEGF: isoforms, proteolysis, and vascular patterning. Cytokine Growth Factor Rev 25:1–19. Vuorela P, Hatva E, Lymboussaki A, et al. 1997. Expression of vascular endothelial growth factor and placenta growth factor in human placenta. Biol Reprod 56:489–494. Woods HA, Hill RI. 2004. Temperature-dependent oxygen limitation in insect eggs. J Exp Biol 207:2267–2276. Zygmunt M, Herr F, Münstedt K, Lang U, Liang OD. 2003. Angiogenesis and vasculogenesis in pregnancy. Eur J Obstet Gynecol Reprod Biol 110:S10–S18.