MOLECULAR AND CELLULAR BIOLOGY, Oct. 1990, p. 5510- 5520 0270-7306/90/105510-11$02.00/0 Copyright © 1990, American Society for Microbiology

Vol. 10, No. 10

Upstream Activation and Repression Elements Control Transcription of the Yeast COX5b Gene MARTIN R. HODGE, KAVITA SINGH, AND MICHAEL G. CUMSKY* Department of Molecular Biology and Biochemistry, University of California, Irvine, Irvine, California 92717 Received 21 February 1990/Accepted 16 July 1990

The Saccharomyces cerevisiae COXSb gene is regulated at the level of transcription by both the carbon source and oxygen. To define the cis-acting elements that underlie this transcriptional control, deletion analysis of the upstream regulatory region of COXSb was performed. The results of the study suggest that at least four distinct regulatory sites are functional upstream of the COXSb transcriptional starts. One, which was precisely defined to a region of 20 base pairs, contains two TATA-like elements. Two upstream activating sequences (UASlsb and UAS2Sb) and an upstream repression sequence (URSSb) were also found. Each of the latter three elements was able either to activate (UAS1Sb and UAS2Sb) or to repress (URSSb) the transcription of a heterologous yeast gene. Further analysis revealed that UAS1Sb is the site of carbon source control and may be composed of two distinct domains that act synergistically. URSSb mediates the aerobic repression of COXSb and contains two sequences that are highly conserved in other yeast genes negatively regulated by oxygen.

Cytochrome c oxidase is a membrane protein complex that catalyzes the terminal reaction in respiratory electron transport, i.e., reduction of molecular oxygen to water. It has been proposed that the activity of cytochrome c oxidase is an important control point in the overall regulation of cellular energy metabolism (10, 23). Thus, detailed knowledge of cytochrome oxidase biogenesis may ultimately provide important insights into our understanding of this fundamentally critical process. In eucaryotes, cytochrome oxidase is a heterooligomer containing up to 13 different polypeptide subunits that are the products of both the nuclear and mitochondrial genomes (2, 38). The three largest subunits (I to III) are the products of mitochondrial DNA and are transcribed and translated within the organelle (2, 38). The remaining subunits, whose number varies for different organisms, are the products of nuclear genes and are imported into mitochondria after translation in the cytosol (2, 38). Cytochrome c oxidase from the yeast Saccharomyces cerevisiae has been extensively studied. In addition to the three polypeptides derived from mitochondrial DNA, it contains six nucleus-encoded subunits (IV to VII, Vlla, and VIII [37]). While most of these subunits are the products of distinct nuclear genes, one, subunit V, is encoded by a pair of isologous genes, COXSa and COXSb (6, 8). Although the products of the COXS genes (subunits Va and Vb, respectively) are functionally interchangeable, under normal aerobic conditions it is the Va polypeptide that makes up most of the subunit V present in the holoenzyme (6, 43). Since it has been demonstrated that under these conditions COXSa is much more efficiently transcribed than COXSb, it is clear that differential transcription of the two COXS genes is at least partly responsible for the predominance of subunit Va in the holoenzyme (21, 43, 44). Both COXS genes are regulated by carbon source and oxygen (21, 44). While high concentrations of glucose repress the transcription of both COX5a and COX5b (21; K. Singh, unpublished data), oxygen affects the expression of each gene in opposite ways. Under high external oxygen *

Corresponding author.

tension (for example, when cells are grown aerobically), the COX5a gene is efficiently transcribed while transcription of COX5b is repressed (21). When the oxygen tension falls (a shift to microaerophilic or anaerobic conditions), COX5a transcription is shut down while COXSb transcription increases severalfold (21). The effect of oxygen appears to be mediated through a metabolic coeffector, heme (21, 34, 44), whose synthesis is dependent upon molecular oxygen (32). It was initially surprising to find that a gene whose product is involved in respiration (COXSb) was more efficiently expressed when oxygen was limiting. However, we reasoned that microaerophilic biosynthesis of subunit Vb was likely to confer an advantage to cytochrome c oxidase and, ultimately, to yeast cells growing under low oxygen tension. Although this hypothesis has not been substantiated experimentally in S. cerevisiae, there is a precedent for it in other systems. For example, procaryotic cells express different terminal oxidases in response to varying environmental conditions, one of which is low oxygen tension (36). In the slime mold Dictyostelium discoideum, the polypeptide composition of cytochrome c oxidase changes specifically in response to varying oxygen tension (39). Likewise, several mammalian cytochrome oxidases exhibit tissue-specific polypeptides (24, 25). Recently it has become clear that COX5b is part of a larger family of yeast genes that are negatively regulated by oxygen and heme. Additional members of this family include the genes ANBI, a yeast homolog of the gene for eIF-4D (28-31; R. Zitomer, personal communication); HEM13, the structural gene for coproporphyrinogen oxidase, an enzyme involved in heme biosynthesis (46, 47); and HMG2, a gene that encodes 3-hydroxy 3-methylglutaryl coenzyme A reductase (3, 42). CYC7, the structural gene for iso-2-cytochrome c, is also a member of this family in that it shares common regulatory elements with the genes mentioned above (31, 48; C. Lowry, personal communication). However, in contrast to those genes, CYC7 transcription does not appear to be induced anaerobically (27, 48). Like COX5b, the products of the HEM13, HMG2, and CYC7 genes are involved in oxygen-dependent processes (in the case of HEM13, oxygen is also a substrate of the enzyme). Moreover, and again reminiscent of COX5b, the ANB1, HMG2, and CYC7 genes all 5510

VOL. 10, 1990

have aerobically expressed counterparts, i.e., the tr-l (28, 30, 31), HMGJ (3, 42), and CYCI (28-30) genes, respectively. It seems unlikely that these striking similarities are purely coincidental. Rather, they seem to suggest that expression of genes under conditions of reduced oxygen tension is likely to be a common and physiologically important control circuit in S. cerevisiae. To understand how the COX5 genes are controlled at the molecular level and to gain a more thorough understanding of how cells adapt to changes in oxygen tension, we analyzed the cis-acting sequences involved in the regulation of COX5b. We show that transcriptional control of COX5b is mediated by both upstream repression sequences (URS) and upstream activation sequences (UAS). The COXSb URS contains two core elements that are present in the 5'-flanking regions of several other yeast genes, including ANB1, HMG2, HEMB3, and CYC7. COXSb also contains at least two distinct activation sequences that mediate carbon source-specific and, possibly, heme-specific transcriptional control. MATERIALS AND METHODS Strains and growth media. The S. cerevisiae strains used in this study were JM43 (MATa leu2-3 leu2-112 his4-580 ura3-52 trpl-289) (6, 7), a respiration proficient strain; JM43GD5b (MATa leu2-3 leu2-112 his4-580 ura3-52 trpl-289 coxSb::LEU2), a derivative of JM43 in which the chromosomal COXSb gene was disrupted with the yeast LEU2 gene (6, 43); JM43-GD5ab (MATa leu2-3 leu2-112 his4-580 ura3-52 trpl -289 cox5aA:: URA3 coxSb::LEU2), a derivative of JM43 in which the chromosomal copies of COXSa and COXSb were disrupted with the URA3 and LEU2 genes, respectively (6, 43); JM43-GDheml (MATa leu2-3 leu2-112 his4-580 ura3-52 trpl-289 heml: :hisG), a derivative of JM43 in which the chromosomal HEM] gene was disrupted by using plasmid pNKY51 (1); JM43-GDSbheml (MATh leu2-3 leu2-112 his4-580 ura3-52 trpl-289 coxSb::LEU2 hemi:: hisG), which contains disruptions of both COXSb and HEMI; and BWG1-7a (MATa leu2-3 leu2-112 his4-519 ura3-52 adel-100) (17). Yeast strains were grown aerobically at 30°C in YPD, YPGal, YPGE, SD, or SL medium (40; SL is synthetic medium containing 2% lactic acid as the carbon source). Synthetic medium was supplemented with required amino acids as necessary. Growth under anaerobic (oxygen-limiting) conditions has been described previously (21). For JM43-GDheml and JM43-GD5bheml, 8-aminolevulinate (5ALA) was added to the medium at either a high (50 jig/ml) or a low (0.5 jig/ml) level. Respiratory proficiency was tested on YPGE medium (40). Solid medium contained 2% BactoAgar (Difco Laboratories). Plasmids. The parental and wild-type plasmids used in this study were YEp13-511, which contains the wild-type COXSb gene on a multicopy yeast plasmid (7); pTC3, a centromeric derivative of YRp7 (43); pBluescript KS- (Stratagene); and pUC19 (45). Three plasmids containing derivatives of the yeast CYCI gene fused to the Escherichia coli lacZ gene were also used. They were pLGA-312, which contains the CYCI upstream region, including both activation elements (UAS1 and UAS2 [17, 18]); pSX178, a derivative of pLGA312 that lacks both UAS elements (18; L. Guarente, personal communication); and p34-8, a derivative of pSX178 in which a 26-base-pair element containing a binding site for the yeast LEU3 product replaced the UAS1-UAS2 region from CYCI (12). The intact CYCI upstream region in pLGA-312 pro-

EXPRESSION OF THE YEAST COX5b GENE

5511

motes high levels of ,-galactosidase synthesis in S. cerevisiae (17, 18, 26), while the pSX178 derivative drives only very low levels of P-galactosidase synthesis because of deletion of the activation sequences (17, 18, 26). The 26base-pair element in p34-8, which corresponds to a UAS from the yeast LEU2 gene, renders P-galactosidase expression dependent upon the LEU3 product and sensitive to leucine (12). The LGA-312 and SX178 plasmids were gifts of L. Guarente, Massachusetts Institute of Technology, Cambridge. Plasmid 34-8 was a gift of Paul Schimmel, Massachusetts Institute of Technology. Construction of COXSb deletions downstream of the XhoI site. A schematic diagram of the yeast COX5b gene is shown in Fig. 1A. To construct a set of nested deletions extending downstream (3'-ward) from the XhoI site (459 nucleotides upstream of the translational start), a 1.2-kilobase (kb) XhoI-ClaI fragment containing the entire COXSb gene was purified from YEp13-511 and ligated into pBluescript KSthat had been digested with XhoI and ClaI. This yielded plasmid p5b-XCl. Deletions were generated by linearizing p5b-XCl with XhoI, digesting it for different times with BAL 31, adding BamHI linkers, and cutting it with ClaI. The resulting pool of COXSb fragments was then gel purified and ligated into pTC3 that had been cut with BamHI and partially with ClaI, and the ligation was transformed into E. coli DH1. Transformants were initially screened by restriction enzyme analysis. For the derivatives studied further, deletion endpoints were determined by sequence analysis. These plasmids were designated YCp5b-xxx (or simply xxx), where xxx corresponds to the nucleotide endpoint of the deletion (as measured from the A of the initiator ATG, routinely called +1). When a given upstream deletion was to be analyzed for its effect on COX5b expression (Fig. 1B), a 1.1-kb fragment containing the yeast URA3 gene (derived from plasmid pRB8, a gift of Lee Henn, University of California, Irvine) was first inserted into the plasmid at the unique BamHI site. This fragment served as a buffer between vector and COX5b sequences. Internal deletions upstream of COXSb. Internal deletions in the COX5b upstream region were generated by combining appropriate COXSb derivatives lacking sequences downstream of the XhoI site (constructed as described above) with derivatives lacking sequences upstream of the BglII site (Fig. 1A). The latter were constructed in plasmid p5b-BCl. This vector contained a 2.5-kb BamHI-ClaI fragment from COXSb blunt end ligated into the SalI-PstI sites of pBluescript KS-, such that the ClaI site was positioned next to the PstI site. Deletion mutagenesis was performed by linearizing the plasmid with BglII, digesting it for different times with BAL 31, digesting it with SmaI, and reclosing the vector with T4 DNA ligase. The resulting pool of deletions was transformed into DH1 and screened by restriction enzyme analysis. Appropriate derivatives were then sequenced to confirm the deletion endpoints. To generate specific internal deletion mutations, the constructs just described were removed from the vector as BamHI fragments (because there is a BamHI site adjacent to the SmaI site in the vector, the method generates deletions and adds a linker in a single step), gel purified, and cloned in the proper orientation at the unique BamHI site of selected XhoI downstream deletions. These plasmids were designated YCp5bL, followed by a number indicating the individual construct. COXSb fusions to CYCI. Two types of constructs designed to test the effect of COX5b regulatory sequences on a heterologous gene (a CYCJ-lacZ fusion) were made. To test heterologous repression by the COX5b URS, a BamHI-

5512

HODGE ET AL.

AvaII restriction fragment from deletion mutant plasmid YCp5b-(-239) was first cloned into a derivative of pUC19 containing an XhoI linker at the endogenous SmaI site (a gift of Edward K. Wagner, University of California, Irvine). Cloning was accomplished by filling in the AvaIl end and ligating the COXSb fragment into this vector cut with BamHI and XbaI (this end was also filled in). The COXSb fragment was removed from the vector by digestion with XhoI and SalI and cloned into pLGA-312 in both orientations either upstream (at the SmaI site) or downstream (at the XhoI site) of the UAS region. The COXSb URS was cloned in an identical manner and in both orientations into the XhoI site of p34-8 (see Fig. 3B). Fragments containing portions of the COXSb upstream region were also inserted into plasmid pSX178. This was done to assay the abilities of these regions to activate transcription of CYCI. The COXSb fragments were inserted into pSX178 at the endogenous XhoI site (see Fig. 4). RNA preparation and analysis. RNA was prepared by a modification of the method described by Hannig et al. (19). Approximately 40 ml of cells from a logarithmic culture was collected by low-speed centrifugation, washed with extraction buffer (50 mM Tris hydrochloride [pH 7.5], 10 mM EDTA, 0.1 M NaCl), and suspended in 250 ,ll of ice-cold extraction buffer plus 1% sarcosyl. The cells were then disrupted by vortexing with 300 RI of glass beads and 250 pLI of phenol-chloroform-isoamyl alcohol (24:24:1). After 10 min of centrifugation at 16,000 x g, the supernatant was reextracted with phenol-chloroform-isoamyl alcohol, followed by extraction with chloroform-isoamyl alcohol (24:1). The aqueous phase was then adjusted to 0.3 M NaOAc and precipitated with 2 volumes of 100%o ethanol. The RNA was pelleted, reprecipitated, washed with 70% ethanol, suspended in H20, and quantitated by measurement of the A260 RNA fractionation, capillary blotting, and hybridization to the 5b-Pr oligonucleotide probe were performed as described previously (20, 21). j3-Galactosidase assays. ,-Galactosidase assays were performed essentially as described by Guarente (15). For each plasmid, a minimum of two fresh transformants were assayed in triplicate, and values representing an average of at least two experiments (performed on separate days) are reported. The activities reported, which were expressed in Miller units (15), varied by 20% or less. RESULTS Deletion of sequences within the upstream region of COXSb. The results of previous studies have shown that the yeast COXSb gene is regulated by both the carbon source and oxygen (21, 44). As with many yeast genes that encode respiratory proteins, high extracellular levels of glucose repress COXSb transcription severalfold (21; K. Singh, unpublished data). The effect of oxygen on COXSb transcription is, however, the opposite of what is expected (and usually observed) for genes that specify respiratory proteins. That is, in cells grown aerobically, COXSb transcription is repressed. In cells grown anaerobically or under low oxygen tension, transcription derepresses severalfold (21). The effect of oxygen appears to be at least partially mediated through intracellular heme levels (heme biosynthesis is dependent upon molecular oxygen [32]), since COXSb transcript levels are elevated aerobically in strains bearing heme biosynthetic mutations (21, 44). In addition, aerobic-growthlike COX5 expression can be induced in anaerobically growing cells by adding heme to the growth medium (21). Finally,

MOL. CELL. BIOL.

the products of the yeast ROXJ and REOJ genes also play a role in aerobic repression of COX5b transcription (21, 44). To define precisely the nucleotide sequences responsible for controlling COXSb expression, extensive deletion analysis of the upstream region of this gene was performed. Two types of deletion mutations were constructed (Fig. 1B). In the first, we generated a nested set of unidirectional deletions extending from a fixed point (an XhoI site at -459) towards the start of COX5b translation (designated + 1). The second set consisted of a series of internal deletions generated by a modified linker-scanning procedure (12 to 210 base pairs were deleted and a linker was inserted [see Materials and Methods]). The effects of both types of deletion mutations were assayed first by determining the ability of the altered COXSb gene to complement (to respiratory proficiency) a yeast strain bearing chromosomal disruptions of both subunit V genes. It is well-established that multiple copies of the COXSb gene are required to confer a respiratory proficiency phenotype on yeast strains lacking a copy of COXSa (6, 43); in such strains, a single copy of COXSb supports only poor growth on nonfermentable substrates like glycerol-ethanol and lactate (6, 43). Thus, although not a quantitative test, this assay provides a convenient and reproducible estimate of significant changes in the level of respiration and, hence, COX5b expression (6, 7, 13, 14, 21, 43). Wild-type and deleted COXSb genes (contained on centromeric plasmids) were transformed into yeast strain JM43GDSab. This strain contains disruptions of the chromosomal COX5a and COXSb genes and therefore cannot grow on nonfermentable carbon sources (6, 43). Representative transformants, initially obtained as tryptophan prototrophs, were then scored for the ability to grow on glycerol-ethanol medium (YPGE [40]). This analysis revealed that the transformants fell roughly into three phenotypic classes. They grew faster, slower (no visible growth at all), or at the same slow rate as strains transformed with a wild-type copy of COX5b (Fig. 1B). The class of transformants that consistently failed to exhibit detectable growth on YPGE fell into two subgroups, depending upon which COX5b sequences were deleted. One group, consisting of mutants L16, L17, and L18, carried deletions in the region between -142 and -49 base pairs upstream of the translational start site. In each of these mutants, the consensus TATA boxes at positions -109 and -102 had been deleted. Since the mutant containing the smallest deletion (L18) lacked only the nucleotides between -117 and -98, we concluded that at least one of the TATA consensus elements is required for aerobic expression of COXSb. We also noted that the distance between the TATA sequences and the 5' ends of the COXSb transcripts (Fig. 1) is well within the range found for functional TATA elements in S. cerevisiae. The second subgroup of deletion mutants that yielded transformants which failed to grow visibly on YPGE carried deletions in the region from -239 to -125. This group consisted of the mutants YCp5b(-125), L7c, L7d, L10, and L14 (Fig. 1B). Since each mutant contained the TATA elements, the phenotype observed suggested the presence of at least one activation sequence within the region. Furthermore, deletion mutant L14 more accurately positioned the element in the region between nucleotides -176 and -125 (Fig. 1B). It should be noted that the data from two other mutants containing deletions in this region could not be used to define this element further, since both the L13 and L15 mutants (Fig. 1B) yielded transformants that grew slowly but

EXPRESSION OF THE YEAST COX5b GENE

VOL. 10, 1990

5513

A -1700

K1 1

rr

BamHI

rAr%±r

-60-35

'J.-Ant

A

Xhol

437

+9 +174

*1

-459

V

+7 67

TM

I TG BgIII

C4l

B -17#0

-7p

1

10

1

B

X

-3 H

0

-1a +

Growth on YPGE

S

+1+1+1-

YCp5b(w.L)

YCp5b(-45) YCp5b(-239) YCp5b(-19)

YCpb(-125)

L6 (-236 to -239)

+1+1+1+1+1-

L7 (-296 to -195)

+

1I (-6 to -46) L2 (-5 to -377) U (405 to -2U4)

L5 (4296 to -2")

U7 (-239 to -195)

++

L7b (.239 to -165)

+1-

L7c (42 to -145)

-

L7d (-239 to -125)

L8 (-212 to-195)

+1-

L10 (4M12 to -125)

LIl (-176 to-1 ")

+1-

112 (-176 to -145)

+1+1-

113 (-176 to -127) L14 (-176 to -125)

115 (-14" to -125)

L16 (-142 to -6) 117 (-142 to 40) 118 (-117 to -98)

FIG. 1. Deletions in the upstream region of COX5b. (A) Schematic diagram of the yeast COX5b gene showing the locations of restriction endonuclease cleavage sites used in the construction of various deletion mutations. The wavy arrow indicates mRNA start sites. (B) Schematic diagram of the COX5b upstream deletions used in this study. Deletions were constructed as described in Materials and Methods; deleted sequences (endpoints are indicated in parentheses; see Materials and Methods) are represented by the open areas on the diagram. For analysis in S. cerevisiae, COX5b genes bearing upstream deletions were cloned into a yeast centromeric plasmid and transformed into respiration-deficient strain JM43-GD5ab (Materials and Methods). Fresh JM43-GD5ab transformants were scored for growth on YPGE plates (which contain the nonfermentable carbon sources glycerol and ethanol) after 4 days of incubation at 30°C. The phenotype is expressed relative to the same strain transformed with wild-type (w.t.) plasmid YCp5b (defined as +/- growth). Abbreviations: B, BamHI; X, XhoI; H, HpaI; S, ScaI; + +, much faster growth than YCp5b transformants; +, faster growth than YCp5b transformants; -, slower growth than YCp5b transformants.

irregularly on YPGE. The lack of reproducibility, therefore, made interpretation of the data difficult. When JM43-GD5ab was transformed with deletion mutants YCp5b(-195), L7, and L7a, the resulting transformants consistently grew faster than the wild type on YPGE.

Mutant L7a, which lacked sequences from -239 to -195, had the most dramatic phenotype. The data suggest the presence of a repression element (operator) in this region. The existence of this element, presumably involved in aerobic repression of COXSb transcription, is consistent with

5514

HODGE ET AL.

MOL. CELL. BIOL.

ND N2 2 N 2 v > 3 0N2 ; FIG. 2. Upstream deletions alter COX5b transcription. Yeast strain JM43-GD5b transformed with the indicated deletion mutations (see the legend to Fig. 1) was grown at 30°C in SD (selective) medium, diluted into YPGal medium, and grown again at the same temperature. When the culture reached the early log phase (approximately 60 Klett units, measured with a green filter), half of the culture was removed and grown anaerobically as previously described (21). Both cultures were then grown for an additional 1.5 h and harvested, and RNAs were prepared (21). The RNAs (30 ,ug) prepared from these cultures were analyzed by blotting and hybridization (Northern blotting) against an oligonucleotide probe specific for the COX5b coding sequence (Sb-Pr [19, 21]). The lane designations (bottom) indicate that the RNA samples were prepared from aerobically (02) or anaerobically (N2) grown cultures. Wild type (w.t.) refers to the same strain transformed with an unmodified COX5b gene (Fig. 1B) on the same vector. The position of the two COXSb transcripts is indicated at the left (Vb). To control for errors in loading, the blot was stripped and rehybridized against a probe specific for the yeast actin gene. This analysis indicated that equivalent amounts of RNA were loaded in each of the lanes (data not shown).

that observed in strains carrying a wild-type copy of the COXSb gene. Together, the results presented in Fig. 1B and 2 support the presence of several cis-acting regulatory elements in the COX5b upstream region. The first, between -117 and -98, contains two TATA-like sequences; our data suggest that at least one of these sequences is required for efficient COXSb transcription. The second, which we designated UASlSb, contains an activation sequence and is located in the region between -176 and -125. The third, URS5b, is located between -239 and -195 and contains a URS responsible for aerobic repression of COXSb transcription. Finally, the data suggest that a second activation element, UAS25b, exists in the region between -296 and -239. Repression of a heterologous gene by URSSb. The putative regulatory elements were tested for the ability to function independently in a context other than that of COX5b. To determine whether URS5b could repress the transcription of a heterologous gene, we used vector pLGA-312 (17, 18). This plasmid carries sequences necessary for its selection and replication in both S. cerevisiae and E. coli, as well as a yeast CYCJ gene (the structural gene for iso-1-cytochrome c) in which the upstream region and translational start codon were fused in frame to lacZ. Since the CYCI portion contains both upstream activation (UAS1 and UAS2) and TATA sequences, expression of P-galactosidase in S. cerevisiae is driven from a properly regulated CYCI promoter

previous findings on COXSb expression (21, 43). Two other observations from the data in Fig. 1B are noteworthy. (i) The data from the L8 mutant place at least part of the repression element in the region between -239 and -212. (ii) The phenotype of L7 transformants was different from that of L7a. That is, deletion of additional sequences between -239 and -296 diminished the effect of the L7a deletion. Thus, the data raise the possibility that an additional activation element is present between -239 and -296. Upstream deletions alter COX5b transcription. The steadystate levels of COX5b mRNA in several representative deletion mutants were also studied. This analysis was done (i) as a more definitive and direct test of the effect of the upstream deletions on COXSb transcription and (ii) to study the effect of the deletions on cells grown under conditions of limiting oxygen (which was not possible with the functional test). Total RNA was prepared from representative transformants grown either with or without oxygen (21). Equivalent amounts of all of the preparations (confirmed by subsequent hybridization of the same blot against a yeast actin probe) were then fractionated and analyzed by blotting and hybridization against a COXSb probe (Northern [RNA] blotting). The data confirmed and extended those obtained by complementation analysis (Fig. 2). When compared with the wild type, the steady-state level of the COX5b transcripts were reduced both aerobically and anaerobically for deletion mutants that yielded transformants which failed to grow on YPGE. This was true for L18, the TATA element deletion mutant, and for L7c, L7d, L10, and L14. As predicted for the L7a mutant, which yielded transformants that grew faster than the wild type on YPGE, we found that the transcript levels were dramatically elevated aerobically. Also as predicted on the basis of the complementation analysis, the transcripts were not elevated aerobically in L6 transformants. In fact, the steady-state level of COX5b transcripts in L6 transformants was somewhat lower than

A restriction fragment containing URS5b (nucleotides -239 through -180) was inserted into pLGA-312 in both orientations at either an XhoI site or an SmaI site (Fig. 3A). Selective use of these two restriction sites permitted positioning of URS5b downstream (XhoI) or upstream (SmaI) of the UAS region of CYCI (Fig. 3A). The parental plasmid (pLGA-312) and each of the four constructs were then transformed into respiration-proficient yeast strain JM43, and uracil prototrophs were assayed for ,3-galactosidase activity. URS5b repressed aerobic expression of CYCI in a manner independent of its orientation six- to sevenfold, but only when located 3' (downstream) of the UAS region (Fig. 3A). The observed repression was not simply the result of a 60-base-pair insertion within the 5'-flanking region of CYCJ nor the result of a change in the position of the CYCI UAS region relative to the TATA elements, since two independent groups previously demonstrated that insertions of this size at the XhoI site did not significantly affect expression of the same gene (16, 41). It is well established that CYCJ is regulated positively by oxygen (via heme) and is not expressed if yeast cells are grown anaerobically (17, 18, 30, 31, 48). For this reason, the pLGA-312 constructs described above (Fig. 3A) could not be used to determine the effect of URS5b on anaerobic expression of CYCJ. Instead, we took advantage of plasmid p34-8 (12), a derivative of pLGA-312, in which the UAS1-UAS2 region of CYCI (which mediates both oxygen-heme and glucose control of CYCJ [17, 18, 26]) was removed and replaced with a UAS from the yeast LEU2 gene (12). Thus, in this construct, expression of P-galactosidase is dependent upon the LEU3 gene product, which binds to UASLeu2, and is sensitive to intracellular leucine levels (12). We generated derivatives of p34-8 which positioned URS5b downstream of UASLeU2 in both orientations (Fig. 3B). Each construct was then transformed into yeast strain JM43-GDSbheml, a derivative of JM43 containing chromosomal disruptions of COXSb and HEM] (the latter is the structural gene for &-ALA synthase, the first enzyme in the

L7a _5:) r~~ ~ ~~~~l

mm a 2

N

L7c

L7d LOIL(Di 14 § r- - --I - r-----I

.1

.

so ,

(17, 18).

VOL. 10, 1990

A sm

| U

I r

.

U

1 x. ....::..:.

*lU] TAT -1*....

I

M

UT^1['~ . TATA

~~~~~~T T. W ,

1

b::--- --::...------ -: :--

...

:

TATA1 l

EXPRESSION OF THE YEAST COXSb GENE

Plasmid pLGA-312 pLGA&-31 2/X5URS pLGA-31 2/XURS5 pLGA-31 2IS5URS

1 -gactosidaISe tadivity 1730 239 286 1740 1740

pLGA-312/SURS5

5515

Fold repression

7.2 6.0 1.0 1.0

B High ALA

-gaiactosidase Plasmid I

U.

| TAT1 :jl . TAT ATA I "''.

|UA

I

_o

1

ATT1

activity

344

34-&X5URS 34-&XURS5

203 42.4 30.0

Fold repression

4.9 6.8

Low ALA B -galactosidase Fold ft repression 135 22.1 15.6

6.1 8.7

FIG. 3. URS5b represses transcription of the yeast CYCI gene when cloned downstream of the UAS region. (A) A 60-base-pair COXSb fragment (-239--*-180) containing the region defined as URS5b was inserted at either the XhoI or SmaI site of pLGA-312 (see Materials and Methods and Results) in both orientations, as shown. The resulting plasmids, as well as pLGA-312, were then transformed into respiration-proficient strain JM43 and analyzed for 3-galactosidase activity after growth (to the mid-log phase) in SL medium. ,B-Galactosidase assays were performed as previously described (15; Materials and Methods). (B) The COX5b (-239--180) fragment was cloned in both orientations at the XhoI site of plasmid 34-8, a derivative of pLGA-312 in which the UAS1-UAS2 region of CYCI was replaced with a 26-base-pair UAS from the yeast LEU2 gene (12). The presence of UASLeU2 renders the control of CYCI expression dependent upon the LEU3 gene product and sensitive to leucine (12). The indicated plasmids were transformed into yeast strain JM43-GDSbheml, grown aerobically to the mid-log phase in SD medium (without exogenously added leucine [12]; JM43-GD5bheml is prototrophic for leucine via LEU2 disruption of COX5b) containing either a high (50 jg/ml) or a low (0.5 p,g/ml) concentration of b-ALA, and assayed for f3-galactosidase activity. Growth of JM43-GD5bheml and its transformants in this manner reproduced the high- or low-heme conditions typical of aerobic (high-B-ALA) or anaerobic (low-8-ALA) growth (see Fig. 4; when the constructs shown here were transformed into JM43 and assayed under aerobic and anaerobic conditions, we obtained results essentially the same as those shown).

heme biosynthetic pathway [26]). It has been shown that in a hem] genetic background, yeast cells grown in low concentrations of b-ALA are viable but, presumably because of low intracellular levels of heme, do not express hemeactivated genes like CYCI (26). When grown in high concentrations of b-ALA, however, the cells are essentially wild type (26). Since the effect of oxygen on COX5b expression is mediated through intracellular heme levels, propagation of JM43-GDSbheml (and its transformants) in low concentrations of b-ALA produces the low-heme state typical of anaerobic growth conditions. In contrast, propagation of these transformants in high concentrations of b-ALA generates a high-heme (aerobic-growth-like) state (results of control experiments demonstrating the efficacy of this system for studies of COXSb expression are presented in Fig. 4). Each JM43-GDSbheml transformant was grown in either a high or a low concentration of b-ALA, and the amount of P-galactosidase activity was determined (Fig. 3B). As expected, under high-heme conditions, URS5b repressed LEU2-driven expression of CYCJ at a level roughly equal to those observed previously. Also as expected, URS5b was functional in either orientation. Surprisingly, however, when the transformants were grown in a low heme concentration, the degree of repression was not significantly different.

Thus, the presence of URS5b alone was not sufficient to cause the anaerobic (low-heme) derepression commonly observed with the intact COXSb gene (see Discussion). Activation of a heterologous gene by upstream fragments of COXSb. Fragments derived from the upstream region of COX5b were also tested for the ability to activate transcription of the CYCI-lacZ fusion. We used plasmid pSX178, which is identical to pLGA-312 except for deletion of the DNA between the SmaI and XhoI sites. Because the region deleted in pSX178 contains both UAS1 and UAS2 of CYCI (Fig. 3), the hybrid gene is no longer sensitive to oxygenheme and glucose control and expresses only background levels of P-galactosidase when introduced into yeast cells (17, 18, 26). The constructions shown in Fig. 4 were transformed into JM43-GDheml (see Materials and Methods) and assayed for 3-galactosidase expression after growth under several different conditions. Insertion of fragments containing all (-1700--117) or most (-459-->-117) of the COX5b upstream region into pSX178 put P-galactosidase expression under the control of the COX5b promoter. Moreover, growth in a low level of b-ALA (low-heme conditions) precisely reproduced the effect of anaerobiosis on COXSb expression; ,-galactosidase levels were 2.6-fold higher when

5516

HODGE ET AL.

MOL. CELL. BIOL.

I

COX5b fragment

B

-I

V

.17F-

I

X

I

H

-2

-10I SAD SA

-1700 -> -117

P -galactosidase activity JM43-GDheml JM43 High ALA LowALA 02 -02 275

707

269

642

216

541

-117

179

464

-305 -*-117

167

431

-200

-117

288

275

-1 17

-459

-180 -165

-*

-200

307

287

-117

22.6

36.2

-142

51.3

42.4

-459

-*

-200

1.5

0.9

-459

-*

-239

4.4

1.6

-305

0.8

0.6

-239

4.0

1.4

0.6

0.6

-459 -305

->

pSX178

1170

pLGA-312

5.7

FIG. 4. COXSb upstream sequences can activate transcription of a heterologous gene. The indicated fragments, derived from the upstream region of COXSb, were cloned into the XhoI site of plasmid pSX178 (see Materials and Methods; Fig. 3). The resulting plasmids were then transformed into yeast strain JM43-GDheml, grown aerobically (to the mid-log phase) in SD medium containing either a high (50 ,ug/ml) or a low (0.5 ,ug/ml) concentration of b-ALA, and assayed for p-galactosidase activity (expressed in Miller units [15]). To make sure that growth of JM43-GDheml transformants in a low concentration of b-ALA reproduced the low-heme state typical of anaerobic growth, the two plasmids containing the largest portions of the COXSb gene (-1700--)-117 and -459--117) were also transformed into respiration-proficient strain JM43 and assayed for j3-galactosidase activity after aerobic (+02) or anaerobic (-02) growth in SD medium containing 0.2% Tween 80 and 20 ,ug of ergosterol per ml (21). Abbreviations: B, BamHI; X, XhoI; H, HpaI; S, ScaI; A, AvaII; D, DdeI.

either anaerobically or in a low concentration of b-ALA. In agreement with the results presented earlier, the data (Fig. 4) also demonstrated that the region between -305 and -117 contains most or all of the key sequences required for proper oxygen-heme regulation and expression of COXSb (we do not know whether the slightly higher levels of ,-galactosidase activity observed for the wild type [-1700--*-117] construct are significant). However, deletion of the sequences between -305 and -200 had a dual effect. We observed an increase (approximately twofold) in COXSb expression at a high heme concentration and a decrease in expression at a low heme concentration, such that the P-galactosidase levels were independent of the exogenous b-ALA concentration. We suggest that these results further confirm the function of both URS5b and UAS25b; we believe that the twofold increase in expression observed at a high heme concentration resulted from deletion of URS5b, while the decrease in overall expression (about 1.5-fold) which was reflected in the low-heme value was attributable to loss of UAS25b. Additional evidence supporting the function of UAS25b was reflected in the activity of the -459--239 and -305--).-239 constructs. These fragments promoted low but reproducible levels of P-galactosidase activity and therefore place UAS25b between -305 and -239. Somewhat surprisingly, the data suggest that UAS25b responds positively to heme. The stronger of the two COXSb transcriptional activators was UAS15b (Fig. 4). The data also suggest that UAS15b does not mediate oxygen-heme control, and they define the limits of the element to the region between -180 and -117 base pairs 5' of the translational start. Furthermore, deletion of the 15 base pairs between -180 and -165 or the 25 base pairs between -142 and -117 (in the -165---117 and

cells were grown

-200--3-142 constructs, respectively) caused a dramatic reduction in expression. Thus, it is possible that UASl5b, as we have defined it, is actually composed of two subelements (or, possibly, distinct UAS) that act synergistically to promote maximal levels of COXSb transcription. Alternatively, the critical region of UASl5b may be large, including the region between -165 and -142 and beyond. Although the data do not permit us to distinguish between these two interpretations, we favor the former (see Discussion). UAS1Sb mediates carbon source control of COX5b. While the data in Fig. 4 suggested that UAS15b was not involved in oxygen-heme-specific control of COXSb expression, involvement of this element in glucose repression was still a possibility. Several of the constructs shown in Fig. 4 were therefore transformed into respiration-proficient yeast strain JM43 and assayed for P-galactosidase activity during growth in a repressing (10% glucose) or nonrepressing (2% galactose) carbon source. Transcriptional activity promoted from the -459--117 construct, which contained all of the functional upstream region from COXSb, as well as from the TABLE 1.

UASl5b mediates glucose repression of COX5b'

Fold increase a-Galactosidase activity C COXSb fragmentordces

-459-*-117 -180--+-117 -305--239

pSX178

Glucose

Galactose

or decrease

101 75 7.8 1.1

216 313 4.7 0.8

2.1 4.2 0.6 1.4

a Respiration-proficient yeast strain JM43, transformed with the indicated plasmids (see the legend to Fig. 4), was grown in synthetic medium containing either 10%o glucose (repressing) or 2% galactose (nonrepressing) as the carbon source. 1-Galactosidase assays were performed when the cultures reached the mid-log phase and are expressed in Miller units (15).

EXPRESSION OF THE YEAST COXSb GENE

VOL. 10, 1990

low-heme

obtained by using high-copy-number plasmids; they contain an origin of replication derived from the endogenous yeast 2,um circle. Such plasmids can, under certain conditions, be maintained at variable copy numbers in yeast cells. While our ,B-galactosidase assays were performed in a manner that generally eliminated copy number effects (the results reported were averages of at least two experiments in

high-herme

were

U

1 21 4 6 7 8 9 Ratio: 28 25 3437 30 23 28 35 4; 2 %

5517

RA 3

which

10

2

26

FIG. 5. COX5b sequences do not alter pilasmid copy number. JM43-GDheml transformed with pSX178 (lanies 1 and 6) or pSX178 containing COXSb sequences (Fig. 4) from -1L80--117 (lanes 2 and 7), -305-- -239 (lanes 3 and 8), -459- -11 7 (lanes 4 and 9), and -1700-*-117 (lanes 5 and 10) was grown in either a low or a high concentration of b-ALA, as indicated. Total IDNA from each transformant was prepared, cut to completion witlhiBamHi and Hindll, and then blotted onto a nylon membrane. enzymes yielded a 1.1-kb HindIll fragment c ontaining the genomic URA3 gene and a HindIII-BamHI fragment oif variable size containing URA3 and the upstream region of the hybrid CYCI gene (including the COXSb sequences) derived from the plasmid (17, 18). The hybridization probe was the 1.1-kb URA3 fragment labeled by the random-primer method. After autoradiography, portions of the blot corresponding to genomic or plasmid-borne URA3 sequences were excised and counted in a scintillation counter. Ratio refers to the number of counts in the plasmid over those in the genomic URA3 fragment.

-180--*-117 construct, containing only UAS15b, was repressible by glucose (approximately two- and fourfold, respectively [Table 1]; this value is in agreement with the amount of repression previously observed for the COXSb transcripts [21]). On the other hand, transcription from the -305----239 construct, which contained only UAS25b, was not repressed by glucose. Thus, we conclude that UAS15b

is

the site through which glucose repression is normally conferred. COXSb sequences do not alter plasmid copy number. The results of the experiments presented in Fig. 4 and Table 1

triplicate assays

were

performed

on

several

different

transformants [see Materials and Methods]), we could not a priori rule out the possibility that the COXSb sequences themselves influenced the copy number of certain plasmids. This possibility was tested directly in the experiment shown in Fig. 5. Total DNA was prepared from JM43-GDheml transformants harboring either the vector (pSX178) or key COX5b constructs after growth in high or low levels of b-ALA. Following digestion with BamHI and HindlIl, the DNA was subjected to Southern blot analysis with a probe specific for URA3 (URA3 is present both on the plasmid and within the yeast genome). The ratio of the counts that hybridized to the plasmid-borne copy of URA3 versus those that hybridized to the genomic copy of URA3 did not vary

significantly between individual COX5b constructs or bethe vector and the COXSb constructs (Fig. 5). Thus,

tween

we concluded that the COX5b sequences do not affect the plasmid copy number.

DISCUSSION

In this study, we report the identification of several cis-acting regulatory elements involved in transcriptional control of the yeast COX5b gene. These elements mediate oxygen-heme-specific and carbon source-specific regulation of COX5b and consist of a 20-base-pair domain containing two TATA-like elements; two activation elements, UAS15b and UAS25b; and a repression element, URS5b (the DNA sequence of COX5b and the relative positions of these upstream elements are schematically summarized in Fig. 6). When taken together, the data presented here suggest that COX5b is regulated in a complex manner that involves transcriptional repression and activation. It seems likely that transcription of COX5b is also subject to a modulation or fine-tuning type of regulation as well. UAS1Sb. UAS15b was initially localized to the region between -180 and -117. Subsequent studies demonstrated that the sequences located between -180 and -165, as well as those between -142 and -117, were required for maximal URS5b

UAS25b

TGTTACCATAATTCCATATAATCGTACTGTTTTGTCATTATTA??aCA=CASm----TTTTTGATTTTGTAT=-T.CGATA&AGTAC4GAAAA

ACAATFGTATTAAGGTATATTAGCATGACAAAACAGTAAT AAT

~ _CAACtT T.

TAAACAXAAM5G TTGgC4=TG=AGT

TTTT

_ I --_L __ _1 _-280

-310

-250

-220

UAS15b , TATA Elements AATGTCATGk.ACCCCTTAAAATTACTGAGGGGTTCAGAAAATACCGTGCAAAAGACGAAAAAAGACGAATTTC.kTTTGAT TTATATTTTATAAATGAACTGTTGCATTAAACAATAGACC TTACAGTACiCTGGGGAATTTTAATGACTCCCCAAGTCTTT TATGGCACGTTTTCTGCTTTTTTCTGC TTAAAGtlrAAACTAAATATAAAATATTTACTTGACAACGTAATTTGTTATCTGG

I

-190

~~~2TT _.I -160

-130

-100

FIG. 6. Nucleotide sequence of the upstream region of COX5b. Numbers below the nucleotide sequence indicate distance from the A (+ 1) of the translational initiation codon. Dashed boxes indicate the limits of UAS25b, URS5b, and UAS15b as defined by deletion analysis. Potential GF1- and HAP2,3-binding sites are depicted by shaded boxes within UAS25b. Underlined nucleotides signify deviations from the published consensus element. Shaded boxes within URS5b indicate identity or similarity to sequences upstream of ANB1 and several other yeast genes negatively regulated by oxygen (see the text). The two repeated elements within UAS15b are indicated by the arrows. The direct repeat is centered at -131, and the inverted repeat (with consensus sequence TGRACCCCTYARNA) is centered at -169. The positions of the putative TATA elements are also indicated.

5518

HODGE ET AL.

transcriptional activation. These data suggest that the functional core of UAS15b is quite large, extending beyond the region between -165 and -142. Alternatively, the element may contain two distinct domains (activation sites) that act synergistically. Although our current data do not allow us to distinguish conclusively between these models, the DNA sequence within UAS15b is informative. Although UAS15b shares no obvious sequence homology with known consensus activation elements in S. cerevisiae, there are repeated sequences at both of its ends (Fig. 6). Between -184 and -154, the 14-base-pair sequence TGRACCCCTYARNA is inversely repeated, while the 10-base-pair sequence AAAAGACGAA is directly repeated between -142 and -120. We noted that part of the 14-base-pair inverted repeat was deleted in the -165--+-117 construct and all of the 10-base-pair direct repeat was deleted in the -200--*-142 construct (Fig. 4). Thus, we speculate that these repeated elements are each important for UASl5b function and that they represent distinct domains that contribute jointly to transcriptional activation of COXSb. UAS2Sb. UAS25b, localized to the region between -305 and -239, is the weaker of the two positive regulatory elements defined here. It appeared to respond positively to the presence of heme but did not seem to be involved in glucose repression of COX5b transcription. While UAS25b alone was able to drive only low levels of ,-galactosidase expression in S. cerevisiae, these levels were nevertheless sevenfold over the background. Moreover, deletion of UAS25b caused a 1.5-fold reduction in overall COX5b expression (Fig. 4), thereby confirming its role in transcriptional regulation of COXSb. Examination of the DNA sequence within UAS25b revealed two observations of note. UAS25b contains a sequence that is homologous (seven of eight base pairs) with the HAP2-HAP3 consensus element TNRTTGGT (Fig. 6) (11, 26, 35). This sequence has been proposed to be the yeast analog of mammalian CCAAT boxes (35). UAS25b also contains a sequence (Fig. 6) that is homologous to the consensus GF1 element RTCRNNNNNNACGNR (9). Although the function of the GF1 factor is not known, the element has been identified upstream of many yeast genes, including several that encode mitochondrial proteins. We are currently performing experiments that will determine whether either of these two sequences plays a direct role in activation from UAS25b. URSSb. URS5b was localized to a region of 44 base pairs (-239 to -195) by deletion mutagenesis. The function of the element was then confirmed on the basis of its ability to repress the expression of a heterologous yeast gene aerobically. Repression of the heterologous gene, a CYCI-lacZ fusion, occurred when URS5b was inserted in either orientation, but only when it was positioned 3' (downstream) of the CYCJ UAS region. This result is significant, because URS5b normally functions 5' (upstream) of UAS15b, the stronger of the two COX5b activation elements. Furthermore, in the p34-8 constructs (Fig. 3B) URS5b repressed aerobic expression of the hybrid gene but was not sufficient to mediate the anaerobic derepression observed in COXSb. Thus, URS5b represses transcription of COX5b and the CYCI gene fusion in mechanistically different ways. While more detailed studies of URS5b function (including those of DNA-protein interactions) are in progress, it is not unrealistic to speculate that when inserted downstream of the CYCI activation sequences, a regulatory protein(s) bound at URS5b physically (sterically) interferes with tran-

MOL. CELL. BIOL.

scriptional activation driven from the CYCI UAS. This situation is analogous to transcriptional repression of GAL] by the E. coli lexA operator when it is inserted between UASGal and the TATA region (4, 5). In the normal COX5b context, our working model of URS5b-mediated repression is more reminiscent of (although possibly not analogous to) transcriptional silencing by the yeast a2 protein, which can repress transcription when bound at operator sequences (URS) positioned both 3' and 5' of a UAS (22). In COX5b, transcriptional control, both positive and negative, may be exerted through interactions between regulatory proteins bound at URS5b and the COXSb activation elements. The presence or absence of the coeffector heme might then be expected to alter either the formation of a primary DNAprotein complex or, alternatively, the ability of an ancillary protein(s) to interact with and thereby modulate the activity of a specific regulatory complex. The results of the experiment shown in Fig. 3B support, but do not prove, this working model. Comparison of the DNA sequence within the upstream region of COX5b with those of several other yeast genes negatively regulated by oxygen and/or heme revealed some striking similarities. As originally pointed out to us by Richard Zitomer (personal communication), COX5b and ANB1 share two sequences of exact homology in their 5'-flanking regions 8 and 13 base pairs long (the shaded boxes in Fig. 6; the 13-base-pair domain is in opposite orientations in the two genes). Furthermore, highly homologous versions of both sequences have been found in CYC7, HEM13, HEM], and HMG2. Homology to one but not both of the elements has been found within a negative regulatory site in the yeast ribonucleotide reductase gene (RNR2; homology to the 13-base-pair sequence) and upstream of the gene that encodes subunit II of QH2:cytochrome c oxidoreductase (homology to the 8-base-pair sequence). Direct demonstration that these sequences are involved in transcriptional repression has been accomplished for only COX5b (M. R. Hodge and M. G. Cumsky, unpublished data) and ANBI (33; C. Lowry and R. Zitomer, personal communication). However, the consistent occurrence of these sequences within the regulatory regions of yeast genes and their repeated presence in genes regulated by oxygen and heme suggest that they are part of a widespread and important regulatory circuit in S. cerevisiae. We are performing a more detailed mutagenic analysis of all the COX5b regulatory elements described here, as well as analyzing the proteins that bind at these sites. In addition, several trans-acting mutants that alter oxygen-heme control of COXSb expression have been isolated (J. R. Lambert and M. G. Cumsky, unpublished data) and are being used in conjunction with the DNA-binding studies just described. We are hopeful that this combined experimental approach will not only facilitate our understanding of COX5b regulation but also increase our knowledge of the much larger yeast regulatory circuit of which COXSb is a part. ACKNOWLEDGMENTS We are grateful to Richard Zitomer and Charles Lowry for communicating unpublished results and the sequence similarities between ANB1 and COXSb to us. We thank Leonard Guarente, Richard Zitomer, Edward Wagner, Lee Henn, Paul Schimmel, and Nancy Kleckner for plasmids and Veronica Gallegos and Hassan Movahedi for technical assistance. We also thank the other members of our laboratory, in particular, Jim Lambert and Brian Miller, for useful discussions and comments on the manuscript. This work was supported by Public Health Service grant

VOL. 10, 1990

GM36675 from the National Institutes of Health and grant BC649 from the American Cancer Society. M.R.H. and K.S. are predoctoral trainees on Public Health Service grant GM07134 from the National Institutes of Health. LITERATURE CITED 1. Alani, E., L. Cao, and N. Kleckner. 1987. A method for gene

disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains. Genetics 116: 541-545. 2. Attardi, G., and G. Schatz. 1988. Biogenesis of mitochondria.

Annu. Rev. Cell Biol. 4:289-333. 3. Basson, M. E., M. Thorsness, and J. Rine. 1986. Saccharomyces

4. 5. 6.

7.

8.

cerevisiae contains two functional genes encoding 3-hydroxy-3methylglutaryl coenzyme A reductase. Proc. Natl. Acad. Sci. USA 83:5563-5567. Brent, R. 1985. Repression of transcription in yeast. Cell 42:3-4. Brent, R., and M. Ptashne. 1984. A bacterial repressor protein or a yeast transcriptional terminator can block upstream activation of a yeast gene. Nature (London) 312:612-615. Cumsky, M. G., C. Ko, C. E. Trueblood, and R. 0. Poyton. 1985. Two nonidentical forms of subunit V are functional in yeast cytochrome c oxidase. Proc. Natl. Acad. Sci. USA 82:2235-2239. Cumsky, M. G., J. E. McEwen, C. Ko, and R. 0. Poyton. 1983. Nuclear genes for mitochondrial proteins. Identification and isolation of a structural gene for subunit V of yeast cytochrome c oxidase. J. Biol. Chem. 258:13418-13421. Cumsky, M. G., C. E. Trueblood, C. Ko, and R. 0. Poyton. 1986. Structural analysis of two genes encoding divergent forms of yeast cytochrome c oxidase subunit V. Mol. Cell. Biol.

7:3511-3519. 9. Dorsman, J. C., W. C. van Heeswijk, and L. A. Grivell. 1988. Identification of two factors which bind to the upstream sequences of a number of nuclear genes coding for mitochondrial proteins and to genetic elements important for cell division in

yeast. Nucleic Acids Res. 16:7287-7301. 10. Erecinska, M., and D. F. Wilson. 1982. Regulation of cellular

energy metabolism. J. Membr. Biol. 70:1-14. 11. Forsburg, S. L., and L. Guarente. 1988. Mutational analysis of upstream activation sequence 2 of the CYCI gene of Saccharomyces cerevisiae: a HAP2-HAP3-responsive site. Mol. Cell.

Biol. 8:647-654. 12. Friden, P., and P. Schimmel. 1988. LEU3 of Saccharomyces cerevisiae activates multiple genes for branched-chain amino

acid biosynthesis by binding to a common decanucleotide core sequence. Mol. Cell. Biol. 8:2690-2697. 13. Glaser, S. M., B. R. Miller, and M. G. Cumsky. 1990. Removal of a hydrophobic domain within the mature portion of a mitochondrial inner membrane protein causes mislocalization to the matrix. Mol. Cell. Biol. 10:1873-1881. 14. Glaser, S. M., C. E. Trueblood, L. Dircks, R. 0. Poyton, and M. G. Cumsky. 1988. Functional analysis of mitochondrial protein import in yeast. J. Cell. Biochem. 36:275-287. 15. Guarente, L. 1983. Yeast promoters and lacZ fusions designed to study expression of cloned genes in yeast. Methods Enzymol. 101:181-191.

16. Guarente, L., and E. Hoar. 1984. Upstream activation sites of the CYCI gene of Saccharomyces cerevisiae are active when inverted but not when placed downstream of the "TATA box." Proc. Natl. Acad. Sci. USA 81:7860-7864. 17. Guarente, L., B. Lalonde, P. Gifford, and E. Alani. 1984. Distinctly regulated tandem upstream activation sites mediate catabolite repression of the CYCI gene of S. cerevisiae. Cell 36:503-511. 18. Guarente, L., and T. Mason. 1983. Heme regulates the transcription of the CYCI gene of S. cerevisiae via an upstream activation site. Cell 32:1279-1286. 19. Hannig, E. M., D. J. Thiele, and M. J. Leibowitz. 1984. Saccharomyces cerevisiae killer virus transcripts contain template-coded polyadenylate tracts. Mol. Cell. Biol. 4:101-109. 20. Hodge, M. R., and M. G. Cumsky. 1989. Splicing of a yeast intron containing an unusual 5' splice junction sequence. Mol.

EXPRESSION OF THE YEAST COX5b GENE

5519

Cell. Biol. 9:2765-2770. 21. Hodge, M. R., G. Kim, K. Singh, and M. G. Cumsky. 1989. Inverse regulation of the yeast COXS genes by oxygen and heme. Mol. Cell. Biol. 9:1958-1964. 22. Johnson, A. D., and I. Herskowitz. 1985. A repressor (MATa2 product) and its operator control expression of a set of cell type specific genes in yeast. Cell 42:237-247. 23. Kadenbach, B. 1986. Regulation of respiration and ATP synthesis in higher organisms: hypothesis. J. Bioenerg. Biomembr. 18:39-54. 24. Kadenbach, B., A. Stroh, M. Ungibauer, L. Kuhn-Nentwig, U. Buge, and J. Jarausch. 1986. Isozymes of cytochrome c oxidase: characterization and isolation from different tissues. Methods Enzymol. 126:32-45. 25. Kadenbach, B., M. Ungibauer, J. Jarausch, U. Buge, and L. Kuhn-Nentwig. 1983. The complexity of respiratory complexes. Trends Biochem. Sci. 8:398-400. 26. Keng, T., and L. Guarente. 1987. Constitutive expression of the yeast HEM] gene is actually a composite of activation and repression. Proc. Natl. Acad. Sci. USA 84:9113-9117. 27. Laz, T. M., D. F. Pietras, and F. Sherman. 1984. Differential regulation of the duplicated isocytochrome c genes in yeast. Proc. Natl. Acad. Sci. USA 81:4475-4479. 28. Lowry, C. V., and R. H. Lieber. 1986. Negative regulation of the Saccharomyces cerevisiae ANBI gene by heme, as mediated by the ROXI gene product. Mol. Cell. Biol. 6:4145-4148. 29. Lowry, C. V., J. L. Weiss, D. A. Walthall, and R. S. Zitomer. 1983. Modulator sequences mediate the oxygen regulation of CYCI and a neighboring gene in yeast. Proc. Natl. Acad. Sci. USA 80:151-155. 30. Lowry, C. V., and R. S. Zitomer. 1984. Oxygen regulation of aerobic and anaerobic genes mediated by a common regulatory factor in yeast. Proc. Natl. Acad. Sci. USA 81:6129-6133. 31. Lowry, C. V., and R. S. Zitomer. 1988. ROXI encodes a heme-induced repression factor regulating ANBI and CYC7 of Saccharomyces cerevisiae. Mol. Cell. Biol. 8:4651-4658. 32. Mattoon, J. R., W. E. Lancashire, H. K. Sanders, R. Carvajal, D. Malamud, G. R. C. Brag, and A. D. Panek. 1979. Oxygen and catabolite regulation of hemoprotein biosynthesis in yeast, p. 421-435. In W. J. Caughey (ed.), Biochemical and clinical aspects of oxygen. Academic Press, Inc., New York. 33. Mehta, K. D., and M. Smith. 1989. Identification of an upstream repressor site controlling the expression of an anaerobic gene (ANBI) in Saccharomyces cerevisiae. J. Biol. Chem. 264:86708675. 34. Myers, A. M., M. D. Crivellone, T. J. Koerner, and A. Tzagoloff. 1987. Characterization of the yeast HEM2 gene and transcriptional regulation of COX5 and CORI by heme. J. Biol. Chem. 262:16822-16829. 35. Olesen, J., S. Hahn, and L. Guarente. 1987. Yeast HAP2 and HAP3 activators both bind to the CYCI upstream activation site, UAS2, in an interdependent manner. Cell 51:953-961. 36. Poole, R. K. 1983. Bacterial cytochrome oxidases. A structurally and functionally diverse group of electron-transfer proteins. Biochim. Biophys. Acta 726:205-243. 37. Power, S. D., M. A. Lochrie, K. A. Severino, T. E. Patterson, and R. 0. Poyton. 1984. The nuclear-coded subunits of yeast cytochrome c oxidase. I. Fractionation of the holoenzyme into chemically pure polypeptides and the identification of two new subunits using solvent extraction and reversed phase high performance liquid chromatography. J. Biol. Chem. 259:65646570. 38. Poyton, R. 0. 1980. Cooperative interaction between mitochondrial and nuclear genomes: cytochrome c oxidase assembly as a model. Curr. Top. Cell. Regul. 17:231-295. 39. Schiavo, G., and R. Bisson. 1989. Oxygen influences the subunit structure of cytochrome c oxidase in the slime mold Dictyostelium discoideum. J. Biol. Chem. 264:7129-7134. 40. Sherman, F., G. Fink, and J. Hicks. 1986. Methods in yeast genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 41. Sumrada, R. A., and T. Cooper. 1987. Ubiquitous upstream repression sequences control activation of the inducible argi-

5520

HODGE ET AL.

nase gene in yeast. Proc. Natl. Acad. Sci. USA 84:3997-4001. 42. Thorsness, M., W. Schafer, L. D'Ari, and J. Rine. 1989. Positive and negative transcriptional control by heme of genes encoding 3-hydroxy-3-methylglutaryl coenzyme A reductase in Saccharomyces cerevisiae. Mol. Cell. Biol. 9:5702-5712. 43. Trueblood, C. E., and R. 0. Poyton. 1987. Differential effectiveness of yeast cytochrome c oxidase subunit V genes results from differences in expression not function. Mol. Cell. Biol. 7:35203526. 44. Trueblood, C. E., R. M. Wright, and R. 0. Poyton. 1988. Differential regulation of the two genes encoding Saccharomyces cerevisiae cytochrome c oxidase subunit V by heme and the HAP2 and REOI genes. Mol. Cell. Biol. 8:4537-4540. 45. Yanisch-Peron, C., J. Vieira, and J. Messing. 1985. Improved

MOL. CELL. BIOL.

M13 phage cloning vectors and host strains: nucleotide seof the M13mpl8 and pUC19 vectors. Gene 33:103-119. 46. Zagorec, M., J.-M. Buhler, I. Treich, T. Keng, L. Guarente, and R. Labbe-Bois. 1988. Isolation, sequence, and regulation by oxygen of the yeast HEM13 gene coding for coproporphyrinogen oxidase. J. Biol. Chem. 263:9718-9724. 47. Zagorec, M., and R. Labbe-Bois. 1986. Negative control of yeast coproporphyrinogen oxidase synthesis by heme and oxygen. J. Biol. Chem. 261:2506-2509. 48. Zitomer, R. S., J. W. Sellers, D. W. McCarter, G. A. Hastings, P. Wick, and C. Lowry. 1987. Elements involved in oxygen regulation of the Saccharomyces cerevisiae CYC7 gene. Mol. Cell. Biol. 7:2212-2220. quences