Journal of Biotechnology 189 (2014) 136–142
Contents lists available at ScienceDirect
Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec
Upstream regulatory regions controlling the expression of the Candida utilis maltase gene ˇ Hana Bonková, Michaela Osadská, Ján Krahulec ∗ , Veronika Liˇsková, ˇ Stanislav Stuchlík, Ján Turna Comenius University in Bratislava, Faculty of Natural Sciences, Department of Molecular Biology, Mlynská dolina, 842 15 Bratislava 4, Slovak Republic
a r t i c l e
i n f o
Article history: Received 26 May 2014 Received in revised form 5 September 2014 Accepted 8 September 2014 Available online 16 September 2014 Keywords: Candida utilis Maltase promoter Cre-loxP system -Galactosidase qPCR
a b s t r a c t Candida utilis represents a promising expression host, generating relatively high levels of recombinant proteins. The current study presents preliminary characterization of the upstream regulatory regions controlling the carbon source-dependent expression of the C. utilis maltase gene. Cellobiose and soluble starch were recognised as inducers of maltase promoter, besides maltose. We successfully applied the Cre-loxP system to acquire a null mutant strain with disrupted maltase gene and promoter in polyploid yeast C. utilis. Furthermore, the strength and minimal functional region of the promoter was evaluated by measuring -galactosidase activity. Our results suggest, the qPCR was shown itself a very smart method for relatively easy characterization of the transformants and correlation of the expression levels with gene dosage. © 2014 Elsevier B.V. All rights reserved.
1. Introduction For more than six decades, Candida utilis has represented an industrially important yeast, being classified as GRAS (Generally Recognized as Safe) by regulatory authorities. Owing to its high protein content and its safety, it is considered to be a fodder yeast and a potential microbial source of various endogenous products (Boze et al., 1992). Cultivation cost is very acceptable, comparable to that of Escherichia coli and C. utilis can adapt to a number of carbon and nitrogen sources. Moreover, secretome of C. utilis is without any proteases (Buerth et al., 2011). Recently, the whole genome sequencing and phylogenetic analysis of C. utilis was published (Buerth et al., 2011; Tomita et al., 2012). The development of genetic tools, including the Cre-loxP recombination system, has allowed the efficient production of recombinant proteins in C. utilis, such as monellin (Kondo et al., 1997), ␣-amylase (Miura et al., 1999), carotenoids (Miura et al., 1998), biotin (Hong et al., 2006), xylanase (Wei et al., 2010) and l-lactate (Ikushima et al., 2009a). Furthermore, the dried yeast powder of recombinant protein-producing strain C. utilis may have the potential to be used directly as food
∗ Corresponding author. Tel.: +421 2 602 96 509. ˇ E-mail addresses: [email protected] (H. Bonková), [email protected] (M. Osadská), [email protected], [email protected] (J. Krahulec), [email protected] (V. Liˇsková), [email protected] (S. Stuchlík), ˇ [email protected] (J. Turna). http://dx.doi.org/10.1016/j.jbiotec.2014.09.006 0168-1656/© 2014 Elsevier B.V. All rights reserved.
additive, cosmetic additive, or animal feed without further expensive processes to isolate and purify recombinant product from the fermentation broth. However, extensive use of C. utilis for the expression of heterologous proteins is hampered, especially due to its polyploidy (Ikushima et al., 2009b). The current paper presents a study of the promoter region upstream of the C. utilis maltase gene in order to compare its regulation. The main aims of this work were construction of C. utilis strain with functionless maltase gene and promoter, identification of minimum-length promoter region of maltase gene and screening for multiple copy integrants using qPCR based method. 2. Material and methods 2.1. Strains and growth conditions Candida utilis CCY 39-38-18 strain was obtained from the Slovak collection of yeasts and yeast-like microorganisms (Institute of Chemistry, SAS Bratislava, Slovakia). For yeast cultivation was used minimal medium (1.34% yeast nitrogen base, 4 × 10−5 % biotin, and 2% carbon source) or YPD medium supplemented with 200 mg dm−3 of G418 (Serva, Heidelberg, Germany) or 30 mg dm−3 of zeocin (Invitrogen, Carlsbad, CA), unless otherwise specified. Escherichia coli strain DH5␣ (Invitrogen, Carlsbad, CA) served for plasmids maintenance and construction. LB medium supplemented with 100 mg dm−3 of ampicillin, 10 mg dm−3 of zeocin or
H. Bonková et al. / Journal of Biotechnology 189 (2014) 136–142 ˇ
137
Table 1 Strains and plasmids used in this study Ampr - ampicillin resistance, Zeor - Zeocin resistance, Kmr - kanamycin resistance, G418r - G418 resistance. Strains Candida utilis CCY 39-38-18 Cu/glcZ Cu/glcG Cu/glcF Cu/glcF-lacZ Cu/glcF-lac4 Kluyveromyces lactis 2359/152 Escherichia coli DH5␣ BL21 Plasmids pGAPZ␣C pPIC9K pUC19 pRI135 pKTac-Cre pCuCRE pglc pGLC-lacZ-d0∼d6 pGAP-lacZ pGLC-lac4 pGAP-lac4
Characteristics
Sources
Wild-type ␣glc::(loxP-Zeor -loxP) ␣glc::loxP, containing replicative plasmid pCuCRE ␣glc::loxP Cu/glcF with inserted pGAP-lacZ or pGLC-lacZd0∼d6 Cu/glcF with inserted pGAP-lac4 or pGLC-lac4
Institute of Chemistry, SAS Bratislava, Slovakia This work This work This work This work This work
Wild-type
Department of Microbiology and Virology, FNS CU Bratislava, Slovakia
supE44,lacU169 (ϕ80 lacZM15), hsdR17, recA1, endA1, gyrA96, thi-1,relA1 F− dcm ompT hsdS(rB − mB − ) gal [malB + ]K-12 (S )
Invitrogen, Carlsbad, CA
r
Zeo , P. pastoris expression vector G418r , P. pastoris expression vector Ampr , E. coli cloning vector Ampr , the plasmid carrying ARS4-2-2 Kmr , the plasmid carrying Cre recombinase G418r , the plasmid carrying Cre cassette and ARS4-2-2 Ampr , pUC19 derivative carrying mutagenesis cassette Zeor , lacZ gene under GLC promoter various length Zeor , lacZ gene under GAP promoter Zeor , lac4 gene under GLC promoter Zeor , lac4 gene under GAP promoter
50 mg dm−3 of kanamycin was used for E. coli cultivation. All strains used in this study are listed in Table 1. 2.2. Recombinant DNA techniques DNA manipulations were performed by standard methods (Sambrook et al., 1989; Rose et al., 1990), or as instructed by the suppliers. Plasmid DNA from C. utilis was purified according to “User-developed protocol: Isolation of plasmid DNA from yeast using the QIAGEN® Plasmid Midi Kit” (Qiagen, QP11.doc Aug-01). PCR was performed on genomic or plasmid DNA with GoTaq® DNA Polymerase (Promega, Madison, WI) or Pfu Ultra II Fusion HS DNA Polymerase (Agilent Technologies, Santa Clara, CA) following the supplier‘s instruction manual. The primers used in this study are listed in Table 2. 2.3. Transformation experiments Transformations were carried out by electroporation with 0.5–10 g of DNA solution in 2 mm electroporation cuvettes under the following conditions: 1.5 kV, 600 , 25 F for yeast cells and 2.5 kV, 200 , 25 F for E. coli. 2.4. Construction of Cre recombinase expression plasmid A DNA fragment responsible for resistance to G418 was generated with primers KAN F/KAN R and plasmid pPIC9K as template. Promoter and terminator sequence of the gene for glyceraldehyde3P-dehydrogenase (GAP) were amplified from genomic DNA of C. utilis using primers CuPgapF/CuPgapR and CuTgapF/CuTgapR, respectively. The three PCR products were used as a template in the next PCR with terminal primers CuPgapF/CuTgapR, resulting in a 2.8-kb DNA fragment. pUC origin of replication was amplified with primers OriF/OriR from plasmid pRI135. PCR products 2.8-kb expression cassette of selection marker and 0.8-kb origin of replication were digested with BglII and ligated together. Autonomously replicating sequence ARS 4-2-2 was isolated as SalI–SpeI fragment (0.9 kb) from plasmid pRI135 and cloned into the previously made plasmid. Cleavage sites for SalI and SpeI were introduced
New England BioLabs, Ipswich, MA Invitrogen, Carlsbad, CA Invitrogen, Carlsbad, CA (Yanisch-Perron et al., 1985) Iwakiri et al. (2005) (Marx et al., 2008) This work This work This work This work This work This work
by primer OriR. S. cerevisiae-derived Cre recombinase was amplified by PCR using primers CreF/CreR from plasmid pKTac-Cre. Promoter and terminator of the yeast plasma membrane ATPase gene (PMA) were amplified from genomic DNA of C. utilis using primers PpmaF/PpmaR and TTpmaF/TTpmaR, respectively. The three PCR products were used as a template in the next PCR with terminal primers PpmaF/TTpmaR, resulting in a 2-kb DNA fragment. Expression cassette was then inserted as a SpeI fragment into the previous vector. All plasmid DNAs after the amplification and subsequent cloning were verified by sequence analysis and the resultant plasmid was named pCuCRE (Fig. 1a). 2.5. Construction of disruption cassette The selectable marker Sh ble gene and its regulatory elements with 34-bp loxP flanks were amplified using primers LOX-ZEO F/LOX-ZEO R from plasmid pGAPZ␣C. Fragments located from −1488 to −983, and +1018 to +1563 relatively to the ATG start codon of the maltase gene, were amplified with primers Up-Glc F/Up-Glc R, and Down-Glc F/Down-Glc R, respectively. The mix of three PCR products was used as a template in the fusion PCR with terminal primers, resulting in 2.3-kb DNA fragment. The disruption cassette was cloned into pUC19 vector via HindIII restriction site, yielding plasmid pglc (Fig. 1b). The nucleotide sequence of this construct was further verified by DNA sequence analysis. 2.6. Construction of plasmids for the reporter gene assay The SalI−BamHI AOX1 (alcohol oxidase) terminator fragment of pGAPZ␣C was replaced by the 0.7-kb fragment of maltase terminator, which was amplified from C. utilis genomic DNA using primers tGLC F/tGLC R. BglII–NotI fragment of GAP promoter and ␣-factor signal sequence of pGAPZ␣C was replaced by the 1.7-kb fragment of 18S rDNA (GenBank AF239662), which was amplified using primers 18S F/18S R from C. utilis genomic DNA. Upstream sequence of maltase gene was amplified using primer pGLC F and sequentially with primers pGLC R1, R2 and R3 from C. utilis genomic DNA, and resultant product was cleaved with NotI and SalI and inserted into the previously made vector. Primers pGLC R1, R2 and
138
H. Bonková et al. / Journal of Biotechnology 189 (2014) 136–142 ˇ
Table 2 Primers used in this study. Primer
Sequence (5 –3 )
LOX-ZEO F
UP-GLC F UP-GLC R DOWN-GLC F DOWN-GLC R
GACCTTCGTTTGTGCGGATCCATAACTTCGTATAATGTATGCTATACGAAGTTATCCCACACACCATAGCTTCAAAATG CTTTTGCTCACATGTTGGTCTCCCCTAGGATAACTTCGTATAGCATACATTATACGAAGTTATAGCTTGCAAATTAAAGCCTTCGAGC GGAGCTAGTGAATGTTCCCATTTAG GGATCCGCACAAACGAAGGTCTCCAGTGAAACTTATCCCACATCCC GGAGACCAACATGTGAGCAAAAGGCCGTTGCGTGACCCGTTTCG GATGACATCAATCTTCTTGGTACCC
Verification primers
P1 L2
CGTAATCAACGTCCTGTTCTTCG CCTCCTTGAAAGCCCATGCC
pCuCRE
PpmaF PpmaR CreF CreR TTpmaF TTpmaR CuPgap F CuPgap T KAN F KAN R CuTgap F CuTgap R OriF OriR
GGGGACTAGTGATCGGTGTTTTGGGCAGTGG GGTGTACGGTCAGTAAATTGGACATCTATATCAATGGTTAGTATCACGTGG ATGTCCAATTTACTGACCGTACACC CTAATCGCCATCTTCCAGCAGG CCTGCTGGAAGATGGCGATTAGGCCGCTAATACCCCTTAGG CCCCACTAGTCCGCACTCGCTGATCGAAAAG GGGGAGATCTAAGCTTACAGCGAGCACTCAAATC TATGTTGTTTGTAAGTGTGTTTTGTATC GATACAAAACACACTTACAAACAACATAGGGGGGGGGAAAGCC CGTAATCCCATAAATAAAAGTCATACAATCGCCGTCCCGTCAAGTC ATTGTATGACTTTTATTTATGGGATTACG CCCCAGATCTACGTGTAATACCTCAGGAGTCAG GGGGAGATCTTGAGCAAAAGGCCAGCAAAAGG CCCCAGATCTACTAGTGTCGACGTAGAAAAGATCAAAGGATCTTCTTG
pGLC-lacZ-d0∼d6; pGAP-lacZ; pGLC-lac4; pGAP-lac4
pGLC F pGLC F-d1 pGLC F-d2 pGLC F-d3 pGLC F-d4 pGLC F-d5 pGLC F-d6 pGLC R1 pGLC R2 pGLC R3 pGAP F-NotI pGAP R1 18S F 18S R Lac4 F Lac4 R LacZ F LacZ R tGLC F tGLC R
GGGGGCGGCCGCATAGTTACTTGTTTAATTCTTCAAAAGAAGAGC GGGGGCGGCCGCGATGTTCACCCAACCAGGTCG GGGGGCGGCCGCCGGAGAAATTACCATTACATCATGGC GGGGGCGGCCGCGTATGAAGGTAGGTTTTAAGGAGGTG GGGGGCGGCCGCGGGTGTATGTAGAGGAGATCACC GGGGGCGGCCGCCATGGGAAGTTTGTGTGCACTGG GGGGGCGGCCGCTTCAACCCCATGCACATGGGG CTATGCCGATGATTAATTGTCAACACTAAGCGAGAACTTGTTCTTGTTTTTGATTC CCTTGTCGTATTATACTATGCCGATATACTATGCCGATGATTAATTGTCAACAC CCCCGTCGACTGGCCATGGTTTAGTTCCTCACCTTGTCGTATTATACTATGCCGATATAC GGGGGCGGCCGCAAGCTTACAGCGAGCACTCAAATC CTATGCCGATGATTAATTGTCAACACTATGTTGTTTGTAAGTGTGTTTTGTATC GGGGAGATCTGATCCTGCCAGTAGTCATATGC CCCCGCGGCCGCTGACTTGCGCTTACTAGGAATTCC GGGGGTCGACATGTCTTGCCTTATTCCTGAGAATTTAAG CCCCGTCGACTTATTCAAAAGCGAGATCAAACTCAAAGTTG GGGGGTCGACATGACCATGATTACGGATTCACTG CCCCGTCGACTTATTTTTGACACCAGACCAACTGG GGGGGTCGACGATACGTATCTTCTATACTGTATAGATG CCCCGGATCCTGTGGTAATTGCTTATGGGGTTTTTTAG
Verification primers
18S F2 18S R2
CAGCCACTGGTAACAGGATTAGC TAAGCCATTCAATCGGTAGTAGCG
qPCR
ori L1 ori P1 mal L1 mal P1
GTAACAGGATTAGCAGAGCGA CGCAGATACCAAATACTGTCCT AATACAGAGACTTGATGGTGGA ACATCAATCTTCTTGGTACCCT
Mutagenesis cassete
LOX-ZEO R
Fig. 1. Plasmids used for Cu/glcF strain construction. (a) pCuCRE. (b) pglc.
H. Bonková et al. / Journal of Biotechnology 189 (2014) 136–142 ˇ
139
(PNPG, Sigma–Aldrich, St. Louis, MO), and (B) o-nitrophenyl-galactoside (ONPG, Sigma–Aldrich, St. Louis, MO) as a chromogenic substrate. The reaction mixture contained (A) 800 l 6 mM PNPG, 199.5 l 50 mM Kx PO4 pH 6.0 and 0.5 l cell extract, and (B) 600 l Z buffer (100 mM Nax PO4 pH 7.0, 10 mM KCl, 1 mM MgSO4 ·7H2 O, 0.28% 2-mercaptoethanol), 200 l cell extract and 200 l ONPG (4 g dm−3 ). The reaction was performed for (A) 15 min at 37 ◦ C, and (B) 30 min at 28 ◦ C and stopped by addition of (A) 200 l, and (B) 400 l 1 M Na2 CO3 . The absorbance of mixtures was measured at (A) 405 nm, and (B) 420 nm. Protein concentrations were determined according to Bradford (1976). 2.8. Determination of plasmid copy number by quantitative PCR
Fig. 2. Plasmids used for characterization of maltase promoter region.
In order to estimate the number of chromosomally integrated plasmids pGLC-lacZ-d0∼d6 and pGAP-lacZ, qPCR on genomic DNA was performed. Primer pair ori L1/ori P1 was designed to amplify integrated plasmid (ori) and internal standardization was performed using a primer pair mal L1/mal P1 with homology to chromosomal sequence. The ratio ori/mal signals obtained from critical take off (Ct) values against log dilution was used to calculate copy number of incorporated heterologous DNA sequences relative to a resident chromosomal gene. 3. Results
R3 were designed to introduce EM7 synthetic prokaryotic constitutive promoter downstream of maltase regulatory region. Next, we amplified the coding region of yeast -galactosidase (GenBank M84410.1) with primers lac4F/lac4R from K. lactis genomic DNA and the E. coli -galactosidase (GenBank J01636.1) with primers lacZ F/lacZ R from E. coli BL21 genomic DNA. The 3-kb lac4 and lacZ inserts were cloned into SalI site of previous plasmid. The SalI restriction site on 3 terminus of -galactosidase gene sequence was eliminated using partial digestion with SalI and filling with T4 DNA polymerase for future easy handling with maltase promoter sequence. All plasmid DNAs after the amplification and subsequent cloning were verified by sequence analysis and the resultant plasmids were named pGLC-lac4 (9.8 kb) and pGLC-lacZd0, respectively. GAP gene promoter was amplified using primer pGAP F-NotI and sequentially primers pGAP R1 and pGLC R2 and R3 from C. utilis genomic DNA. Maltase promoter in pGLC-lac4 and pGLClacZ-d0 was replaced by 1-kb DNA fragment of amplified C. utilis GAP promoter via NotI/SalI restriction sites yielding in pGAP-lac4 and pGAP-lacZ plasmids, respectively. Various lengths of upstream regulatory regions of the maltase gene were obtained by PCR amplification using primers (pGLC F-d1∼d6) and primer pGLC R3. The full length upstream region of maltase gene in plasmid pGLC-lacZ-d0 was then replaced for shorter ones via NotI and SalI restriction sites, resulting in pGLC-lacZ-d1∼d6 plasmids (Fig. 2). The nucleotide sequence of all these constructs were verified by DNA sequence analysis. 2.7. Assay of (A) ˛-glucosidase and (B) ˇ-galactosidase enzyme activity Overnight cell cultures for the extract preparation were harvested by centrifugation, washed with distilled water and suspended in 0.3 ml of the breaking buffer containing (A) 1% SDS, 0.1 M NaCl, 0.01 M Tris–HCl pH 8.0 and 1 mM EDTA, and (B) 0.1 M Tris–HCl, pH 8.0, 1 mM DTT and 20% glycerol. Yeast cells were disrupted using acid-washed glass beads (Sigma–Aldrich, St. Louis, MO) by shaking (6 cycles of 30 s shaking and 60 s cooling) in a vortex mixer at maximum speed. Insoluble particles were removed by centrifugation and obtained clear cell extract was used in measurements of activity using (A) p-nitrophenyl-␣-d-glucopyranoside
3.1. Effect of carbon-sources on expression from maltase promoter Different carbon sources were tested to obtain data about repression and induction of the maltase gene transcription and also ability to grow on assayed carbon sources of both wild type C. utilis and mutated C. utilis with no maltase activity and integrated plasmid pGLC-lacZ-d0, namely Cu/glcF-lacZ. Transcription activity of the promoter region upstream of maltase gene was assayed by the level of the ␣-glucosidase or -galactosidase activity on chromogenic substrates and all experiments were performed at least in triplicate. Both strains were able to grow on fructose, glucose, mannose, cellobiose, sucrose, trehalose, raffinose, soluble starch, ethanol and glycerol. Both did not grow on arabinose, galactose, lactose, dextran, cellulose, methanol, manitol and sorbitol. Expectantly on maltose only wild type one was able to grow, but not Cu/glcF-lacZ. Only three of assayed carbon sources, namely maltose, cellobiose and soluble starch were recognised as the inducers. In order to identify the repressors of the maltase promoter, glucose, fructose, sucrose, raffinose, and glycerol were selected for combining. Except raffinose, all of them totally repressed the promoter activity, ergo the activity was as high as for non-inducers alone and it was about 6.3 pkat mg−1 . Data on repressive effect of raffinose on maltase promoter are presented in Table 3. 3.2. Maltase gene elimination in C. utilis using Cre-loxP recombination system The maltase gene was identified in genome sequence C. utilis NBRC 0988 (GenBank BAEL00000000.1) by aligning known nucleotide sequence of C. albicans maltase gene. Sequence analysis showed two open reading frames in opposite directions, corresponding to the maltase and maltose permease genes. The nucleotide sequence deduced from the C. utilis maltase gene exhibited 66% identity with maltase gene from C. albicans. In order to perform gene disruption efficiently, we applied the modified reusable marker Cre-loxP recombination system. Before introduction into C. utilis CCY 39-38-18 cell, the plasmid pglc containing mutagenic cassette was digested with HindIII. Correct integration
140
H. Bonková et al. / Journal of Biotechnology 189 (2014) 136–142 ˇ
Fig. 3. Verification of maltase disruption and marker excision by PCR using primers L2/P1 and schematic representation of C. utilis maltase gene alleles: (A) wild-type allele (3.3-kb PCR product); (B) allele with the zeocin expression cassette replacing the maltase gene and promoter (2.5-kb product); (C) disrupted allele resulting from Cre-recombination (1.2-kb product).
Table 3 Regulation of maltase promoter in C. utilis wild-type strain and maltase deletion mutant carrying plasmid pGLC-lacZ-d0. Minimal media containing 2% carbon sources were used for cultivation. Carbon source
Activity of ␣-glucosidase (nkat mg−1 ) + Raffinose
C. utilis wild-type Cellobiose Maltose Soluble starch Carbon source
135.4 81.7 61.4
51.7 10.0 15.7
Activity of -galactosidase (nkat.mg−1)+ raffinosecellobiose0.410.19maltose mg−1 ) + Raffinose
Cu/glcF-lacZ Cellobiose Maltose
0.41 0
0.19 0.18
was verified by plasmid isolation and subsequent transformation and selection of the E. coli DH5␣ cells on kanamycin media. All of assayed clones contained plasmid pCuCRE. One of these clones was named Cu/glcG and after the selection on G418 passaged in liquid media without any antibiotics and then plated on agar plates in convenient dilution to obtain single colonies. Several tenths of clones were assayed on plates with either G418 and zeocin and no one conferred resistance to either one of them even when only one day passage was used. When culture was plated only after 3 generations, 16% of cells conferred resistance to G418, but no one to zeocin. Employing PCR using primers L2/P1 it was possible to obtain only 1.2-kb product (Fig. 3) that corresponded to mutated allele without determinant for zeocin resistance. No one of verified strains conferred ␣-glucosidase activity in minimal cellobiose medium. One of these strains was designated Cu/glcF and used for all further manipulations. 3.3. Maltase promoter activity
of gene disruption cassette was confirmed by both enzyme activity and PCR using primers L2/P1 located outside the left or right flanking homology arm, respectively. Employing PCR it was possible to observe either wild type 3.3-kb PCR product or both wild type with mutated one (3.3-kb and 2.5-kb fragments). The presence of clones with both products suggests the presence of multiple maltase alleles, at least two. The frequency of the clones with both PCR products was below 20%. Nevertheless, when we used for transformation digested plasmid with blunt termini we observed correct integration in almost all the examined strains. The concentration of antibiotic also plays quite important role on efficiency in obtaining correct clones. We used various zeocin concentrations (from 0.03 g dm−3 to 4 g dm−3 ) and the most effective concentration was recognized 0.3 g dm−3 . The wild type clone reached the ␣-glucosidase activity about 81.7 nkat mg−1 , whereas the activity in mutated ones oscillated around 50% with few exception (under the 10%) around 70–80% and 20–30% of the wild type one. In order to obtain the strain only with one 2.5-kb large PCR product, additional mutagenesis had to be performed. One strain with the activity about half of wild type one was chosen to be retransformed with mutation cassette of pglc plasmid. In this phase of experiments, the most effective zeocin concentration for correct clone’s acquisition was recognized 1 g dm−3 . It was possible to achieve almost 20% clones with inability to grow on maltose as the carbon source. All of them had only one PCR product with size of 2.5-kb corresponding to mutated one. One of these clones, designated Cu/glcZ, was transformed with replicative plasmid pCuCRE to eliminated determinant for zeocin resistance. The presence of the plasmid in selected clones that conferred resistance to G418
In order to study the regulation and strength of maltase promoter, Cu/glcF strain with functionless maltase gene was transformed with plasmid pGLC-lac4, carrying -galactosidase from K. lactis, linearized with SacII. The correct integration of the plasmid was confirmed by PCR with primers 18S F2/R2. Minimal cellobiose medium was chosen for -galactosidase assay, because the maltase promoter was activated by this inductor to highest levels (Table 3). However, any lac4 expression, ergo -galactosidase activity could not be detected from any clone. As the activity could not be detected either even from constitutive promoter of C. utilis GAP gene, employing plasmid pGAP-lac4, it was possible to conclude that lac4 gene did not express in yeast C. utilis at detectable levels. Under these circumstances, plasmids pGLC-lacZ-d0 and pGAP-lacZ, which carried E. coli lacZ gene, were constructed. Both plasmids were successfully introduced into the Cu/glcF 18S rDNA and E. coli lacZ gene was expressed intracellularly from both GAP and maltase promoters in C. utilis, what could be readily detected by -galactosidase activity in cell extracts and undetectable activity in media (data not shown). In order to localize the minimum-length promoter region for the maximum transcription level, several deletion mutants of the promoter region were constructed. As a control sequence was taken an intergenic region between maltase and maltose permease genes. The region and its deletion derivatives (d0-d6) were functionally connected with lacZ gene in plasmids pGLC-lacZ-d0∼d6. It was possible to observe that deletion d6 had elimination effect on promoter. Additional two deletions decreased expression level of the -galactosidase by 40% and deletion d3 is the shortest one
H. Bonková et al. / Journal of Biotechnology 189 (2014) 136–142 ˇ
141
Fig. 4. Diagram showing the zeocin resistance level (g dm−3 ) and the ori/mal ratio, which represents plasmid copy number of selected Cu/glcF-lacZ clones, carrying plasmids pGLC-lacZ-d0 (1, 5, 6, 7), pGLC-lacZ-d1 (2, 3, 4, 8) or pGAP-lacZ (9, 10), relative to a maltase gene. Table 4 -Galactosidase activities of transformants having various lengths of the maltase promoter. Medium data of three to four distinct transformants are shown. Standard deviation was less than 20%. Final values of -galactosidase activity are standardize to the same plasmid copy number according to data obtained by qPCR method.
Length of promoter (bp) -Galactosidase activity (nkat mg−1 )
pGLC-lacZ-d0
pGLC-lacZ-d1
pGLC-lacZ-d2
pGLC-lacZ-d3
pGLC-lacZ-d4
pGLC-lacZ-d5
pGLC-lacZ-d6
2370 0.343
1770 0.327
1627 0.337
1467 0.343
1327 0.215
1151 0.203
577 Below detection
with no lost in transcriptional activity (Table 4). During activity calculation, relative copy number were taken into the consideration as it is described below. Relative values of plasmid copy number were estimated by qPCR using primers ori L1/ori P1 to amplify integrated plasmid (ori) and primer set mal L1/mal P1 with homology to chromosomal sequence (mal). When comparing the ori/mal ratios with the expression levels of the different clones it was obvious that there is a correlation between gene dosage and recombinant protein expression level. The linear regression correlation coefficient (R2 ) for 11 selected clones was 0.9984. Several clones did not fit the linearity and in this cases found copy numbers were always higher than the expectable one taking into the consideration measured -galactosidase activity. The highest value of achieved activity for maltase promoter was approximately 4-times higher than the lowest one, and it was 1.3 nkat mg−1 per 3.86 relative copies. Nevertheless, the activities reached for GAP promoter were usually higher, whereby the numbers did not change linear regression correlation coefficient, significantly. The highest measured activity was reached for GAP promoter with relative copy number of about 39.7 and -galactosidase activity of about 18.6 nkat mg−1 . When calculated for one relative copy, the activity for the maltase promoter is about 0.34 nkat mg−1 and for GAP 0.47 nkat mg−1 . The qPCR data also showed, as expected, that plasmid copy number increases with elevated resistance towards zeocin (Fig. 4). 4. Discussion Within the meaning of given information including introduction, it appears that C. utilis tends to be prominent expression host for production of recombinant proteins of many interests. As the molecular genetics of C. utilis is not well understood up to now, this study is trying to contribute to the knowledge about gene expression regulation and its possibilities to use it for recombinant protein expression in C. utilis. Promoter region of maltase gene was chosen because of its induction possibilities that were described before (Rolim et al., 2003). In spite of a fact that natural inductor of maltase promoter is maltose, two other inductors were found out, soluble starch and cellobiose. Cellobiose, compared to maltose and starch, does not
contain ␣(1 → 4) bonds, but (1 → 4), and interestingly the activities of ␣-glucosidase for cellobiose were approximately twice as high as for maltose. The reason is so far unclear. As the activity of the ␣-glucosidase was not detected for Cu/glcF in minimal cellobiose medium and -galactosidase activity could be detected in Cu/glcF-lacZ, it can be concluded that cellobiose is real inductor of maltase promoter, and that is not secondary activity of different glycosidase induced by cellobiose. Moreover the strain Cu/glcF grew on cellobiose, what could mean that cellobiose induced glycosidase is able to cleave cellobiose (1 → 4) bond. Nevertheless, polysaccharide cellulose, with the same bond between glucoses, was not utilized by C. utilis. Probably mentioned glycosidase is intracellular and the cellulose need some special transporter. Analogical situation was observed for lactose, which is a natural substrate for -galactosidase. Cu/glcF-lacZ were not able to utilize this disaccharide even in combination with maltose as the inductor of maltase promoter. A similar phenotype has been noticed for C. albicans (Uhl and Johnson, 2001) and S. cerevisiae (Sreekrishna and Dickson, 1985), and expression of a lactose permease was necessary before lactose could be utilized as a carbon source. The zeocin resistance gene was fully function in C. utilis even it was used with transcriptional promoter and terminator sequences from P. pastoris. According to our knowledge, this is the first application of zeocin as a selectable marker in C. utilis. Compared with the previously reported method using Cre-loxP system for C. utilis, where four cycles of mutagenesis had to be performed to obtain null mutant (Ikushima et al., 2009a), our strategy helps to reduce the number of steps to two. However, acquisition of a null mutant clone after single transformation with mutation cassette was practically impossible. Tenths of clones were assayed without any success even the highest concentration of zeocin was used. Probably the capacity in number of molecules which can enter the cell during electroporation is limited. The process of homological recombination occurs afterword the electroporation with definite number of molecules. Once one double homological recombination occurs and wild type allele is replaced, this place itself is much more likely target for homological recombination than other wild type allele. If on additional wild type replacement occurs the probability of self-change increases and change of next wild type allele
142
H. Bonková et al. / Journal of Biotechnology 189 (2014) 136–142 ˇ
decreases. Simultaneously with this, number of free mutation cassettes are become lower not only by inserting into the chromosome, but also by action of nucleases. Probably combination of described hypothesis, time, nucleases and number of screened clones made impossible to find null mutant after the single transformation. Our analysis of genome sequence C. utilis NBRC 0988 (GenBank BAEL00000000.1) indicates that the intergenic region between the structural genes for C. utilis maltase and maltose permease is 2370 bp long. The length of respective sequence for example in case of Saccharomyces carlsbergensis is 884 bp (Hong and Marmur, 1986). A systematic deletion analysis revealed that the region up to 1467 nt upstream of translation initiation codon of maltase gene should harbour all elements essential for full transcriptional capacity of the C. utilis maltase promoter. In contrast, H. polymorpha maltase promoter length of approximately 315 bp was sufficient for similar regulation as the full length promoter (Alamäe et al., 2003). Comparing with C. utilis, even longer promoter (577-bp) conferred undetectable levels of -galactosidase activity. The qPCR based method presented here offers a convenient and reliable means of characterizing recombinant C. utilis clones and could be included in the standard protocols when screening for multi-copy transformants. Since the primers used are designed to amplify a part of the vector sequence rather than the specific gene, it is generic for all constructs based on the pUC ori vector. Due to an unclear question of C. utilis ploidy, we could not definitely specify the absolute values of integrated plasmid copy number, thus we present only the ratios of integrated plasmid relative to a resident chromosomal gene (maltase gene). For clones with integrated pGAP-lacZ relative copy number oscillated around higher values than for clones with integrated pGLC-lacZ-d0. In C. utilis Cu/glcF strain promoter region of maltase gene has been deleted, but not GAP promoter. The presence of additional homological sequence makes higher probability for pGAP-lacZ to integrate into the chromosome in more copies than for pGLC-lacZ-d0. It is remarkable that the strength of the maltase promoter under cellobiose induction is quite comparable to the strength of the constitutive GAP promoter, which is known to be one of the most highly expressed genes in yeast. These results strongly suggest that the maltase promoter might find application for the design of expression systems to produce the protein of interest. Therefore it could be used like the inducible promoters for the regulated production of proteins that might be toxic to the cell. Summing up, cre-loxP system in combination with the zeocin as a reusable marker appears to be powerful method not only to disrupt C. utilis gene without additional selection marker, but it can also be used in finding clones with multi-inserted expression cassette. A screen for multiple copy integrants via qPCR could become a part of the routine optimization strategy when overexpressing recombinant proteins in this host. Acknowledgments We would like to thank Dr. Iwakiri for kindly providing pRI135 and pRI385 vectors and we also thank Dr. Ikushima for
helpful advice. This work is result of project implementation: “Industrial research of the new agents based on recombinant proteins” (ITMS 26240220034) supported by the Research and Development Operational Program funded by the ERDF and also supported by grant of Slovak research and development agency APVV-0119-12. References Alamäe, T., Pärn, P., Viigand, K., Karp, H., 2003. Regulation of the Hansenula polymorpha maltase gene promoter in H. polymorpha and Saccharomyces cerevisiae. FEMS Yeast Res. 4, 165–173. Boze, H., Moulin, G., Galzy, P., 1992. Production of food and fodder yeasts. Crit. Rev. Biotechnol. 12, 65–86. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Anal. Biochem. 72, 248–254. Buerth, C., Heilmann, C.J., Klis, F.M., de Koster, C.G., Ernst, J.F., Tielker, D., 2011. Growth-dependent secretome of Candida utilis. Microbiology 157, 2493–2503, http://dx.doi.org/10.1099/mic.0. 049320-0. Hong, Y.R., Chen, Y.L., Farh, L., Yang, W.J., Liao, C.H., Shiuan, D., 2006. Recombinant Candida utilis for the production of biotin. Appl. Microbiol. Biotechnol. 71, 211–221. Hong, S.H., Marmur, J., 1986. Primary structure of the maltase gene of the MAL6 locus of Saccharomyces carlsbergensis. Gene 41, 75–84. Ikushima, S., Fujii, T., Kobayashi, O., Yoshida, S., Yoshida, A., 2009a. Genetic engineering of Candida utilis yeast for efficient production of l-lactic acid. Biosci. Biotechnol. Biochem. 73, 1818–1824. Ikushima, S., Fujii, T., Kobayashi, O., 2009b. Efficient gene disruption in the high-ploidy yeast Candida utilis using the Cre-loxP system. Biosci. Biotechnol. Biochem. 73, 879–884. Iwakiri, R., Eguchi, S., Noda, Y., Adachi, H., Yoda, K., 2005. Isolation and structural analysis of efficient autonomously replicating sequences (ARSs) of the yeast Candida utilis. Yeast 23, 1049–1060. Kondo, K., Miura, Y., Sone, H., Kobayashi, K., Iijima, H., 1997. High-level expression of a sweet protein, monellin, in the food yeast Candida utilis. Nat. Biotechnol. 15, 453–457. Marx, H., Mattanovich, D., Sauer, M., 2008. Overexpression of the riboflavin biosynthetic pathway in Pichia pastoris. Microb. Cell Fact. 7, 23, http://dx.doi.org/10.1186/1475-2859-7-23. Miura, Y., Kondo, K., Saito, T., Shimada, H., Fraser, P.D., Misawa, N., 1998. Production of the carotenoids lycopene, beta-carotene, and astaxanthin in the food yeast Candida utilis. Appl. Environ. Microbiol. 64, 1226–1229. Miura, Y., Kettoku, M., Kato, M., Kobayashi, K., Kondo, K., 1999. High level production of thermostable alpha-amylase from Sulfolobus solfataricus in high-cell density culture of the food yeast Candida utilis. J. Mol. Microbiol. Biotechnol. 1, 129–134. Rolim, M.F., de Araujo, P.S., Panek, A.D., Paschoalin, V.M., Silva, J.T., 2003. Shared control of maltose and trehalose utilization in Candida utilis. Braz. J. Med. Biol. Res. 6, 829–837. Rose, M.D., Winston, F.M., Heiter, P., 1990. Methods in yeast genetics: a laboratory course manual. Cold Spring Harbor, New York. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor, New York. Sreekrishna, K., Dickson, R.C., 1985. Construction of strains of Saccharomyces cerevisiae that grow on lactose. Proc Natl Acad Sci U S A 82, 7909–7913. Tomita, Y., Ikeo, K., Tamakawa, H., Gojobori, T., Ikushima, S., 2012. Genome and transcriptome analysis of the food-yeast Candida utilis. PLoS One 7, e37226, http://dx.doi.org/10.1371/journal.pone.0037226. Uhl, M.A., Johnson, A.D., 2001. Development of Streptococcus thermophilus lacZ as a reporter gene for Candida albicans. Microbiology 147, 1189–1195. Wei, W., Hong-Lan, Y., Huifang, B., Daoyuan, Z., Qi-Mu-Ge, S., Wood, A.J., 2010. The effective expression of xylanase gene in Candida utilis by 18S rDNA targeted homologous recombination in pGLR9K. Mol. Biol. Rep. 37, 2615–2620. Yanisch-Perron, C., Vieira, J., Messing, J., 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequence of the M13mp18 and pUC19 vectors. Gene 33, 103–119.
Contents lists available at ScienceDirect
Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec
Upstream regulatory regions controlling the expression of the Candida utilis maltase gene ˇ Hana Bonková, Michaela Osadská, Ján Krahulec ∗ , Veronika Liˇsková, ˇ Stanislav Stuchlík, Ján Turna Comenius University in Bratislava, Faculty of Natural Sciences, Department of Molecular Biology, Mlynská dolina, 842 15 Bratislava 4, Slovak Republic
a r t i c l e
i n f o
Article history: Received 26 May 2014 Received in revised form 5 September 2014 Accepted 8 September 2014 Available online 16 September 2014 Keywords: Candida utilis Maltase promoter Cre-loxP system -Galactosidase qPCR
a b s t r a c t Candida utilis represents a promising expression host, generating relatively high levels of recombinant proteins. The current study presents preliminary characterization of the upstream regulatory regions controlling the carbon source-dependent expression of the C. utilis maltase gene. Cellobiose and soluble starch were recognised as inducers of maltase promoter, besides maltose. We successfully applied the Cre-loxP system to acquire a null mutant strain with disrupted maltase gene and promoter in polyploid yeast C. utilis. Furthermore, the strength and minimal functional region of the promoter was evaluated by measuring -galactosidase activity. Our results suggest, the qPCR was shown itself a very smart method for relatively easy characterization of the transformants and correlation of the expression levels with gene dosage. © 2014 Elsevier B.V. All rights reserved.
1. Introduction For more than six decades, Candida utilis has represented an industrially important yeast, being classified as GRAS (Generally Recognized as Safe) by regulatory authorities. Owing to its high protein content and its safety, it is considered to be a fodder yeast and a potential microbial source of various endogenous products (Boze et al., 1992). Cultivation cost is very acceptable, comparable to that of Escherichia coli and C. utilis can adapt to a number of carbon and nitrogen sources. Moreover, secretome of C. utilis is without any proteases (Buerth et al., 2011). Recently, the whole genome sequencing and phylogenetic analysis of C. utilis was published (Buerth et al., 2011; Tomita et al., 2012). The development of genetic tools, including the Cre-loxP recombination system, has allowed the efficient production of recombinant proteins in C. utilis, such as monellin (Kondo et al., 1997), ␣-amylase (Miura et al., 1999), carotenoids (Miura et al., 1998), biotin (Hong et al., 2006), xylanase (Wei et al., 2010) and l-lactate (Ikushima et al., 2009a). Furthermore, the dried yeast powder of recombinant protein-producing strain C. utilis may have the potential to be used directly as food
∗ Corresponding author. Tel.: +421 2 602 96 509. ˇ E-mail addresses: [email protected] (H. Bonková), [email protected] (M. Osadská), [email protected], [email protected] (J. Krahulec), [email protected] (V. Liˇsková), [email protected] (S. Stuchlík), ˇ [email protected] (J. Turna). http://dx.doi.org/10.1016/j.jbiotec.2014.09.006 0168-1656/© 2014 Elsevier B.V. All rights reserved.
additive, cosmetic additive, or animal feed without further expensive processes to isolate and purify recombinant product from the fermentation broth. However, extensive use of C. utilis for the expression of heterologous proteins is hampered, especially due to its polyploidy (Ikushima et al., 2009b). The current paper presents a study of the promoter region upstream of the C. utilis maltase gene in order to compare its regulation. The main aims of this work were construction of C. utilis strain with functionless maltase gene and promoter, identification of minimum-length promoter region of maltase gene and screening for multiple copy integrants using qPCR based method. 2. Material and methods 2.1. Strains and growth conditions Candida utilis CCY 39-38-18 strain was obtained from the Slovak collection of yeasts and yeast-like microorganisms (Institute of Chemistry, SAS Bratislava, Slovakia). For yeast cultivation was used minimal medium (1.34% yeast nitrogen base, 4 × 10−5 % biotin, and 2% carbon source) or YPD medium supplemented with 200 mg dm−3 of G418 (Serva, Heidelberg, Germany) or 30 mg dm−3 of zeocin (Invitrogen, Carlsbad, CA), unless otherwise specified. Escherichia coli strain DH5␣ (Invitrogen, Carlsbad, CA) served for plasmids maintenance and construction. LB medium supplemented with 100 mg dm−3 of ampicillin, 10 mg dm−3 of zeocin or
H. Bonková et al. / Journal of Biotechnology 189 (2014) 136–142 ˇ
137
Table 1 Strains and plasmids used in this study Ampr - ampicillin resistance, Zeor - Zeocin resistance, Kmr - kanamycin resistance, G418r - G418 resistance. Strains Candida utilis CCY 39-38-18 Cu/glcZ Cu/glcG Cu/glcF Cu/glcF-lacZ Cu/glcF-lac4 Kluyveromyces lactis 2359/152 Escherichia coli DH5␣ BL21 Plasmids pGAPZ␣C pPIC9K pUC19 pRI135 pKTac-Cre pCuCRE pglc pGLC-lacZ-d0∼d6 pGAP-lacZ pGLC-lac4 pGAP-lac4
Characteristics
Sources
Wild-type ␣glc::(loxP-Zeor -loxP) ␣glc::loxP, containing replicative plasmid pCuCRE ␣glc::loxP Cu/glcF with inserted pGAP-lacZ or pGLC-lacZd0∼d6 Cu/glcF with inserted pGAP-lac4 or pGLC-lac4
Institute of Chemistry, SAS Bratislava, Slovakia This work This work This work This work This work
Wild-type
Department of Microbiology and Virology, FNS CU Bratislava, Slovakia
supE44,lacU169 (ϕ80 lacZM15), hsdR17, recA1, endA1, gyrA96, thi-1,relA1 F− dcm ompT hsdS(rB − mB − ) gal [malB + ]K-12 (S )
Invitrogen, Carlsbad, CA
r
Zeo , P. pastoris expression vector G418r , P. pastoris expression vector Ampr , E. coli cloning vector Ampr , the plasmid carrying ARS4-2-2 Kmr , the plasmid carrying Cre recombinase G418r , the plasmid carrying Cre cassette and ARS4-2-2 Ampr , pUC19 derivative carrying mutagenesis cassette Zeor , lacZ gene under GLC promoter various length Zeor , lacZ gene under GAP promoter Zeor , lac4 gene under GLC promoter Zeor , lac4 gene under GAP promoter
50 mg dm−3 of kanamycin was used for E. coli cultivation. All strains used in this study are listed in Table 1. 2.2. Recombinant DNA techniques DNA manipulations were performed by standard methods (Sambrook et al., 1989; Rose et al., 1990), or as instructed by the suppliers. Plasmid DNA from C. utilis was purified according to “User-developed protocol: Isolation of plasmid DNA from yeast using the QIAGEN® Plasmid Midi Kit” (Qiagen, QP11.doc Aug-01). PCR was performed on genomic or plasmid DNA with GoTaq® DNA Polymerase (Promega, Madison, WI) or Pfu Ultra II Fusion HS DNA Polymerase (Agilent Technologies, Santa Clara, CA) following the supplier‘s instruction manual. The primers used in this study are listed in Table 2. 2.3. Transformation experiments Transformations were carried out by electroporation with 0.5–10 g of DNA solution in 2 mm electroporation cuvettes under the following conditions: 1.5 kV, 600 , 25 F for yeast cells and 2.5 kV, 200 , 25 F for E. coli. 2.4. Construction of Cre recombinase expression plasmid A DNA fragment responsible for resistance to G418 was generated with primers KAN F/KAN R and plasmid pPIC9K as template. Promoter and terminator sequence of the gene for glyceraldehyde3P-dehydrogenase (GAP) were amplified from genomic DNA of C. utilis using primers CuPgapF/CuPgapR and CuTgapF/CuTgapR, respectively. The three PCR products were used as a template in the next PCR with terminal primers CuPgapF/CuTgapR, resulting in a 2.8-kb DNA fragment. pUC origin of replication was amplified with primers OriF/OriR from plasmid pRI135. PCR products 2.8-kb expression cassette of selection marker and 0.8-kb origin of replication were digested with BglII and ligated together. Autonomously replicating sequence ARS 4-2-2 was isolated as SalI–SpeI fragment (0.9 kb) from plasmid pRI135 and cloned into the previously made plasmid. Cleavage sites for SalI and SpeI were introduced
New England BioLabs, Ipswich, MA Invitrogen, Carlsbad, CA Invitrogen, Carlsbad, CA (Yanisch-Perron et al., 1985) Iwakiri et al. (2005) (Marx et al., 2008) This work This work This work This work This work This work
by primer OriR. S. cerevisiae-derived Cre recombinase was amplified by PCR using primers CreF/CreR from plasmid pKTac-Cre. Promoter and terminator of the yeast plasma membrane ATPase gene (PMA) were amplified from genomic DNA of C. utilis using primers PpmaF/PpmaR and TTpmaF/TTpmaR, respectively. The three PCR products were used as a template in the next PCR with terminal primers PpmaF/TTpmaR, resulting in a 2-kb DNA fragment. Expression cassette was then inserted as a SpeI fragment into the previous vector. All plasmid DNAs after the amplification and subsequent cloning were verified by sequence analysis and the resultant plasmid was named pCuCRE (Fig. 1a). 2.5. Construction of disruption cassette The selectable marker Sh ble gene and its regulatory elements with 34-bp loxP flanks were amplified using primers LOX-ZEO F/LOX-ZEO R from plasmid pGAPZ␣C. Fragments located from −1488 to −983, and +1018 to +1563 relatively to the ATG start codon of the maltase gene, were amplified with primers Up-Glc F/Up-Glc R, and Down-Glc F/Down-Glc R, respectively. The mix of three PCR products was used as a template in the fusion PCR with terminal primers, resulting in 2.3-kb DNA fragment. The disruption cassette was cloned into pUC19 vector via HindIII restriction site, yielding plasmid pglc (Fig. 1b). The nucleotide sequence of this construct was further verified by DNA sequence analysis. 2.6. Construction of plasmids for the reporter gene assay The SalI−BamHI AOX1 (alcohol oxidase) terminator fragment of pGAPZ␣C was replaced by the 0.7-kb fragment of maltase terminator, which was amplified from C. utilis genomic DNA using primers tGLC F/tGLC R. BglII–NotI fragment of GAP promoter and ␣-factor signal sequence of pGAPZ␣C was replaced by the 1.7-kb fragment of 18S rDNA (GenBank AF239662), which was amplified using primers 18S F/18S R from C. utilis genomic DNA. Upstream sequence of maltase gene was amplified using primer pGLC F and sequentially with primers pGLC R1, R2 and R3 from C. utilis genomic DNA, and resultant product was cleaved with NotI and SalI and inserted into the previously made vector. Primers pGLC R1, R2 and
138
H. Bonková et al. / Journal of Biotechnology 189 (2014) 136–142 ˇ
Table 2 Primers used in this study. Primer
Sequence (5 –3 )
LOX-ZEO F
UP-GLC F UP-GLC R DOWN-GLC F DOWN-GLC R
GACCTTCGTTTGTGCGGATCCATAACTTCGTATAATGTATGCTATACGAAGTTATCCCACACACCATAGCTTCAAAATG CTTTTGCTCACATGTTGGTCTCCCCTAGGATAACTTCGTATAGCATACATTATACGAAGTTATAGCTTGCAAATTAAAGCCTTCGAGC GGAGCTAGTGAATGTTCCCATTTAG GGATCCGCACAAACGAAGGTCTCCAGTGAAACTTATCCCACATCCC GGAGACCAACATGTGAGCAAAAGGCCGTTGCGTGACCCGTTTCG GATGACATCAATCTTCTTGGTACCC
Verification primers
P1 L2
CGTAATCAACGTCCTGTTCTTCG CCTCCTTGAAAGCCCATGCC
pCuCRE
PpmaF PpmaR CreF CreR TTpmaF TTpmaR CuPgap F CuPgap T KAN F KAN R CuTgap F CuTgap R OriF OriR
GGGGACTAGTGATCGGTGTTTTGGGCAGTGG GGTGTACGGTCAGTAAATTGGACATCTATATCAATGGTTAGTATCACGTGG ATGTCCAATTTACTGACCGTACACC CTAATCGCCATCTTCCAGCAGG CCTGCTGGAAGATGGCGATTAGGCCGCTAATACCCCTTAGG CCCCACTAGTCCGCACTCGCTGATCGAAAAG GGGGAGATCTAAGCTTACAGCGAGCACTCAAATC TATGTTGTTTGTAAGTGTGTTTTGTATC GATACAAAACACACTTACAAACAACATAGGGGGGGGGAAAGCC CGTAATCCCATAAATAAAAGTCATACAATCGCCGTCCCGTCAAGTC ATTGTATGACTTTTATTTATGGGATTACG CCCCAGATCTACGTGTAATACCTCAGGAGTCAG GGGGAGATCTTGAGCAAAAGGCCAGCAAAAGG CCCCAGATCTACTAGTGTCGACGTAGAAAAGATCAAAGGATCTTCTTG
pGLC-lacZ-d0∼d6; pGAP-lacZ; pGLC-lac4; pGAP-lac4
pGLC F pGLC F-d1 pGLC F-d2 pGLC F-d3 pGLC F-d4 pGLC F-d5 pGLC F-d6 pGLC R1 pGLC R2 pGLC R3 pGAP F-NotI pGAP R1 18S F 18S R Lac4 F Lac4 R LacZ F LacZ R tGLC F tGLC R
GGGGGCGGCCGCATAGTTACTTGTTTAATTCTTCAAAAGAAGAGC GGGGGCGGCCGCGATGTTCACCCAACCAGGTCG GGGGGCGGCCGCCGGAGAAATTACCATTACATCATGGC GGGGGCGGCCGCGTATGAAGGTAGGTTTTAAGGAGGTG GGGGGCGGCCGCGGGTGTATGTAGAGGAGATCACC GGGGGCGGCCGCCATGGGAAGTTTGTGTGCACTGG GGGGGCGGCCGCTTCAACCCCATGCACATGGGG CTATGCCGATGATTAATTGTCAACACTAAGCGAGAACTTGTTCTTGTTTTTGATTC CCTTGTCGTATTATACTATGCCGATATACTATGCCGATGATTAATTGTCAACAC CCCCGTCGACTGGCCATGGTTTAGTTCCTCACCTTGTCGTATTATACTATGCCGATATAC GGGGGCGGCCGCAAGCTTACAGCGAGCACTCAAATC CTATGCCGATGATTAATTGTCAACACTATGTTGTTTGTAAGTGTGTTTTGTATC GGGGAGATCTGATCCTGCCAGTAGTCATATGC CCCCGCGGCCGCTGACTTGCGCTTACTAGGAATTCC GGGGGTCGACATGTCTTGCCTTATTCCTGAGAATTTAAG CCCCGTCGACTTATTCAAAAGCGAGATCAAACTCAAAGTTG GGGGGTCGACATGACCATGATTACGGATTCACTG CCCCGTCGACTTATTTTTGACACCAGACCAACTGG GGGGGTCGACGATACGTATCTTCTATACTGTATAGATG CCCCGGATCCTGTGGTAATTGCTTATGGGGTTTTTTAG
Verification primers
18S F2 18S R2
CAGCCACTGGTAACAGGATTAGC TAAGCCATTCAATCGGTAGTAGCG
qPCR
ori L1 ori P1 mal L1 mal P1
GTAACAGGATTAGCAGAGCGA CGCAGATACCAAATACTGTCCT AATACAGAGACTTGATGGTGGA ACATCAATCTTCTTGGTACCCT
Mutagenesis cassete
LOX-ZEO R
Fig. 1. Plasmids used for Cu/glcF strain construction. (a) pCuCRE. (b) pglc.
H. Bonková et al. / Journal of Biotechnology 189 (2014) 136–142 ˇ
139
(PNPG, Sigma–Aldrich, St. Louis, MO), and (B) o-nitrophenyl-galactoside (ONPG, Sigma–Aldrich, St. Louis, MO) as a chromogenic substrate. The reaction mixture contained (A) 800 l 6 mM PNPG, 199.5 l 50 mM Kx PO4 pH 6.0 and 0.5 l cell extract, and (B) 600 l Z buffer (100 mM Nax PO4 pH 7.0, 10 mM KCl, 1 mM MgSO4 ·7H2 O, 0.28% 2-mercaptoethanol), 200 l cell extract and 200 l ONPG (4 g dm−3 ). The reaction was performed for (A) 15 min at 37 ◦ C, and (B) 30 min at 28 ◦ C and stopped by addition of (A) 200 l, and (B) 400 l 1 M Na2 CO3 . The absorbance of mixtures was measured at (A) 405 nm, and (B) 420 nm. Protein concentrations were determined according to Bradford (1976). 2.8. Determination of plasmid copy number by quantitative PCR
Fig. 2. Plasmids used for characterization of maltase promoter region.
In order to estimate the number of chromosomally integrated plasmids pGLC-lacZ-d0∼d6 and pGAP-lacZ, qPCR on genomic DNA was performed. Primer pair ori L1/ori P1 was designed to amplify integrated plasmid (ori) and internal standardization was performed using a primer pair mal L1/mal P1 with homology to chromosomal sequence. The ratio ori/mal signals obtained from critical take off (Ct) values against log dilution was used to calculate copy number of incorporated heterologous DNA sequences relative to a resident chromosomal gene. 3. Results
R3 were designed to introduce EM7 synthetic prokaryotic constitutive promoter downstream of maltase regulatory region. Next, we amplified the coding region of yeast -galactosidase (GenBank M84410.1) with primers lac4F/lac4R from K. lactis genomic DNA and the E. coli -galactosidase (GenBank J01636.1) with primers lacZ F/lacZ R from E. coli BL21 genomic DNA. The 3-kb lac4 and lacZ inserts were cloned into SalI site of previous plasmid. The SalI restriction site on 3 terminus of -galactosidase gene sequence was eliminated using partial digestion with SalI and filling with T4 DNA polymerase for future easy handling with maltase promoter sequence. All plasmid DNAs after the amplification and subsequent cloning were verified by sequence analysis and the resultant plasmids were named pGLC-lac4 (9.8 kb) and pGLC-lacZd0, respectively. GAP gene promoter was amplified using primer pGAP F-NotI and sequentially primers pGAP R1 and pGLC R2 and R3 from C. utilis genomic DNA. Maltase promoter in pGLC-lac4 and pGLClacZ-d0 was replaced by 1-kb DNA fragment of amplified C. utilis GAP promoter via NotI/SalI restriction sites yielding in pGAP-lac4 and pGAP-lacZ plasmids, respectively. Various lengths of upstream regulatory regions of the maltase gene were obtained by PCR amplification using primers (pGLC F-d1∼d6) and primer pGLC R3. The full length upstream region of maltase gene in plasmid pGLC-lacZ-d0 was then replaced for shorter ones via NotI and SalI restriction sites, resulting in pGLC-lacZ-d1∼d6 plasmids (Fig. 2). The nucleotide sequence of all these constructs were verified by DNA sequence analysis. 2.7. Assay of (A) ˛-glucosidase and (B) ˇ-galactosidase enzyme activity Overnight cell cultures for the extract preparation were harvested by centrifugation, washed with distilled water and suspended in 0.3 ml of the breaking buffer containing (A) 1% SDS, 0.1 M NaCl, 0.01 M Tris–HCl pH 8.0 and 1 mM EDTA, and (B) 0.1 M Tris–HCl, pH 8.0, 1 mM DTT and 20% glycerol. Yeast cells were disrupted using acid-washed glass beads (Sigma–Aldrich, St. Louis, MO) by shaking (6 cycles of 30 s shaking and 60 s cooling) in a vortex mixer at maximum speed. Insoluble particles were removed by centrifugation and obtained clear cell extract was used in measurements of activity using (A) p-nitrophenyl-␣-d-glucopyranoside
3.1. Effect of carbon-sources on expression from maltase promoter Different carbon sources were tested to obtain data about repression and induction of the maltase gene transcription and also ability to grow on assayed carbon sources of both wild type C. utilis and mutated C. utilis with no maltase activity and integrated plasmid pGLC-lacZ-d0, namely Cu/glcF-lacZ. Transcription activity of the promoter region upstream of maltase gene was assayed by the level of the ␣-glucosidase or -galactosidase activity on chromogenic substrates and all experiments were performed at least in triplicate. Both strains were able to grow on fructose, glucose, mannose, cellobiose, sucrose, trehalose, raffinose, soluble starch, ethanol and glycerol. Both did not grow on arabinose, galactose, lactose, dextran, cellulose, methanol, manitol and sorbitol. Expectantly on maltose only wild type one was able to grow, but not Cu/glcF-lacZ. Only three of assayed carbon sources, namely maltose, cellobiose and soluble starch were recognised as the inducers. In order to identify the repressors of the maltase promoter, glucose, fructose, sucrose, raffinose, and glycerol were selected for combining. Except raffinose, all of them totally repressed the promoter activity, ergo the activity was as high as for non-inducers alone and it was about 6.3 pkat mg−1 . Data on repressive effect of raffinose on maltase promoter are presented in Table 3. 3.2. Maltase gene elimination in C. utilis using Cre-loxP recombination system The maltase gene was identified in genome sequence C. utilis NBRC 0988 (GenBank BAEL00000000.1) by aligning known nucleotide sequence of C. albicans maltase gene. Sequence analysis showed two open reading frames in opposite directions, corresponding to the maltase and maltose permease genes. The nucleotide sequence deduced from the C. utilis maltase gene exhibited 66% identity with maltase gene from C. albicans. In order to perform gene disruption efficiently, we applied the modified reusable marker Cre-loxP recombination system. Before introduction into C. utilis CCY 39-38-18 cell, the plasmid pglc containing mutagenic cassette was digested with HindIII. Correct integration
140
H. Bonková et al. / Journal of Biotechnology 189 (2014) 136–142 ˇ
Fig. 3. Verification of maltase disruption and marker excision by PCR using primers L2/P1 and schematic representation of C. utilis maltase gene alleles: (A) wild-type allele (3.3-kb PCR product); (B) allele with the zeocin expression cassette replacing the maltase gene and promoter (2.5-kb product); (C) disrupted allele resulting from Cre-recombination (1.2-kb product).
Table 3 Regulation of maltase promoter in C. utilis wild-type strain and maltase deletion mutant carrying plasmid pGLC-lacZ-d0. Minimal media containing 2% carbon sources were used for cultivation. Carbon source
Activity of ␣-glucosidase (nkat mg−1 ) + Raffinose
C. utilis wild-type Cellobiose Maltose Soluble starch Carbon source
135.4 81.7 61.4
51.7 10.0 15.7
Activity of -galactosidase (nkat.mg−1)+ raffinosecellobiose0.410.19maltose mg−1 ) + Raffinose
Cu/glcF-lacZ Cellobiose Maltose
0.41 0
0.19 0.18
was verified by plasmid isolation and subsequent transformation and selection of the E. coli DH5␣ cells on kanamycin media. All of assayed clones contained plasmid pCuCRE. One of these clones was named Cu/glcG and after the selection on G418 passaged in liquid media without any antibiotics and then plated on agar plates in convenient dilution to obtain single colonies. Several tenths of clones were assayed on plates with either G418 and zeocin and no one conferred resistance to either one of them even when only one day passage was used. When culture was plated only after 3 generations, 16% of cells conferred resistance to G418, but no one to zeocin. Employing PCR using primers L2/P1 it was possible to obtain only 1.2-kb product (Fig. 3) that corresponded to mutated allele without determinant for zeocin resistance. No one of verified strains conferred ␣-glucosidase activity in minimal cellobiose medium. One of these strains was designated Cu/glcF and used for all further manipulations. 3.3. Maltase promoter activity
of gene disruption cassette was confirmed by both enzyme activity and PCR using primers L2/P1 located outside the left or right flanking homology arm, respectively. Employing PCR it was possible to observe either wild type 3.3-kb PCR product or both wild type with mutated one (3.3-kb and 2.5-kb fragments). The presence of clones with both products suggests the presence of multiple maltase alleles, at least two. The frequency of the clones with both PCR products was below 20%. Nevertheless, when we used for transformation digested plasmid with blunt termini we observed correct integration in almost all the examined strains. The concentration of antibiotic also plays quite important role on efficiency in obtaining correct clones. We used various zeocin concentrations (from 0.03 g dm−3 to 4 g dm−3 ) and the most effective concentration was recognized 0.3 g dm−3 . The wild type clone reached the ␣-glucosidase activity about 81.7 nkat mg−1 , whereas the activity in mutated ones oscillated around 50% with few exception (under the 10%) around 70–80% and 20–30% of the wild type one. In order to obtain the strain only with one 2.5-kb large PCR product, additional mutagenesis had to be performed. One strain with the activity about half of wild type one was chosen to be retransformed with mutation cassette of pglc plasmid. In this phase of experiments, the most effective zeocin concentration for correct clone’s acquisition was recognized 1 g dm−3 . It was possible to achieve almost 20% clones with inability to grow on maltose as the carbon source. All of them had only one PCR product with size of 2.5-kb corresponding to mutated one. One of these clones, designated Cu/glcZ, was transformed with replicative plasmid pCuCRE to eliminated determinant for zeocin resistance. The presence of the plasmid in selected clones that conferred resistance to G418
In order to study the regulation and strength of maltase promoter, Cu/glcF strain with functionless maltase gene was transformed with plasmid pGLC-lac4, carrying -galactosidase from K. lactis, linearized with SacII. The correct integration of the plasmid was confirmed by PCR with primers 18S F2/R2. Minimal cellobiose medium was chosen for -galactosidase assay, because the maltase promoter was activated by this inductor to highest levels (Table 3). However, any lac4 expression, ergo -galactosidase activity could not be detected from any clone. As the activity could not be detected either even from constitutive promoter of C. utilis GAP gene, employing plasmid pGAP-lac4, it was possible to conclude that lac4 gene did not express in yeast C. utilis at detectable levels. Under these circumstances, plasmids pGLC-lacZ-d0 and pGAP-lacZ, which carried E. coli lacZ gene, were constructed. Both plasmids were successfully introduced into the Cu/glcF 18S rDNA and E. coli lacZ gene was expressed intracellularly from both GAP and maltase promoters in C. utilis, what could be readily detected by -galactosidase activity in cell extracts and undetectable activity in media (data not shown). In order to localize the minimum-length promoter region for the maximum transcription level, several deletion mutants of the promoter region were constructed. As a control sequence was taken an intergenic region between maltase and maltose permease genes. The region and its deletion derivatives (d0-d6) were functionally connected with lacZ gene in plasmids pGLC-lacZ-d0∼d6. It was possible to observe that deletion d6 had elimination effect on promoter. Additional two deletions decreased expression level of the -galactosidase by 40% and deletion d3 is the shortest one
H. Bonková et al. / Journal of Biotechnology 189 (2014) 136–142 ˇ
141
Fig. 4. Diagram showing the zeocin resistance level (g dm−3 ) and the ori/mal ratio, which represents plasmid copy number of selected Cu/glcF-lacZ clones, carrying plasmids pGLC-lacZ-d0 (1, 5, 6, 7), pGLC-lacZ-d1 (2, 3, 4, 8) or pGAP-lacZ (9, 10), relative to a maltase gene. Table 4 -Galactosidase activities of transformants having various lengths of the maltase promoter. Medium data of three to four distinct transformants are shown. Standard deviation was less than 20%. Final values of -galactosidase activity are standardize to the same plasmid copy number according to data obtained by qPCR method.
Length of promoter (bp) -Galactosidase activity (nkat mg−1 )
pGLC-lacZ-d0
pGLC-lacZ-d1
pGLC-lacZ-d2
pGLC-lacZ-d3
pGLC-lacZ-d4
pGLC-lacZ-d5
pGLC-lacZ-d6
2370 0.343
1770 0.327
1627 0.337
1467 0.343
1327 0.215
1151 0.203
577 Below detection
with no lost in transcriptional activity (Table 4). During activity calculation, relative copy number were taken into the consideration as it is described below. Relative values of plasmid copy number were estimated by qPCR using primers ori L1/ori P1 to amplify integrated plasmid (ori) and primer set mal L1/mal P1 with homology to chromosomal sequence (mal). When comparing the ori/mal ratios with the expression levels of the different clones it was obvious that there is a correlation between gene dosage and recombinant protein expression level. The linear regression correlation coefficient (R2 ) for 11 selected clones was 0.9984. Several clones did not fit the linearity and in this cases found copy numbers were always higher than the expectable one taking into the consideration measured -galactosidase activity. The highest value of achieved activity for maltase promoter was approximately 4-times higher than the lowest one, and it was 1.3 nkat mg−1 per 3.86 relative copies. Nevertheless, the activities reached for GAP promoter were usually higher, whereby the numbers did not change linear regression correlation coefficient, significantly. The highest measured activity was reached for GAP promoter with relative copy number of about 39.7 and -galactosidase activity of about 18.6 nkat mg−1 . When calculated for one relative copy, the activity for the maltase promoter is about 0.34 nkat mg−1 and for GAP 0.47 nkat mg−1 . The qPCR data also showed, as expected, that plasmid copy number increases with elevated resistance towards zeocin (Fig. 4). 4. Discussion Within the meaning of given information including introduction, it appears that C. utilis tends to be prominent expression host for production of recombinant proteins of many interests. As the molecular genetics of C. utilis is not well understood up to now, this study is trying to contribute to the knowledge about gene expression regulation and its possibilities to use it for recombinant protein expression in C. utilis. Promoter region of maltase gene was chosen because of its induction possibilities that were described before (Rolim et al., 2003). In spite of a fact that natural inductor of maltase promoter is maltose, two other inductors were found out, soluble starch and cellobiose. Cellobiose, compared to maltose and starch, does not
contain ␣(1 → 4) bonds, but (1 → 4), and interestingly the activities of ␣-glucosidase for cellobiose were approximately twice as high as for maltose. The reason is so far unclear. As the activity of the ␣-glucosidase was not detected for Cu/glcF in minimal cellobiose medium and -galactosidase activity could be detected in Cu/glcF-lacZ, it can be concluded that cellobiose is real inductor of maltase promoter, and that is not secondary activity of different glycosidase induced by cellobiose. Moreover the strain Cu/glcF grew on cellobiose, what could mean that cellobiose induced glycosidase is able to cleave cellobiose (1 → 4) bond. Nevertheless, polysaccharide cellulose, with the same bond between glucoses, was not utilized by C. utilis. Probably mentioned glycosidase is intracellular and the cellulose need some special transporter. Analogical situation was observed for lactose, which is a natural substrate for -galactosidase. Cu/glcF-lacZ were not able to utilize this disaccharide even in combination with maltose as the inductor of maltase promoter. A similar phenotype has been noticed for C. albicans (Uhl and Johnson, 2001) and S. cerevisiae (Sreekrishna and Dickson, 1985), and expression of a lactose permease was necessary before lactose could be utilized as a carbon source. The zeocin resistance gene was fully function in C. utilis even it was used with transcriptional promoter and terminator sequences from P. pastoris. According to our knowledge, this is the first application of zeocin as a selectable marker in C. utilis. Compared with the previously reported method using Cre-loxP system for C. utilis, where four cycles of mutagenesis had to be performed to obtain null mutant (Ikushima et al., 2009a), our strategy helps to reduce the number of steps to two. However, acquisition of a null mutant clone after single transformation with mutation cassette was practically impossible. Tenths of clones were assayed without any success even the highest concentration of zeocin was used. Probably the capacity in number of molecules which can enter the cell during electroporation is limited. The process of homological recombination occurs afterword the electroporation with definite number of molecules. Once one double homological recombination occurs and wild type allele is replaced, this place itself is much more likely target for homological recombination than other wild type allele. If on additional wild type replacement occurs the probability of self-change increases and change of next wild type allele
142
H. Bonková et al. / Journal of Biotechnology 189 (2014) 136–142 ˇ
decreases. Simultaneously with this, number of free mutation cassettes are become lower not only by inserting into the chromosome, but also by action of nucleases. Probably combination of described hypothesis, time, nucleases and number of screened clones made impossible to find null mutant after the single transformation. Our analysis of genome sequence C. utilis NBRC 0988 (GenBank BAEL00000000.1) indicates that the intergenic region between the structural genes for C. utilis maltase and maltose permease is 2370 bp long. The length of respective sequence for example in case of Saccharomyces carlsbergensis is 884 bp (Hong and Marmur, 1986). A systematic deletion analysis revealed that the region up to 1467 nt upstream of translation initiation codon of maltase gene should harbour all elements essential for full transcriptional capacity of the C. utilis maltase promoter. In contrast, H. polymorpha maltase promoter length of approximately 315 bp was sufficient for similar regulation as the full length promoter (Alamäe et al., 2003). Comparing with C. utilis, even longer promoter (577-bp) conferred undetectable levels of -galactosidase activity. The qPCR based method presented here offers a convenient and reliable means of characterizing recombinant C. utilis clones and could be included in the standard protocols when screening for multi-copy transformants. Since the primers used are designed to amplify a part of the vector sequence rather than the specific gene, it is generic for all constructs based on the pUC ori vector. Due to an unclear question of C. utilis ploidy, we could not definitely specify the absolute values of integrated plasmid copy number, thus we present only the ratios of integrated plasmid relative to a resident chromosomal gene (maltase gene). For clones with integrated pGAP-lacZ relative copy number oscillated around higher values than for clones with integrated pGLC-lacZ-d0. In C. utilis Cu/glcF strain promoter region of maltase gene has been deleted, but not GAP promoter. The presence of additional homological sequence makes higher probability for pGAP-lacZ to integrate into the chromosome in more copies than for pGLC-lacZ-d0. It is remarkable that the strength of the maltase promoter under cellobiose induction is quite comparable to the strength of the constitutive GAP promoter, which is known to be one of the most highly expressed genes in yeast. These results strongly suggest that the maltase promoter might find application for the design of expression systems to produce the protein of interest. Therefore it could be used like the inducible promoters for the regulated production of proteins that might be toxic to the cell. Summing up, cre-loxP system in combination with the zeocin as a reusable marker appears to be powerful method not only to disrupt C. utilis gene without additional selection marker, but it can also be used in finding clones with multi-inserted expression cassette. A screen for multiple copy integrants via qPCR could become a part of the routine optimization strategy when overexpressing recombinant proteins in this host. Acknowledgments We would like to thank Dr. Iwakiri for kindly providing pRI135 and pRI385 vectors and we also thank Dr. Ikushima for
helpful advice. This work is result of project implementation: “Industrial research of the new agents based on recombinant proteins” (ITMS 26240220034) supported by the Research and Development Operational Program funded by the ERDF and also supported by grant of Slovak research and development agency APVV-0119-12. References Alamäe, T., Pärn, P., Viigand, K., Karp, H., 2003. Regulation of the Hansenula polymorpha maltase gene promoter in H. polymorpha and Saccharomyces cerevisiae. FEMS Yeast Res. 4, 165–173. Boze, H., Moulin, G., Galzy, P., 1992. Production of food and fodder yeasts. Crit. Rev. Biotechnol. 12, 65–86. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Anal. Biochem. 72, 248–254. Buerth, C., Heilmann, C.J., Klis, F.M., de Koster, C.G., Ernst, J.F., Tielker, D., 2011. Growth-dependent secretome of Candida utilis. Microbiology 157, 2493–2503, http://dx.doi.org/10.1099/mic.0. 049320-0. Hong, Y.R., Chen, Y.L., Farh, L., Yang, W.J., Liao, C.H., Shiuan, D., 2006. Recombinant Candida utilis for the production of biotin. Appl. Microbiol. Biotechnol. 71, 211–221. Hong, S.H., Marmur, J., 1986. Primary structure of the maltase gene of the MAL6 locus of Saccharomyces carlsbergensis. Gene 41, 75–84. Ikushima, S., Fujii, T., Kobayashi, O., Yoshida, S., Yoshida, A., 2009a. Genetic engineering of Candida utilis yeast for efficient production of l-lactic acid. Biosci. Biotechnol. Biochem. 73, 1818–1824. Ikushima, S., Fujii, T., Kobayashi, O., 2009b. Efficient gene disruption in the high-ploidy yeast Candida utilis using the Cre-loxP system. Biosci. Biotechnol. Biochem. 73, 879–884. Iwakiri, R., Eguchi, S., Noda, Y., Adachi, H., Yoda, K., 2005. Isolation and structural analysis of efficient autonomously replicating sequences (ARSs) of the yeast Candida utilis. Yeast 23, 1049–1060. Kondo, K., Miura, Y., Sone, H., Kobayashi, K., Iijima, H., 1997. High-level expression of a sweet protein, monellin, in the food yeast Candida utilis. Nat. Biotechnol. 15, 453–457. Marx, H., Mattanovich, D., Sauer, M., 2008. Overexpression of the riboflavin biosynthetic pathway in Pichia pastoris. Microb. Cell Fact. 7, 23, http://dx.doi.org/10.1186/1475-2859-7-23. Miura, Y., Kondo, K., Saito, T., Shimada, H., Fraser, P.D., Misawa, N., 1998. Production of the carotenoids lycopene, beta-carotene, and astaxanthin in the food yeast Candida utilis. Appl. Environ. Microbiol. 64, 1226–1229. Miura, Y., Kettoku, M., Kato, M., Kobayashi, K., Kondo, K., 1999. High level production of thermostable alpha-amylase from Sulfolobus solfataricus in high-cell density culture of the food yeast Candida utilis. J. Mol. Microbiol. Biotechnol. 1, 129–134. Rolim, M.F., de Araujo, P.S., Panek, A.D., Paschoalin, V.M., Silva, J.T., 2003. Shared control of maltose and trehalose utilization in Candida utilis. Braz. J. Med. Biol. Res. 6, 829–837. Rose, M.D., Winston, F.M., Heiter, P., 1990. Methods in yeast genetics: a laboratory course manual. Cold Spring Harbor, New York. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor, New York. Sreekrishna, K., Dickson, R.C., 1985. Construction of strains of Saccharomyces cerevisiae that grow on lactose. Proc Natl Acad Sci U S A 82, 7909–7913. Tomita, Y., Ikeo, K., Tamakawa, H., Gojobori, T., Ikushima, S., 2012. Genome and transcriptome analysis of the food-yeast Candida utilis. PLoS One 7, e37226, http://dx.doi.org/10.1371/journal.pone.0037226. Uhl, M.A., Johnson, A.D., 2001. Development of Streptococcus thermophilus lacZ as a reporter gene for Candida albicans. Microbiology 147, 1189–1195. Wei, W., Hong-Lan, Y., Huifang, B., Daoyuan, Z., Qi-Mu-Ge, S., Wood, A.J., 2010. The effective expression of xylanase gene in Candida utilis by 18S rDNA targeted homologous recombination in pGLR9K. Mol. Biol. Rep. 37, 2615–2620. Yanisch-Perron, C., Vieira, J., Messing, J., 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequence of the M13mp18 and pUC19 vectors. Gene 33, 103–119.
