.::) 1992 Oxford University Press
Nucleic Acids Research, Vol. 20, No. 11 2735-2739
Uranyl photofootprinting of triple helical DNA Peter E.Nielsen Research Center for Medical Biotechnology, Department of Biochemistry B, The Panum Institute, Blegdamsvej 3 c, 2200 Copenhagen N, Denmark Received March 4, 1992; Revised and Accepted April 24, 1992
ABSTRACT Two triple helix structures (1 5-mers containing only T * A-T triplets or containing mixed T * A-T and C * G-C triplets) have been studied by uranyl mediated DNA photocleavage to probe the accessibility of the phosphates of the DNA backbone. Whereas the phosphates of the pyrimidine strand are at least as accessible as in double stranded DNA, in the phosphates of the purine strand are partly shielded and more so at the 5'-end of the strand. With the homo A/T target increased cleavage is observed towards the 3'-end on the pyrimidine strand. These results show that the third strand is asymmetrically positioned along the groove with the tightest triple strand double strand interactions at the 5'-end of the third strand. The results also indicate that homo-A versus mixed A/G 'Hoogsteen-triple helices' have different structures. INTRODUCTION Recent years have revived the interest in triple helical DNA structures due to their occurence in natural DNA sequence-at least in vitro-(1 -4) as well as the prospect of developing DNA sequence targetted drugs based on triple helical DNA recognition (5-19). Structural information on DNA triple helices has been obtained from X-ray fiber diffraction (20-2 1), NMR (22-24) and various chemical probing techniques (2-4). These results have shown that at least two non-compatible triple helix structures exist exploiting the four natural nucleobases, adenine (A), cytosine (C), guanine (G) and thymine (T). In the one structure formed at homopurine homopyrimidine sequences, the third strand is composed of pyrimidines which bind in the major groove of the double helical DNA such that T binds to A of an AT base pair, while protonated C binds to G of a GC base pair both by Hoogsteen base pairing (25). Furthermore, the two pyrimidine strands have anti-parallel orientation and the double helix adopts an A-like conformation. In the other structure formed at oligoG sequences, the third strand is also oligo-G which forms hydrogen bonds to G of a GC base pair and which is anti-parallel to the G-strand of the double helix (2,10). We have recently found that the accessibility (/electronegativity) of the phosphates in DNA can be probed by uranyl mediated DNA photocleavage (26-29). Using this technique we have now probed the accessibility (/electronegative potential) of the
phosphates of the Watson-Crick strands of two Hoogsteen-type triple helices, and we find reduced phosphate accessibility of the purine strand, in particular at the 5'-end.
MATERIALS & METHODS Oligonucleotides were synthesized by standard phosphoamidite chemistry on a Biosearch 7500 DNA synthesizer. Complementary oligonucleotides with BamHI/Hindll 'sticky ends' were ligated to pUC19 cleaved with BamHI and HindlU and used for transformation of E.coli JM103 using standard techniques (30). Plasmid DNA was purified by density boyant centrifugation in CsCl. Plasmid containing the A5(AG)5 target was designated pTHa, while plasmid containing the A15 target was designated pTHe. A plasmid designated pTH2 containing two (A/T)15 targets in opposite orientation was obtained by ligation of two complementary oligonucleotides (GATCA15 & GATCT15) with BamHl overhang into pUC 19 cleaved with BamHl. DNA fragments for footprinting were prepared by 3'-32pendlabeling of the EcoRI/PvuH treated pTH plasmid using a[32P]-dATP (Amersham, 3000 Ci/mmol) and the Klenow E.coli DNA polymerase fragment (BRL-Gibco), or by 5'-32pendlabeling of EcoRI/alkaline phosphatase treated pTH plasmid (purified by gel electrophoresis in low melting agarose) using 'y[32P]ATP (Amersham, > 5000 Ci/mmol) and T4-polynucleotid kinase (BRL-Gibco) followed by treatment with Pvull. The fragment containing the insert (the large EcoRllPvuH fragment) was purified by gel electrophoresis in 5 % polyacrylamide/TBE (90 mM Tris-borate, pH 8.3, 1 mM EDTA) buffer, extracted with 0.5 M NH4-acetate, 1 mM EDTA and precipitated in 66% ethanol. Triple helix complexes were formed by mixing 500 cps of pTH fragment with 15 yg of oligonucleotide in 80 AI buffer (10 mM Tris-HCl, pH 7.4, 1 mM spermidine, 100 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, 40% ethylene glycol). (Upon addition of U02(NO3)2 to 1 mM to this buffer, the pH decreased to 6.4). The sample was heated to 37°C for 5 min, cooled to room temperature (10 min) and then put on ice (10 min). For DNase I footprinting, 20 IA DNAse I (Boehringer Mannheim, grade I; 1 jig/ml) was added, the reaction was stopped after 5 min (on ice) by addition of 3 !d 0.5 M EDTA, and the DNA was precipitated with 250 Al 2% K-acetate in ethanol. For uranyl photofootprinting, 20 iul 5 mM uranyl nitrate (freshly diluted from a 100 mM stock solution in H20) was added, and the sample
2736 Nucleic Acids Research, Vol. 20, No. 11
(contained in an Eppendorf tube) was irradiated from above with light from a Philips TL 40W/03 fluorescent light tube (X -420 nm, 30 nm band width, 20 J-m-2 s-1). The DNA was precipitated with 250 Al ethanol after addition of 20 ul 0.5 M Na-acetate, pH 4.5. The DNA was taken up in 4 IL 80% formamide/TBE buffer and analysed by high resolution gel electrophoresis (10% acrylamide (0.33% bisacrylamide), 7 M urea, TBE buffer) followed by autoradiography (intensifying screen, Agfa curix RP1 X-ray film, -70°C). The autoradiographs were scanned with a Molecular Dynamics laser densitometry scanner.
1 5' . AGC. 4'"'CCATAGCC 3'. TAGCTTATATATAA~.ILGTAT''' 35 ....TC ....
5'TTTTTCTCTCTCTCT . AGCTTATATATATATAAAAAGAGAGAGAGATCGATAGGTC
3'.... ..TCGAATATATATATATTTTTCTCTCTCTCTAGCTATCCTAG
m 5' 3'..
DISCUSSION Two triple helix structures consisting of 15 triplets were examined RESULTS
GATCTTTTTTTTTTT5STGATCA AAAAAAAAAAACTC wTTTTTTCTAG T T CTAGAAAAAAAAAAAAACTAGTTTTTT
(Figure 1). The dsDNA targets were constructed by cloning the appropriate oligonucleotides into the BamHI/Hindll sites of pUCl9. The one target is identical to that used by Moser and
Figure 1. Sequences of the triple helix targets and 3rd strand oligonucleotides (I - pTHe, II - pTHa & III - pTH2).
0,11 'IN,
~~~1.) 1)1V 1 23 4 5 6
I.
1.
0
0
0 5 6
&
-
12
) t4 1'5 \
I
2 3 4 5 0,
0
1,
I
2
iR
4
6.(
1) 1) 1
1
% 1
1 2 3 4 5 6
p 3 F.
.......s
~
4s^:
£
.
-
}:';
i ....:
-
I4:
oW2
.;;a
I
3 W.2 4.
... 10
.:...
40
.:.-
a
*1
49
M
:_.
s.0 ,:..
.s.
0 .40
.p
.62
'
*
_f
f22
0
..
U.,.
lb.-
4,.4
4p
l.*
0 i.
6 A. -
.-
-
Aul
Figure 2. Footprints of DNA triple helices. a: 3'-labeled pTHe (EcoRI/PvuII) fragment and dT,5 oligonucleotide. b: 3'-labeled pTHa fragment and d[T5(CT)5J oligonucleotide. c: 5'-labeled pTHe fragment and dT15 oligonucleotide. d: 5'-labeled pTHa fragment and d[T5(CT)5] oligonucleotide. e: 3'-labeled pTH2 fragment and dT,5 oligonucleotide. Lanes D are DNase I footprints and lanes U are uranyl photofootprints. (+) denotes that third strand oligonucleotide is present and (-) that no oligonucleotide is present. Lanes 6 are A+G sequence markers while lanes I are no treatment controls.
Nucleic Acids Research, Vol. 20, No. 11 2735-2739
Uranyl photofootprinting of triple helical DNA Peter E.Nielsen Research Center for Medical Biotechnology, Department of Biochemistry B, The Panum Institute, Blegdamsvej 3 c, 2200 Copenhagen N, Denmark Received March 4, 1992; Revised and Accepted April 24, 1992
ABSTRACT Two triple helix structures (1 5-mers containing only T * A-T triplets or containing mixed T * A-T and C * G-C triplets) have been studied by uranyl mediated DNA photocleavage to probe the accessibility of the phosphates of the DNA backbone. Whereas the phosphates of the pyrimidine strand are at least as accessible as in double stranded DNA, in the phosphates of the purine strand are partly shielded and more so at the 5'-end of the strand. With the homo A/T target increased cleavage is observed towards the 3'-end on the pyrimidine strand. These results show that the third strand is asymmetrically positioned along the groove with the tightest triple strand double strand interactions at the 5'-end of the third strand. The results also indicate that homo-A versus mixed A/G 'Hoogsteen-triple helices' have different structures. INTRODUCTION Recent years have revived the interest in triple helical DNA structures due to their occurence in natural DNA sequence-at least in vitro-(1 -4) as well as the prospect of developing DNA sequence targetted drugs based on triple helical DNA recognition (5-19). Structural information on DNA triple helices has been obtained from X-ray fiber diffraction (20-2 1), NMR (22-24) and various chemical probing techniques (2-4). These results have shown that at least two non-compatible triple helix structures exist exploiting the four natural nucleobases, adenine (A), cytosine (C), guanine (G) and thymine (T). In the one structure formed at homopurine homopyrimidine sequences, the third strand is composed of pyrimidines which bind in the major groove of the double helical DNA such that T binds to A of an AT base pair, while protonated C binds to G of a GC base pair both by Hoogsteen base pairing (25). Furthermore, the two pyrimidine strands have anti-parallel orientation and the double helix adopts an A-like conformation. In the other structure formed at oligoG sequences, the third strand is also oligo-G which forms hydrogen bonds to G of a GC base pair and which is anti-parallel to the G-strand of the double helix (2,10). We have recently found that the accessibility (/electronegativity) of the phosphates in DNA can be probed by uranyl mediated DNA photocleavage (26-29). Using this technique we have now probed the accessibility (/electronegative potential) of the
phosphates of the Watson-Crick strands of two Hoogsteen-type triple helices, and we find reduced phosphate accessibility of the purine strand, in particular at the 5'-end.
MATERIALS & METHODS Oligonucleotides were synthesized by standard phosphoamidite chemistry on a Biosearch 7500 DNA synthesizer. Complementary oligonucleotides with BamHI/Hindll 'sticky ends' were ligated to pUC19 cleaved with BamHI and HindlU and used for transformation of E.coli JM103 using standard techniques (30). Plasmid DNA was purified by density boyant centrifugation in CsCl. Plasmid containing the A5(AG)5 target was designated pTHa, while plasmid containing the A15 target was designated pTHe. A plasmid designated pTH2 containing two (A/T)15 targets in opposite orientation was obtained by ligation of two complementary oligonucleotides (GATCA15 & GATCT15) with BamHl overhang into pUC 19 cleaved with BamHl. DNA fragments for footprinting were prepared by 3'-32pendlabeling of the EcoRI/PvuH treated pTH plasmid using a[32P]-dATP (Amersham, 3000 Ci/mmol) and the Klenow E.coli DNA polymerase fragment (BRL-Gibco), or by 5'-32pendlabeling of EcoRI/alkaline phosphatase treated pTH plasmid (purified by gel electrophoresis in low melting agarose) using 'y[32P]ATP (Amersham, > 5000 Ci/mmol) and T4-polynucleotid kinase (BRL-Gibco) followed by treatment with Pvull. The fragment containing the insert (the large EcoRllPvuH fragment) was purified by gel electrophoresis in 5 % polyacrylamide/TBE (90 mM Tris-borate, pH 8.3, 1 mM EDTA) buffer, extracted with 0.5 M NH4-acetate, 1 mM EDTA and precipitated in 66% ethanol. Triple helix complexes were formed by mixing 500 cps of pTH fragment with 15 yg of oligonucleotide in 80 AI buffer (10 mM Tris-HCl, pH 7.4, 1 mM spermidine, 100 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, 40% ethylene glycol). (Upon addition of U02(NO3)2 to 1 mM to this buffer, the pH decreased to 6.4). The sample was heated to 37°C for 5 min, cooled to room temperature (10 min) and then put on ice (10 min). For DNase I footprinting, 20 IA DNAse I (Boehringer Mannheim, grade I; 1 jig/ml) was added, the reaction was stopped after 5 min (on ice) by addition of 3 !d 0.5 M EDTA, and the DNA was precipitated with 250 Al 2% K-acetate in ethanol. For uranyl photofootprinting, 20 iul 5 mM uranyl nitrate (freshly diluted from a 100 mM stock solution in H20) was added, and the sample
2736 Nucleic Acids Research, Vol. 20, No. 11
(contained in an Eppendorf tube) was irradiated from above with light from a Philips TL 40W/03 fluorescent light tube (X -420 nm, 30 nm band width, 20 J-m-2 s-1). The DNA was precipitated with 250 Al ethanol after addition of 20 ul 0.5 M Na-acetate, pH 4.5. The DNA was taken up in 4 IL 80% formamide/TBE buffer and analysed by high resolution gel electrophoresis (10% acrylamide (0.33% bisacrylamide), 7 M urea, TBE buffer) followed by autoradiography (intensifying screen, Agfa curix RP1 X-ray film, -70°C). The autoradiographs were scanned with a Molecular Dynamics laser densitometry scanner.
1 5' . AGC. 4'"'CCATAGCC 3'. TAGCTTATATATAA~.ILGTAT''' 35 ....TC ....
5'TTTTTCTCTCTCTCT . AGCTTATATATATATAAAAAGAGAGAGAGATCGATAGGTC
3'.... ..TCGAATATATATATATTTTTCTCTCTCTCTAGCTATCCTAG
m 5' 3'..
DISCUSSION Two triple helix structures consisting of 15 triplets were examined RESULTS
GATCTTTTTTTTTTT5STGATCA AAAAAAAAAAACTC wTTTTTTCTAG T T CTAGAAAAAAAAAAAAACTAGTTTTTT
(Figure 1). The dsDNA targets were constructed by cloning the appropriate oligonucleotides into the BamHI/Hindll sites of pUCl9. The one target is identical to that used by Moser and
Figure 1. Sequences of the triple helix targets and 3rd strand oligonucleotides (I - pTHe, II - pTHa & III - pTH2).
0,11 'IN,
~~~1.) 1)1V 1 23 4 5 6
I.
1.
0
0
0 5 6
&
-
12
) t4 1'5 \
I
2 3 4 5 0,
0
1,
I
2
iR
4
6.(
1) 1) 1
1
% 1
1 2 3 4 5 6
p 3 F.
.......s
~
4s^:
£
.
-
}:';
i ....:
-
I4:
oW2
.;;a
I
3 W.2 4.
... 10
.:...
40
.:.-
a
*1
49
M
:_.
s.0 ,:..
.s.
0 .40
.p
.62
'
*
_f
f22
0
..
U.,.
lb.-
4,.4
4p
l.*
0 i.
6 A. -
.-
-
Aul
Figure 2. Footprints of DNA triple helices. a: 3'-labeled pTHe (EcoRI/PvuII) fragment and dT,5 oligonucleotide. b: 3'-labeled pTHa fragment and d[T5(CT)5J oligonucleotide. c: 5'-labeled pTHe fragment and dT15 oligonucleotide. d: 5'-labeled pTHa fragment and d[T5(CT)5] oligonucleotide. e: 3'-labeled pTH2 fragment and dT,5 oligonucleotide. Lanes D are DNase I footprints and lanes U are uranyl photofootprints. (+) denotes that third strand oligonucleotide is present and (-) that no oligonucleotide is present. Lanes 6 are A+G sequence markers while lanes I are no treatment controls.
