Molecular Immunology, Vol. 29, No. 2, pp. 193-203, 1992 Printed in Great Britain.

0161-X390/92 $5.00 + 0.00 0 1992 Pergamon Press plc

USE OF FAMILY SPECIFIC LEADER REGION PRIMERS FOR PCR AMPLIFICATION OF THE HUMAN HEAVY CHAIN VARIABLE REGION GENE REPERTOIRE MICHAEL J. CAMPBELL,* ANDREW D. ZELENETZ, SHOSHANALEVY and RONALD LEVY Stanford University

School of Medicine, Department of Medicine, Division of Oncology, M207, Stanford, CA 94305-5306, U.S.A.

(First received 15 February 1991; accepted in revised form 27 May 1991)

Abstract-We have designed a set of six, non-degenerate

oligonucleotide primers, corresponding to the 5’ leader regions of each of the six human V, gene families. A general strategy for family specific polymerase chain reaction amplification is described using these primers and a conserved 3’ primer corresponding to frame work 3, J,, or constant region. This strategy was used to isolate and sequence novel human germline VH genes belonging to the V,2 and V,4 families. Under certain conditions, chimeric V, sequences were created by a “jumping polymerase chain reaction”, combining DNA segments from different germline genes, but this could be avoided by limiting the number of amplification cycles. PCR amplification with these family specific primers will facilitate studies of the repertoire of germline V, genes as well as studies on V, gene usage in normal and aberrant (B cell malignancies, autoimmune diseases, etc.) B cell populations.

INTRODUCTION Immunoglobulin heavy chain genes are produced by the rearrangement of variable, diversity and joining regions (V,, D and J,, respectively). The repertoire of immunoglobulin diversity is determined by the number of germline V,, D and J, segments, the random combination of these segments, and the hypermutation of these rearranged genes. In humans, there are an estimated 100-200 V, germline genes which can be divided into six families based on amino acid or nucleotide sequence similarity (Kabat et al., 1987; Berman et al.,

1988). Members of a given family are greater than 80% identical at the nucleotide level. Sequences of Ig variable region genes are of interest from a number of perspectives. They provide a foundation upon which studies on the molecular basis of antibody interactions (antigen-antibody, idiotypeanti-idiotype, etc.) are built. They are necessary for the production of chimeric antibodies for use as therapeutics. These sequences are also useful in studies on V gene usage in a variety of pathological conditions (B cell malignancies, autoimmune diseases, etc.). Several methods for cloning and sequencing Ig V regions have been described. These include direct mRNA sequencing (Kaartinen et al., 1983), cDNA synthesis followed by subcloning into sequencing vectors (Levy et al., 1987) and polymerase chain reaction (PCR) based strategies. A universal method of PCR amplifying human V, genes

for all conceivable purposes would need to fulfill the following criteria: (1) ability to amplify from either DNA or RNA/cDNA; (2) yield a complete, full length leaderintron-variable region (from DNA) or leader-variable region (from RNA+DNA) sequence; and (3) allow rapid, facile identification of V, gene family usage in a given B cell clone. Several groups have described PCR based strategies for isolating human V, genes (Akahori et al., 1990; Brisco et al., 1990; Carroll et al., 1989; Cuisinier et al., 1990; Deane and Norton, 1990; Larrick et al., 1989; Kipps et al., 1989; Sanz et al., 1989; Van der Heijden et al., 1990; Yamada et al., 1989), however, none of these previously reported methods fulfill all of the above criteria. We have designed six non-degenerate primers (designated V, 1-ldr through to V,6-ldr) which are homologous to conserved areas at the five prime end of the leader sequences for each of the six human IgH V gene families. These primers are useful for general amplification of V, genes from either DNA or RNAcDNA, yield full length sequences, and since they are family specific, they allow easy identification of V, gene family usage in a given B cell clone. In this report we demonstrate the specificity of each primer for its respective V, family and we use these primers to specifically amplify and isolate germline V, genes from a given family. By doing so, we have identified new members of the V, 2 and V,4 families. MATERIALS AND METHODS

*Author to whom correspondence

should he addressed. PCR, polymerase chain reaction; TE, 1OmM Tris-1 mM EDTA; V,-ldr, heavy chain leader region oligonucleotide primer; V,-FR3, heavy chain framework 3 consensus oligonucleotide primer.

Abbreviations:

Plasmids

Plasmid 51PlJ, which contains a V, 1 cDNA insert, was kindly provided by H. W. Schroeder and R. M. Perlmutter. Plasmids 9-1, 1.911, 5-1Rl and 6-lR1, which 193

194

MICHAEL

J. CAMPBELL

contain V,3, V,4, V, 5 and V,6 genomic inserts, respectively, were kindly provided by J. E. Berman and F. W. Ah. Preparation

of germline

DNA

Human germline DNA was obtained as previously described (Nathans and Hogness, 1984). Briefly, 1 ml of semen was gently lysed in 30 ml of 0.1 M EDTA-0.1 M Tris-HCl, pH 7.5-l % sarkosyl-0.3 M 2-mercaptoethanol-100 pg of proteinase K per ml. After 2 hr at 5O”C, 28 g of CsCl and 10mg of ethidium bromide were added and the DNA was purified by equillibrium centrifugation. Oligonucleotide

primer

design

Design of the 5’ human V, family specific PCR primers was based on the leader sequences of each of the six V, gene families. The leader region primers denoted V, I-ldr, V, 3-ldr, V,4-ldr, V, 5-ldr and V, 6-ldr were derived from the consensus sequences of nine V, 1 genes (Berman et al., 1988; Schroeder et al., 1987), 14 V,3 genes (Berman et al., 1988; Schroeder et al., 1987), seven V,4 genes (Lee et al., 1987), the two V, 5 germline genes (V, 252 and V, 32) (Humphries et al., 1988) and the one V,6 gene (Schroeder et al., 1988), respectively. The V, 2-ldr primer was from the sequence of the V, 2 gene pCE-1 (Takahashi et al., 1984). All leader primers were 20-mers except V, I-ldr which was an 18-mer. These primers are shown in Table 1 along with their homologies to consensus leader sequences of each of the six VH families. The 3’ antisense primers were derived from: (1) a sequence of FR3 which is relatively conserved in members of all six V, families (V,FR3-corn: 5’-CAGTAATACACGGCCGTGTC-3’) (Yamada et al., 1989); (2) a consensus sequence of the six heavy chain joining region segments (JH : 5’-ACCTGAGGAGACGGTG-

PI al.

ACCAGGGT-3’) (Crescenzi et al., 1988); or (3) conserved sequences within the constant region of the p heavy chain (C, : 5’-CAGGAGACGAGGGGGAA-3’) (Levy et al., 1987). Polymerase

chain reaction

PCR reactions were carried out in 100 ~1 volumes containing 0.5-2pg DNA, 0.5 PM of the 5’ primer, 0.5 PM of the 3’ primer, 200 PM of each dNTP, 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl,, 0.01% gelatin, and 2.5 U of Amplitaq DNA polymerase (Perkin-Elmer Cetus, Norwalk, CT). The samples were overlayed with 100 ~1 mineral oil and subjected to 30-40 cycles of denaturation (20 set at 94°C; first cycle for 2 min), annealing (20 set at 50-65”C), and elongation (30 set at 72°C) using the Perkin-Elmer thermal cycler. After the last cycle, a final elongation step (5 min at 72°C) was performed. PCR fragments (about onetenth of the reaction mixture) were separated on 1.5% agarose gels in 90 mM Tris-borate-2 mM EDTA (TBE buffer) and visualized with ethidium bromide staining. Cloning and sequencing

V, genes

PCR products were purified by electroelution from agarose gels, kinased in the presence of 10 mM ATP with T4 polynucleotide kinase (New England Biolabs, Beverly, MA), and blunt-end ligated into a phosphatase treated SmaI cut M13mp19 using T4 DNA ligase (Boehringer Mannheim Biochemicals, Indianapolis, IN). The ligation mixture was used to transform electrocompetent E. coli strains BSJ72 or SURE (Stratagene, La Jolla, CA) using a Gene pulser with Pulse controller (BioRad, Richmand, CA) as described (Zelenetz and Levy, 1990). Recombinant plaques were selected by their colorless appearance in the presence of Xgal and IPTG

Table I. Heavy chain variable region leader primers for PCR amplification and their homologies to consensus sequences of each of the six V, families (dashes indicate identity with the primer sequence) V,l-ldr V,l V,2 Vtl3 V,4 V,5 V,6

CCATGGACTGGACCTGGA ------_-ATACTT--TT ------_G-TTGGGCT__ A-----A-ACACCTG----T AG-___GG_CA_____GCC_ -A---TCTGTCT----TCC

V,3-ldr Vtll V,, 2 V”3 Vti4 Vk!5 V,6

CCATGGAGTTTGGGCTGAGC -----__C-GGACCTG___G -------CA-ACTTTGTTC-

V,S-ldr V,l V,2 V,3 V”4 V,5 Vu6

ATGGGGTCAACCGCCATCCT ----AC-GG---TGG-GCA----ACAT-CTTTGTTC--AC --m--m-A-PTTGGGCTG--G-TG ---AAACACCTGTGGT---T-

A----A-ACACCT-TG-TTAG----G---CAACCGCC-T-A---TCTG-CTCCT-CCT-

---TCTGTCT--TT-C--A-

V,2-ldr V”l Vtl2 V”3 V,4 V,S V,6 V,4-ldr V,l

VH2 V,3 V”4

VH5 V,6 V,6-ldr

Vtll vtI2 V”3 v,4 V,5 Vu6

ATGGACATACTTTGTTCCAC ------TGGACC--GAGG-T -----GT-TGGGCTGAG-TG ---A-ACAC--G--G-T-TT ----GGTC-ACCGCCAT-CT ---TCTGTCTCC-TCCT--T ATGAAACACCTGTGGTTCTT ---G-CTGGACC---AGGA---G-CATA--T--T-C-AC ---G--GTTTGG-CT-AG--G ---GGGTCAACCGCCA--C---TCTGT-TCC-TCC--AATGTCTGTCTCCTTCCTCAT ---GACTGGA---GGAGG----GACA-ACTT-GTTC--C -----GAGT-TGGGC-GAG-TG ---AAACA-CTG-GGT--T---GGGTCAA--GC-A--C-

Family specific amplification

(Sambrook et al., 1989). Ml3 plaques were picked at random and used to prepare ssDNA. Rapid preparation of up to 24 samples at one time was performed using a modification of the procedure of Kristensen et al. (1987). Clear plaques were picked and grown in 2 ml of 2 x YT broth for 6-8 hr. Bacteria were removed by centrifugation and the phage were precipitated with 1% final concn of glacial acetic acid for 2-10 min at room temp. The precipitate was recovered onto glass fiber filters using a PHD cell harvester (Cambridge Technology, Inc., Watertown, MA). The phage were dissociated and the DNA bound to the glass fiber filters by running 4 M NaClO,lO mM Tris-HCl, pH 7.5-l mM EDTA through the harvester. The filters were then washed with 70% (v/v) ethanol and transferred from the harvester

M

M

13456 VWldr

13456 Vtb-ldr

123456

Fig. 1. PCR amplification products using family specific Vu-ldr primers. (A) Plasmid DNA, containing Vu 1, V,3, Vu4, Vu5 and Vu6 gene inserts, was amplified with each of the Vu-ldr primers and a consensus FR3 primer. Fifteen microliters from a 100 ~1 PCR reaction was electrophoresed on a 1.5% agarose gel. Each Vu-ldr primer used is indicated above five lanes representing amplifications of each of the Vu containing plasmids (1, 3, 4, 5 and 6). Lane M contained Hinff digested pBR322 (from the top: 1631 bp, 506/516 bp, 396 bp, 344 bp, 298 bp, 2201221bp). (B) PBL DNA was amplified and electrophoresed as above. Lanes l-6 represent amplification products obtained with V, l-V,6 leader primers. Lane M is as above.

of human Vu genes

195

unit to a piece of Parafilm to air dry for 5 min. The filters were placed in 0.5 ml centrifuge tubes and incubated with 15 ~1 of 0.1 x TE, pH 7.5, for 5 min at room temp. The eluted DNA was recovered by piercing a small hole in the bottom of the tube with a 25 g needle, placing it inside a 1.5 ml tube, and spinning for 15-30 sec. Seven microliters of the eluted samples were used for sequencing by the dideoxy chain termination procedure using a modified T7 DNA polymerase (Sequenase, United States Biochemical Corp., Cleveland, OH) according to the manufacturer’s protocol. RESULTS AND DISCUSSION

Design of human V, family spedjic primers The human V, gene locus is composed of at least six distinct families. The nucleotide sequences of previously described V, genes (Berman et al., 1988; Lee et al., 1987; Schroeder et al., 1987, 1988; Humphries et al., 1988; Takahashi et al., 1984) were sorted into their respective families and aligned. A consensus sequence of 20 nucleotides (18 for V, 1) beginning near the ATG start codon of the leader region was obtained for each family. Each of these sequences was then compared to the corresponding consensus sequence of each of the other V, families. Table 1 shows the V,-ldr primers and their homologies with a consensus leader sequence of each V, family. As illustrated, for any particular V, family, its V,-ldr primer is generally less than 50% homologous with the leader sequences of the other V, families. More importantly, the 3’ end of any given V,-ldr primer is sufficiently mismatched with the other leader sequences such that it should not prime and amplify any V, gene except those belonging to its particular family. Table 2 shows the alignment of several published human V, leader sequences with their respective family specific V,-ldr primers. As can be seen, each primer has 95% or greater identity with each family member and all show sufficient 3’ homology to suggest that these primers would amplify all of the V, genes listed. The ability of these primers to specifically amplify V, genes was tested using previously cloned plasmids containing V, inserts representing five of the six human V, families (Berman et al., 1988; Schroeder et al., 1987) the exception being V, 2 (the available V,2 containing plasmid was leaderless). Plasmid DNA was amplified in separate reactions with each of the V,-ldr primers and the anti-sense FR3-corn primer for 30 cycles. The products of the amplification are shown in Fig. l(A). Plasmid 51PlJ contained a cDNA insert of a V, 1 gene and yielded the expected 350 bp PCR product when the V, 1-ldr primer was used. Plasmids 9-1, 1.911, 5-1Rl and 6- 1R 1 contained genomic inserts of V, 3, V, 4, V, 5 and V,6 genes, respectively. Each yielded a PCR product of the expected size of approximately 430 bp. In addition, each leader primer amplified only its respective V, family member and displayed no cross-priming of the other V, genes. Although a strong band was observed with the V, 5-ldr primer and the VH4 containing plasmid, it was much larger than the expected 430 bp and

196

MICHAEL J. CAMPBELL et

al.

Table 2. Alignment of the six family specific PCR primers with human V, leader sequences (Kabat Berman et al., 1988; Lee et al.. 1987; Schroeder et ul.. 1987. 1988: Humuhries et al.. 1988: Takahashi Vnl-ldr CCATGGACTGGACCTGGA 20~3 ~____-~~~~______~~

Hg3 ____~~~____~_~____ --____-___________ ___~~______~______ ~_~_____~~_______~ ~_~____~~_______~_ ~-___~~~___-_~~___ ___~~_____~~______ --__~--___~~______

LS2/EBV Riv ~_____~______~____ 266/bt ____~_____~~_____~ Hyb-Bc 7-2 ______~~_____~____

V,2-ldr ATGGACATACTTTGTTCCAC pCB_l -___________________

V,4-ldr ~71-2 V71_4 VI1 V79

et al..

V,3-ldr CCATGGAGTTTGGGCTGAGC 2pt ~~~___~~~~~~__._~~~~~ 3opt ----~~~~-__-_~_~_--.-_ 38pt _~~_~~ ~ _ --_G____-__ 56pt ______~~~__.--__~~--_-K6H6 ____~~____~~~~__.__~~ Ht6br ___--____C--__-----Hit _~~_~____~~~_____~~~ Vh26 ~~_____~~______~~___ CLL..TM ____-_~~_____~______ J,9JJJ _-__~~~--__~~~~__..__~~ 2.9111 ___----_C--------_--9-t ~~~-__~~~~___~_~~____ 12-2 ____~~____~~~___~~~~13-2 -__-----___G-__-_--_-~-8_1B ____~~____~~~___~~~_ 22_2B ____~___-_~~--___~~__ l~9l~---__~--__-_~__.-~~~~ 2-3 ___----_-_-CAT-_----__

51Pl Wi--Ht2 -Hpl ______~~_______~__ V35 CLL_Nei CLL-And 21-2 3-t 1.92 l-1

et al.,

1987; 19841

_ ~~~

V,S-ldr ATGGGGTCAACCGCCATCCT V251________________~~__ V32 ________-______~~_--~ 5_1Rl________~______~___~ 5_2R1_~_____~_____~____~~ l_V---_-----_---T__---Ws~________~~_____~_.-_~

ATGAAACACCTGTGGTTCTT ___-~_____~___-~____ _---__--T___---___-______-~____________ ~__________~_____~__

V,6-ldr ATGTCTGTCTCCTTCCTCAT 6_lRJ _______________~____ 6_lG1__~___-~_____~____~~ V-H-6 ~---__~--___~--__~--

v~2g_1____________________ V2_1 _---_G---___---___-V58 ___~____~___________ Omm -_------N----------C&2 _----_--_T--_-----_-58p2 _---__--T-__---___-1.9JJ____~_____~_________ 2.9JJ___~_____~__________

was not a consistent finding. These results demonstrate the utility of these leader primers on prototypical V, genes. We next tested these primers on a heterogeneous DNA sample rather than homogeneous plasmid DNA. DNA from PBL was subjected to 30 cycles of amplification using each of the V,-ldr primers with the anti-sense FR3-corn primer. As shown in Fig. l(B), all of the Vu-ldr primers (including the V,2-ldr) yielded the appropriate size PCR products (430 bp) from PBL DNA. That these PCR bands actually represent V region genes and not non-Ig amplification products was some spurious, demonstrated by sequence analysis as described below. Amplljication and sequencing genes-the V,6 family

of human

germline

germline Vu genes from several of the human Ig V, families. We first amplified human germline DNA with the V,6-ldr and FR3-corn primers and cloned the resulting PCR product into ml3 for sequencing. Five randomly chosen plaques were picked and sequenced. Since the Vu6 family contains only one member, the sequences obtained from the ml3 clones should be identical. Indeed, all were identical to the published V, 6 germline sequence (Schroeder et al., 1988) (data not shown). These results indicate that the V,6-ldr primer can amplify Vu6 variable region germline genes (as confirmed by sequence) and that this primer only amplifies V,6 genes.

V,

The six human V, gene families contain an estimated 100-200 members (Berman et al., 1988). The smallest family, V, 6, contains only one member while the largest, V,3, may contain 100 or more genes. Using the family specific Vu-ldr primers we tested our ability to isolate

Amplzjication and sequencing genes-the VH2 family

of human

germline

V,

The Vu2 gene family has been estimated to contain between five and 10 members based on Southern blot analyses (Berman et al., 1988; Lee et al., 1987). This may be an underestimate because of the presence of multiple

Family specific amplification of human V, genes

consensus sequences may represent allelic differences, since the germline DNA used for amplification was obtained from a single individual most of them probably represent errors introduced during amplification with T.aq. polymerase. Out of 16 V,2 clones, we have apparently identified only two germline genes (or, since V,2-MC1 and V,2MC2 differ by only 4 bp, they may represent two allelic counterparts of the same germline gene). One possible explanation for this is that the V,2-ldr primer is biased towards these two genes, since its design was based upon only one sequence. To test this idea, two more V,2-ldr primers were synthesized. Again, each was based on the leader sequence of pCE-1, however, they were designed to have 3’ homology at different positions in the leader region as shown below:

V, genes on a single Southern band. Takahashi et al, (1984) have published the nucleotide sequence of a rearranged V,2 gene (pCE-1) obtained from the CESS cell line and Schroeder and Wang (1990) have recently published a rearranged Vn2 sequence obtained from fetal liver. Since no V,2 germline gene sequences have been described, we were interested in using the V,2-ldr primer to isolate germline V,2 genes. Germline DNA was amplified with the V,2-ldr and FR3-corn primers and the PCR product obtained was cloned into m13. Sixteen clones were randomly selected and sequenced. These are shown in Fig. 2 along with the sequence of pCE-1 and the fetal Vn2 sequence (M60). Five of these clones were identical to each other and were denoted V,2-MCl. Two clones (V,2-MCla and V,2-MClb) differed from V,2-MC1 by one nucleotide each. Another four clones were identical to each other and were designated V, 2-MC2. Four clones (V, 2-MC2a, V, 2-MC2b, V, 2-MC2c and V, 2-MC2d) had only one or two differences from V,2-MC2. One clone, V,2MC2e, was identical to V,2-MC2 except for a 2 bp deletion in the leader sequence. Although the random differences from either the V,2-MC1 or V,2-MC2

V"2-"Cl VH*_"Cln VjQ_)fClb WZ_K2

v”*-)jc*a

5’-CACCATGGACATACTITGTTCCACG-3’ pCE- 1 VH2-ldr 5’-ATGGACATACTTTGTTCCAC-3’ V, 2. I-ldr 5’-CCATGGACATACT’TTGTTC-3’ V, 2.2-ldr 5’-CACCATGGACATACTTTG-3’. Thus, if the V,2-ldr primer failed to amplify some Vn2 genes due to 3’ mismatch, the V,2.1-ldr and V,2.2-ldr

-5

-19 5) VW-WC1 V"*_"Cla V"i._HC1b 4) a*_"C* VH2_"C2= VH2_)&-2b V"*_MC2c V"2_MC2d V"2_nC2* NE-1

197

ATGGAC ___ ___ ___ ___ ___ ___ __- _---_ _---- _-___ -_-_- --__- ---

___ ___ ___ -__ -__-----_-_

___ ___ ___ ---__ ----____-

tatqttcttctcuca _______________

___ ___ ___ --___ --_ -----_-

___ ___ ___ --___ ___ --_-_ --_

___ _-___ --_ ___ ___ --_ -__ ___

CTC ___ --___ _-_ ___ ___ _____ -__

CTG ___ --___ -__ ___ ___ _-_ __. -__

CTA ----___ _-___ ___ -_.-_-_

CTG ----__-_----__-----

ACT --------------_----

GTC -------------------

CCC -------------------

TCC -------------------

~~~P=~~GC~P~G~~C=PP~=~~==~~=~~~~G=~==~~~~=~~~~~~=~==~~~G~~~~=~~=~~~~~=~ ____________________~~~~~~~~________~~_________________________________ -------------------------------9_--__---~~~~~~_~___________-____________ ____________---------~~~~~~~~~~~_________~~~_________________-_-_______ ______-----_-___-___--____________-_-____-_____ ~_______________________ __________________---~~~~~~~~~______~~~~~_~_~_________-____-___________ ________________~__________ ~~____________~~~__~~___________~___________ ____________________----____________-____________-___-_________________ ______-__--__-______~~______~~~~~~_____________-___-_-_________________ ____________________--____________________________--_-__-______________

1 10 20 -4 GGG GTC TTA TCC CAG GTC XC TTG SAG GAG TCT GGT CCT GCG CTG CTG AAA CCC ACA CAG ACC CTC AC?, CTG ACC TGC MC TTC TCT GGG TTC ___ ___ ___ ___ ___ ___ ___ ___ --- --- --- --- --- --- --- -_- --- --- -_- ___ _-_ ___ ___ ___ _-_ ___ ___ ___ ___ ___ ___

__-------------

___

___

_--

---

---

---

---

---

---

_______________

___

___

___

___

___

___

___

---

-G-

---

---

---

---

---

---

---

---

---

---

---

---

---

___

___

-__

___

___

_-_

___

___

___

__-------------

___

___

___

___

___

-__

___

_--

_G-

___

___

___

___

___

--_

---

___

___

___

___

___

___

___

___

___

___

___

___

___

___

___

___

___

___

---

---

---

---

---

---

---

---

---

---

---

---

--_

__-

---

___

___

___

___

V”.J_“,-Zb

_______________

___

___

___

___

_--

---

---

-G-

---

---

---

---

---

---

---

---

---

---

---

---

---

--_

___

_--

-__

__-

___

___

___

v”*_nc&

__-------------

___

___

___

___

---

---

---

---

_G_

___

___

___

___

___

---

___

___

___

___

___

___

___

___

___

___

___

___

___

___

___

___

vf&,_$,c-,j

_______________

___

___

___

___

___

___

___

___

-G-

__-

---

---

___

___

___

---c--

___

___

___

___

___

___

___

___

___

G__

___

___

___

lf”*+fc*e

___---_--------

---

___

___

___

___

___

___

_--

-G-

---

---

-__

___

---

---

---

___

___

___

-__

___

___

___

___

___

___

___

___

___

___

___

_______________

___

___

___

___

___

___

_A_

--A

-G-

---

---

---

--_

---

---

---

_-_

G__

___

--T

___

___

---

___

___

-__

___

___

___

___

-_G

G__

___

___

___

_G_

___

---

---

---

_-_

--_

___

---

---

___

__-

-__

___

---

---

___

___

___

_-A

_A_

___

___

TTC ___ ___

TAC AGC

NE-1

n60

---

,____________CDRl-__________,

VHZ-MC1 VHZ-MCla VHZ-MClb VHZ-MC2 VH2-Flc2a VHP-HC2b VH2+lC2C VHZ-MC2d VHZ-MC2e pa-1 M60

Vm2-MC1 w2-Mc1a VH2-MClb VH2-MC2 VH2-nc2a VH2-MC2b wi2-nc2c VHZ-MCZd VHZ-MCZe pa-1 H60

___ ___ -__

30 CTC AGC ACT AGT ___ ___ ___ ___ ___ ___ ___ ___ ___ -__-_ ---

--_

__-

-__

_-_

---

--_

-_-

-__

---

---

___

___

___

__-

___

___

___

---

TCA

GGA ___ ___ ---

---

___

,_______-__________-________CDRZ_____-_______

40 3% 3% ATG CGT GTG AGC TGG ATC CGT CAG CCC CCA CGG MG ___ ___ ---

___ ___

___ ___

___ ___

__---

-----

T__

___

_--

--_

__-

---

---

T__

___

___

_--

-__

_--

---

---

T__

___

___

___

___

---

---

---

---

T__

___

___

___

___

---

---

---

___

T__

___

___

___

---

---

-------

-----

50 GCA CGC ATT --------___ ---

GAT ---_-

___

___

___

---

___ ___

___

___

-__

___

___

___

--_

___

_-_

___

___

___

GCC -----

---

---

---

___

---

_T_

---

---

-__

___

---

---

___

_T-

---

---

-__

___

---

_-_

___

_T_

___

---

--_

___

---

-_-

___

_T_

---

---

__-

---

---

___

___

-----

-----

---

--_

-__

---

---

-__

_--

_--

-_-

--G

_--

---

---

---

_--

---

---

---

---

---

--___

_--

CTG GAG TGG CTT -----------------

-----

-----

---

---

60 TGG GAT GAT ----___ ___ _-_ ___

GAT AI\A

___

___

___

-__

_A_

___

___

_-_

-__

___

___

___

_A_

___

___

___

___

___

___

___

+_

___

___

___

_A_

___

___

___

_A_

___

___

_-_-_

-__ ___ ___

___ ___

___ ___

___

___

___

___

___

___

___

T-e

___

___

_-_

__-

__-

_-_

---

---

---

___

---

___

__-

-__

-T_

___

___

___

___

___

G__

_A_

---

c--

---

-__

TC_

___

___

___

---

---

---

---

-_-

---

---

---

--_

__-

---

___

___

-__

___

-__

___

___

___

___

__G

_A_

___

G-T

---

_-_

___

__-

___

__-

-__

T__

___

___

___

___

___

___

---

---

___

___

___

---

___

__-

_-_

___

-T-

___

___

-__

___

___

___

___

_A_

___

___

___

___

___

___

___

_A-

BO 70 82A 828 82C 90 AC.t TCT CTG AAG KC AGG CTC KC AK TCC AAG GAC KC TCC a MC UC GTG GTC CTT ACA ATG ACC AK ATG GAC CCT GTG GAC ___ __C __- _-_ -__ --- --- --_ ___ ___ --- --- --- --- --- --- --- --- --- --_ --- --_ __- --- -__ --- --- ___ -__ ___ -__ ___ ___ ___ __

___________________________--- _-__________________-__ _______-- --___________________________--- --_______________--- --- --- --- --- --____________________________-- ---__ -_- ______-_- --- --- -__ --- --- --_____________________________- --__- --- --_ ___

___

___

___-__ --- ----- --- --- ----- --- --- ----- --- --- ----- --- _-_ ----- --- --- ----- --_ ____--

---------------

---------------

__- --- ----- _-- ----- --- ----- --- --_ -__ _-- ----- --- --_-_ ___--_

_____- _-- ___--- -__ _---_ ______--- --- --- ---__ __- --- --- ___-_- ----- --_ --_ _____- --- ---__ ___--_ --- --- --- ----- --- --- --- --- --_ --_____- ______--- --- ---

--_ -_- -__ ______________ --- ___--- ______________ --- _-- --- _-- --- _-_ _____ -_- --- ___--- ___________ --- ___--_ _-_ ___________ -__ _-_ _________________ --- -__ _-_ __- ___________

G_-

-_T

___

---

---

--_

___

___

___

___

m-T

---

---

___

__-

--_

___

-A_

G__

___

___

___

___

___

_c_

___

__A

___

AC_

___

___

__

___

___

___

___

___

___

__-

---

---

--_

-__

---

---

--_

___

___

---

---

---

---

---

---

---

---

--_

___

__A

__-

AC_

___

___

__

Fig. 2. Nucleotide sequences of human immunoglobulin heavy chain variable region germline genes from the Vn2 family. Sequences obtained after PCR amplification with the V,2-ldr and FR3-corn primers are compared with the rearranged Vn2 family sequences pCE-1 (Takahashi et al., 1984) and M60 (Schroeder and Wang, 1990). Non-coding sequences are shown in lower case. Dashes designate identity to Vn2-MCl. Positions of the primer sequences are underlined. Numbers in parentheses indicate the number of individual isolates of a given sequence. If no number is given only one clone was isolated.

198

MICHAEL J. CAMPBELL

primers might overcome this problem. Sequences were obtained for six clones amplified with the V,2.1-ldr primer and four using the V,2.2-ldr primer. Of these 10 clones, seven were identical to V,2-MC2, two were identical to V,2-MCl, and one had only one difference from V,2-MC1 (data not shown). We have also amplified PBL DNA and RNA with these V,2-ldr primers and varied the 3’ primer (FR3-corn, J,, or C,) and still find the same two variable region genes (albeit with somatic mutations) (data not shown). Thus, either the V, 2-ldr primers are still biased

rt al.

towards these genes or there are only two V,,2 germline genes. If the latter is the case, the multiple bands seen on Southern analysis with a Vu2 probe may represent multiple copies of the same Vu2 gene or they may represent cross-hybridization with other V, genes. Experiments are underway to address these issues. Interestingly, the V,2-MC2 germline gene is highly homologous to the two previously reported rearranged V,2 genes (96% homology with pCE-1 and 99% homology with M60) and may represent the germline counterpart of these clones.

Fig. 3. Continued on next page

Family specific amplification

of human Vu genes

Fig. 3. Nucleotide sequences of human immunoglobulin heavy chain variable region germline genes from the Vu4 family. Sequences obtained after PCR ampification with the V,4-ldr and FR3-corn primers are compared with previously published V,4 germline genes (Berman et al., 1988; Lee et al., 1987; Sanz et al., 1989). Non-coding sequences are shown in lower case. Dashes designate identity to the given sequence. Positions of the primer sequences are underlined. Numbers in parentheses indicate the number of individual isolates of a given sequence. If no number is given only one clone was isolated.

Ampll$cation and sequencing genes-the V,4 family

of human

germline

V,

The Vu4 gene family contains an estimated six to 10 members by Southern analyses (Berman et al., 1988; Lee et al., 1987). Eight different Vu4 germline sequences MlMM 2%--E

have been described (Lee et al., 1987; Sanz et al., 1989) as well as one pseudogene (Berman et al., 1988). We wished to demonstrate that using our V,4-ldr primer we could isolate all the previously described Vu4 germline genes as well as new ones which have not been identified.

200

MICHAEL J. CAMPBELL et al.

In initial experiments, we isolated multiple clones of most of the previously reported V,4 germline genes. In addition, up to one third of the clones we isolated seemed to represent unique combinations of the known V,4 genes, but we suspected that these recombinant genes resulted from an artefact of PCR. Paabo et al. (1989, 1990) have described a phenomenon termed “jumping PCR” and have suggested that it may occur under several conditions, one of which being high template concentrations. Since all members of a given V, family are highly homologous, there is a potential for jumping PCR artefacts after many cycles of amplification and accumulation of large quantities of product. To avoid this, we performed another amplification of germline DNA but limited the number of cycles of amplification. Aliquots were removed from the PCR every five cycles and electrophoresed on an agarose gel. At 20 cycles, product just began to accumulate to the point of being visible by ethidium bromide staining. The PCR product for 20 cycles of amplification was gel purified and cloned into m13. None of the sequences generated from this PCR were “jumping PCR recombinants”. Sequences from 58 clones were obtained from this 20 cycle PCR and compared in Fig. 3 and Table 3 to previously published V,4 germline genes (Vl 1, V79, V71-2, V71-4, V2-1, V12g-1 and V58 from Lee et al. (1987); 2.911 from Berman et al. (1988); and V”4.11, V,4.18, V,4.21 and V,4.23 from Sanz et al. (1989)). The former comparisons include leader and intron sequences whereas the latter (Sanz et al., 1989) are only for coding region sequences. Six of the 58 clones were identical to each other and were denoted V,4-MCl. These clones were 99.3% homologous to Vl 1 and 100% homologous to Vn4.23. Four identical clones, designated Vu 4-MC2, differed from V71-4 by 1 bp and were identical to Vu4.11. Another three clones were >99% homologous to V71-2. Of these clones (V,4-MC3, V,4MC3a and V,4-MC3b) the first was identical to V71-2 while the latter two each differed by one nucleotide. We isolated four clones which showed > 99% homology to V79. Two of these were identical to V79 and were designated V,4-MC4. The other two (V,4-MC4a and

Table 3. Comparison Vll VuCMCl V,4-MC2 V,4-MC3 V,4-MC4 V,4-MC5 V,4-MC6 V,4-MC7 V,4-MC8 V,4-MC9

99.2’ 93.7 93.3 95.3 91.9 92.0 92.5 93.0 91.5

of Vn4 germline

genes isolated

V,4-MC4b) each differed by one nucleotide. Five more clones were found to be >95% homologous to V58 and > 99% homologous to V,4.21. Two of these were identical to V,4.21 and were designated V,4-MC5. The other three (V,4-MC5a, V,4-MC5b and V,4-MC5c) each differed from V,4.21 by one nucleotide. We isolated one clone, V, 4-MC6, which was 99% homologous to V2-1 and identical to V”4.18 and another clone, V,4-MC7, which differed from V12g- 1 by only one nucleotide. We also isolated 17 clones which showed > 99% similarity to a V,4 pseudogene (2.911) described by Berman et al. (1988). Three of these, designated V,4-MC8 (‘I’), were identical to 2.911, Seven clones, designated V,4-MC8a(Y), differed from V,4-MC8(Y) by one nucleotide. Another two, V,4-MC8b(‘P), differed by one bp each, and the remaining five clones differed by between one and three nucleotides each. Finally, we isolated 16 additional clones which showed 95% or less homology to any of the previously reported V,4 germline genes. Ten of these clones were identical and were designated V,4-MC9. The other six each differed from V,4-MC9 by 1-6 bp. V,4-MC9 showed greatest homology to V71-2, although differing by 21 nucleotides, and probably represents a new germline gene or perhaps a V71-2 subfamily. The deduced amino acid sequences of V,4-MC9 and V,4-MC5 (the full length counterpart of V,4.21) are compared in Fig. 4 to the published Vu4 germline sequences (Berman et al., 1988; Lee et al., 1987; Sanz et al., 1989). As with the V,2 sequences, these V,4 germline genes were obtained from a single individual, hence the differences from consensus sequences observed were most likely due to misincorporation during amplification, although some may represent allelic differences. For example, the recurring discrepant nucleotides seen in codon 70 of V,4-MC8a, e, f and g or in codon 74 of V,4-MC9c, d, e and f may have arisen as PCR errors early during amplification or may indeed represent allelic polymorphisms. Altogether, using the V,4-ldr primer, we isolated all of the previously published V, 4 germline genes (with the exception of V58) as well as a new Vu4 germline gene, thus demonstrating the utility of this strategy. Although we did not isolate any V58 genes, we did find several

in this study to previously

Vu4.23

v71-4

V”4.11

V71-2

v79

V58

100.0 93.9 93.6 98.1 93.2 94.0 93.6 95.1 92.1

94.3 99.7 99.2 93.5 91.9 93.7 93.5 90.6 94.3

93.9 100.0 99.6 93.6 92.4 95.5 93.9 91.3 95.1

94.0 99.0 100.0 94.3 92.2 93.8 93.8 91.5 94.6

96.1 93.7 94.3 100.0 91.9 93.0 94.0 92.5 93.0

90.9 92.7 93.2 90.1 96.3 90.9 90.1 88.8 90.6

described

Vu4 germline

genes“

Vu4.21

v2-1

Vu4.18

v12g-1

2.911

93.2 92.4 92.4 92.8 100.0 92.0 89.8 91.7 91.3

92.2 93.5 93.3 92.5 90.9 99.5 93.3 90.2 93.3

94.0 95.5 94.8 93.6 92.0 100.0 93.6 92.1 93.7

93.5 94.0 94.0 94.3 90.3 94.0 99.7 92.5 94.3

93.8 90.9 91.5 92.5 91.4 90.7 92.2 100 90.7

“Vll, V71-4, V71-2, V79, V58, V2-1 and V12g-1 are from Lee et al. (1987); V”4.23, V”4.11, V”4.21 and Vu4.18 are from Sanz et al. (1989); and 2.911 is from Berman et at. (1988). Comparisons do not include primer sequences and for the sequences from Sanz et nl. (1989) the comparisons do not include leader or intron sequences. bPercent homology.

Family specific amplification of human VH genes /-cDRl/ “71-Z “71-4 “11 “79 y12g_l “2-l “58 WM.21 vS4-MC5 Wd_Kc’) 2.911(w)

10 1 Qv*IQESGPG _--___-_--____--L-----__-----_--_---_~_____--m_*----_____pll_S_ ___--*p*_ _____-__-________--

-19 ~LwFFLLL”MPR9NL.S ___________________ ___________________ ___________________ ___________________ _____-_____-____--_____--____--___--________________-____________________ _________________--

30

20 LVXPSETLSL -------------------__-SO____ _____p____________p__---__ _I-__--___p___________p___ _______-_-

KwScGS”S __________ __“_____I_ __A_____I_ --A---y-I-_______I_ __~_T____. _-A-y---F. --A-T---F. ________I_ ~_*__+_~_

SGSYYUSWIR -..-------._Sp+--“-.-m---“-.-Nww_c--_S____~___ --,--------.--------.--------I+-------.SwI-“-

,_____COS2______/ “71-Z “71-d “11 “79 VIZ.?-l “2-l “58 ““1.21 vH4-Ms VIM-MC9 2.911(W)

40 QPPGKGLEWI ___--_______-________-____-___-________-______ ___-_-______-______ -__---_--_ ___-_-_-__“____-___

50 GYIYYSCSTN _____-__-_ _S__S_+Jp_ _S__S-____ _ __ _ - ---_s_______y __________ _S_S”_____ _S_SS___-_ _S_SS____y __-______y

y

60 YNPSLRSRVT _~___----__-------_-____---__________ ______---S_______S_ __________ __________ ________I_ --~------

70 ISVDTSKNPP __-_____-_ __I_S____-

SO

90

____1[__--n_-----___ ________S_

SLUSSVTAA -_--_----_________________________--v _________-

DTAWY _____----------c -----------

_______--___-_----________-+_____--__________

--S---------------_________y--------________--

-----c ----------______ ------

Fig. 4. Deduced amino acid sequences of human V,4 gerrnline genes. Sequences are numbered according to Kabat et al. (1987). Identical amino acids are represented by dashes and deletions are represented by dots. Asterisks indicate stop codons. clones identical to Vn4.21 which Sanz et al. (1989) have proposed may constitute a V58 subfamily. Conclusions We have devised a general strategy for PCR amplifying human V, genes that fulfills the criteria of amplification from either DNA or RNA/cDNA, that results in a complete, full length leader-intron-variable region (from DNA) or leader-variable region (from RNA-cDNA) sequence, and that allows rapid, facile identification of V, gene family usage in a given B cell clone. Although several investigators have described PCR based strategies for isolating human Vu genes (Akahori et al., 1990; Brisco et al., 1990; Carroll et al., 1989; Cuisinier et al., 1990; Deane and Norton, 1990; Larrick et al., 1989; Kipps et al., 1989; Sanz et al., 1989; Van der Heijden et al., 1990; Yamada et al., 1989), none of these previously reported methods present a universal approach for amplification of human V, genes. The single-sided PCR technique used by Cuisinier et al. (1990), allows amplification from RNA-cDNA but not from DNA and the intron primers described by Sanz et al. (1989) and Van der Heijden et al. (1990) allow amplification only from DNA. In contrast, V, leader primers allow amplification from either DNA or RNA-cDNA. Several groups (Akahori et al., 1990; Brisco et al., 1990; Deane and Norton, 1990; Kipps et al., 1989; Van der Heijden et al., 1990; Yamada et al., 1989) have described PCR primers which anneal to regions in FRI or FR3 (some specific for a given V gene, others more general) and thus allow amplification from DNA or RNA-cDNA, but do not yield full length sequences. In contrast, the use of leader region primers yields full length Vu gene sequences. Thus, when amplifying from DNA, the intron sequences, which are useful when examining and comparing germline V, genes, are not lost. In addition, for producing recombinant human antibodies by PCR amplification and cloning into expression vectors, the use of leader region primers yields Vn gene segments

201

(and thus recombinant Abs) which reflect the complete, native protein. Finally, Larrick et al. (1989), Carroll et al. (1989), and Kipps et al. (1989) have reported the use of leader region primers for PCR amplification of human V, genes which fulfil criteria (1) and (2) above, but not (3), the rapid identification of V, gene family usage as they do not allow specific amplification of each individual V, family. Thus, although there are other reports in the literature of PCR based strategies to isolate human VH genes, the approach which we have described (using V, 1-ldr through Vu 6-ldr family specific primers) is the only one which fulfils all of the criteria listed above and provides a nearly universal method for the amplification of human V, genes. The results presented herein demonstrate that these six V,-ldr primers specifically amplify V region genes of their respective families but do not cross-prime and amplify members of the other families. We have demonstrated the utility of these primers in an analysis of the germline repertoire of the V, 2 and V, 4 families, and have identified a new V,4 member and two new Vu2 germline genes. These primers will be useful in examining the germline repertoire of the other V, families as well. The identification of new germline genes brings us a step closer to being able to make assignments of expressed human V, genes to their germline counterparts. To do this, one must know the sequences of all the germline genes in the expressed gene’s V, family. For the small Vn 5 and Vu 6 families, where all the germline genes are known, this is relatively straight forward. For the V,4 family, estimated to contain around 10 members, nine germline gene sequences have been reported and the addition of this new V,4 germline gene may complete, or nearly complete this family. The new V,2 germline genes are of particular interest since there are no V,2 germline genes reported in the literature. The family-specific V,-ldr primers should also prove useful in studies examining V, gene utilization in human B cell development or in various B cell disorders such as B cell malignancies or autoimmune diseases. We have used these primers to efficiently amplify (from DNA as well as mRNAcDNA), clone and sequence (or directly sequence via assymetric PCR) V, genes from human B cell lymphomas and have identified members from each of the six V, families (as confirmed by sequence analysis) which were specifically amplified with their respective V,-ldr primers (Zelenetz et al., 1991; Bahler et al., manuscript submitted for publication). Previous studies have utilized hybridization techniques to determine Vu family usage (Logtenberg et al., 1989; Mayer et al., 1990). Since V genes are quite homologous these studies are sometimes hampered by cross-reactivity of probes between families. The family specific V,-ldr primers would provide a more rapid and facile method of identifying V, gene usage by normal and aberrant B cell populations. In addition, unlike hybridization studies, one can sequence the resulting PCR products and make further assignments of V regions to subfamilies. As a final cautionary note, when amplifying genes from multigene families such as Ig genes, one must be aware of the

202

MICHAEL.J. CAMPBELL et al.

potential for creating artifactual sequences by combining DNA segments from different alleles or loci via a ‘jumping polymerase chain reaction”. Acknowledgements-We thank Marlo Lenox for skilful technical assistance. This work was supported in part by grants CA33399 and CA34233 from the United States Public Health Services-National Institutes of Health. A. D. Zelenetz is a recipient of a Clincial Investigator Award K08 CA01396 from the National Cancer Institute. R. Levy is an American Cancer Society Clinical Research Professor.

REFERENCES Akahori Y., Kurosawa Y., Kamachi Y. Torii S. and Matsuoka H. (1990) Presence of immunoglobulin (Ig) M and IgG double isotype-bearing cells and defect of switch recombination in hyper IgM immunodeficiency. J. clin. Invest. 85, 172221727. Berman J. E., Mellis S. J., Pollock R., Smith C. L., Suh H., Heinke B., Kowal C. Surti U., Chess L., Cantor C. R. and Alt F. W. (1988) Content and organization of the human Ig Vn locus: definition of three new V, families and linkage to the Ig C, locus. EMBO f. 7, 727-738. Brisco M. J., Tan L. W., Orsborn A. M. and Morley A. A. (1990) Development of a highly sensitive assay, based on the polymerase chain reaction, for rare B-lymphocyte clones in a polyclonal population. Br. J. Haematol. 75, 163-167. Carroll W. L., Yu M., Link M. P. and Korsmeyer S. J. (1989) Absence of Ig V region gene somatic hypermutation in advanced Burkitt’s lymphoma. J. Zmmun. 143, 6922698. Crescenzi M., Seto M., Herzig G. P., Weis P. D., Griffith R. C. and Korsmeyer S. J. (1988) Thermostable DNA polymerase chain amplification of t( 14; 18) chromosome breakpoints and detection of minimal residual disease. Proc. natn. Acad. Sci. U.S.A. 85, 4869-4873. Cuisinier A., Fumoux F., Moinier D., Boubli L., Guigou V., Milili M., Schiff C., Fougereau M. and Tonnelle C. (1990) Rapid expansion of human immunoglobulin repertoire (VH, VIC, VA) expressed in early fetal bone marrow. New Biologist 2, 689-699. Deane M. and Norton J. D. (1990) Detection of immunoglobulin gene rearrangement in B Iymphoid malignancies by polymerase chain reaction gene amplification. Br. J. Haemat. 74, 251-256. Humphries C. G., Shen A., Kuziel W. A., Capra J. D., Blattner F. R. and Tucker P. W. (1988) A new human immunoglobulin V, family preferentially rearranged in immature B-cell tumors. Nature 331, 446-449. Kaartinen M., Griffiths G. M., Hamlyn P. H., Markham A. F., Karjalainen K., Pelkonen J. L. T., Makela 0. and Milstein C. (1983) Anti-oxazolone hybridomas and the structure of the oxazolone idiotype. J. Immun. 130, 9377945. Kabat E. A., Wu T. T., Reid-Miller M., Perry H. M. and Gottesman K. S. (1987) Sequences of Proteins of Zmmunological Interest (4th Edn). Department of Health and Human Services, Washington, DC. Kipps T. J., Tomhave E., Pratt L. F., Duffy S., Chen P. P. and Carson D. A. (1989) Developmentally restricted immunoglobulin heavy chain variable region gene expressed as high frequency in chronic lymphocytic leukemia. Proc. natn. Acad. Sci. U.S.A. 86, 5913-5917.

Kristensen T., Voss H. and Ansorge W. (1987) A simple and rapid preparation of ml3 sequencing templates for manual and automated dideoxy sequencing. Nttcleic Acids Res. 15, 550775516. Larrick J. W., Danielsson L., Brenner C. A., Abrahamson M., Fry K. E. and Borrebaeck C. A. K. (1989) Rapid cloning of rearranged immunoglobulin genes from human hybridoma cell lines using mixed primers and the poiymerase chain reaction. Biochem. hioph.ys. Res. Commun. 160, 1250-I 256. Lee K. H., Matsuda F., Kinashi T., Kodaira M. and Honjo T. (1987) A novel family of variable region genes of the human immunoglobulin heavy chain. J. molec. Biol. 195, 761-768. Levy S., Mendel E. and Kon S. (1987) A rapid method for cloning and sequencing variable-region genes of expressed immunoglobulins. Gene 54, 167-173. Logtenberg T., Schutte M. E. M., Inghirami G., Berman J. E., Gmelig-Meyhng F. H. J., Insel R. A., Knowles D. M. and Alt F. W. (1989) Immunoglobulin Vi, gene expression in human B cell lines and tumors: biased V, gene expression in chronic lymphocytic leukemia. Int. Immun. 1, 362-366. Mayer R., Logtenberg T., Strauchen J., Dimitriu-Bona A., Mayer L., Mechanic S., Chiorazzi N., Borche L., Dighiero G., Mannheimer-Lory A., Diamond B., Alt F. and Bona C. (1990) CD5 and immunoglobulin V gene expression in B-cell lymphomas and chronic lymphocytic leukemia. Blood 75, 1518-1524. Nathans J. and Hogness D. S. (1984) Isolation and nucleotide sequence of the gene encoding human rhodopsin. Proc. natn. Acad. Sci. U.S.A. 81, 4851-4855. Paabo S., Higuchi R. G. and Wilson A. C. (1989) Ancient DNA and the polymerase chain reaction. J. biol. Chem. 264, 970999712. Paabo S., Irwin D. M. and Wilson A. C. (1990) DNA damages promotes jumping between templates during enzymatic amplification. J. biol. Chem. 265, 4718-4721. Sambrook J., Fritsch E. F. and Maniatis T. (1989) Molecular Cloning. A Laboratory Manual (2nd Edn). Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sanz I., Kelly P., Williams C., Scholl S., Tucker P. and Capra J. D. (1989) The smaller human V, gene families display remarkably little polymorphism. EMBO J. 8, 3741-3748. Schroeder H. W., Jr, Hillson J. L. and Perlmutter R. M. (1987) Early restriction of the human antibody repertoire. Science 238, 791-793. Schroeder H. W., Jr, Walter M. A., Hofker M. H., Ebens A., Van Dijk K. W., Liao L. C., Cox D. W., Milner E. C. B. and Perlmutter R. M. (1988) Physical linkage of a human immunoglobulin heavy chain variable region gene segment to diversity and joining region elements. Proc. natn. Acad. Sci. U.S.A. 85, 819668200. Schroeder H. W., Jr and Wang J. Y. (1990) Preferential utilization of conserved immunoglobulin heavy chain variable gene segments during human fetal life. Proc. natn. Acad. Sci. U.S.A. 87, 6146-6150. Takahashi N., Noma T. and Honjo T. (1984) Rearranged immunoglobulin heavy chain variable region (V,) pseudogene that deletes the second complementarity-determining region. Proc. natn. Acad. Sci. U.S.A. 81, 519445198. Van der Heijden R. W. J., Bunschoten H., Pascual V., Uytdehaag F. G. C. M., Osterhaus A. D. M. E. and Capra J. D. (1990) Nucleotide sequence of a human monoclonal

Family specific amplification anti-idiotypic antibody specific for a rabies virus-neutralizing monoclonal idiotypic antibody reveals extensive somatic variability suggestive of an antigen-driven immune response. J. Immun. 144, 2835-2839. Yamada M., Hudson S., Tournay O., Bittenbender S., Shane S. S., Lange B., Tsujimoto Y., Caton A. J. and Rovera G. (1989) Detection of minimal disease in hematopoietic malignancies of the B-cell lineage by using third-complementarity-

of human V, genes

203

determining region (CDR-III) = specific probes. Proc. natn. Acad. Sci. U.S.A. 86, 5123-5127.

Zelenetz A. D. and Levy R. (1990) Directional cloning of cDNA using a selectable SfiI cassette. Gene 89, 123-127. Zelenetz A. D., Chen T. T. and Levy R. (1991) Histologic transformation of follicular lymphoma to diffuse lymphoma represents tumor progression by a single malignant B cell. J. exp. Med. 173, 197-207.