Q;=D' 1992 Oxford University Press

Nucleic Acids Research, Vol. 20, No. 13 3361-3366

Variants of the Xenopus Iaevis ribosomal transcription factor xUBF are developmentally regulated by differential

splicing

Alain Guimond and Tom Moss* Centre de Recherche en Cancerologie de l'Universite Laval, Hotel-Dieu de Quebec, 11 Cote du Palais, Quebec GiR 2J6, Canada Received April 3, 1992; Revised and Accepted May 28, 1992

ABSTRACT XUBF is a Xenopus ribosomal transcription factor of the HMG-box family which contains five tandemly disposed homologies to the HMG1 & 2 DNA binding domains. XUBF has been isolated as a protein doublet and two cDNAs encoding the two molecular weight variants have been characterised. The major two forms of xUBF identified differ by the presence or absence of a 22 amino acid segment lying between HMG-boxes 3 and 4. Here we show that the mRNAs for these two forms of xUBF are regulated during development and differentiation over a range of nearly 20 fold. By isolating two of the xUBF genes, it was possible to show that both encoded the variable 22 amino acid segment in exon 12. Oocyte splicing assays and the sequencing of PCR-generated cDNA fragments, demonstrated that the transcripts from one of these genes were differentially spliced in a developmentally regulated manner. Transcripts from the second gene were found to be predominantly or exclusively spliced to produce the lower molecular weight form of xUBF. Expression of a high molecular weight form from yet a third gene was also detected. Although the intronexon structures of the Xenopus and mouse UBF genes were found to be essentially identical, the differential splicing of exon 8 found in mammals, was not detected in Xenopus.

INTRODUCTION Transcription of the ribosomal genes by RNA polymerase I requires at least two DNA associated factors, UBF and a second factor variously refered to as SLl, TFLB, factor D or RibI (1-6) which has been recently found to be a specific form of TFIID (7). UBF is a DNA binding protein of the HMG-box family and is to some degree species specific in its activity (1,8-11). The HMG-box is a DNA-binding fold originally identified in HMG1 and 2 (12). It has since been found in a wide range of transcription factors (13-18). UBF has been found to be essential for efficient in vitro transcription by RNA polymerase I and the recombinant *

To whom correspondence should be addressed

EMBL accession

protein

nos

X65690-X65698 (incl.)

can effectively replace its natural counterpart(1,5). Mammalian UBF contains 6 tandemly repeated HMG-box homologies, while the equivalent Xenopus factor (xUBF) contains only five such repeats, essentially lacking the fourth HMG-box of the mammalian UBF (19), figure la. Otherwise, the mammalian and Xenopus UBFs show a very high degree of homology, such that individual HMG-boxes can be easily crossidentified. However xUBF and mammalian UBF cannot substitute for each other in vitro (9). In both mammals and Xenopus, two molecular weight forms of UBF (UBF1 & 2) have been detected (1,20). The two recognised forms of mammalian UBF appear to be derived from the same gene by differential splicing of exon 8, which encodes 37 amino acids (a.a.) of HMG-box 2, figure la (21,22). XUBF1 & 2 differ by 22 a.a., but in this case the variable region lies between HMG-boxes 3 and 4, within the region of major difference between the Xenopus and mammalian UBFs, see again figure la (23). Unlike the mammalian situation, the xUBF1 and 2 cDNAs isolated to date are obviously derived from two different genes (19,23). Southern blotting has also suggested the presence of yet further xUBF genes (23). The essential role of UBF in ribosomal transcription suggests that its different forms could be of functional importance in ribosomal gene regulation. The deletion of major segments of potential DNA binding domains could clearly be of profound importance to the interaction of UBF with the DNA and with the other factors controlling initiation. Consistent with this possibility, the differential splicing which leads to the two mammalian forms of UBF does appear to be regulated to some degree (21). The presence in Xenopus of two or more genes also opens the possibility that the xUBFs are regulated at the transcriptional level. To resolve some of these questions we have isolated two UBF genes from Xenopus and have studied the regulation of the different forms of xUBF mRNA. The data have identified four different xUBF mRNAs and showed that the Xenopus genome has the potential to code at least two more. The differential splicing which gives rise to some of this diversity was also shown to be regulated to a very significant degree during development and differentiation.

3362 Nucleic Acids Research, Vol. 20, No. 13 In order to conform with the nomenclature of the mammalian UBFs we have simply reversed the previous numbering of the molecular weight variants of xUBF. XUBF1 refers here to the higher molecular weight variant, i.e. with the 22 a.a. insertion and xUBF2 to the lower molecular weight variant lacking the 22 a.a. This change has been submitted to the EMBL databank.

%,

--7.3 , - E',- -.

,

.1.

T...,

C,

MATERIALS AND METHODS Preparation of total RNA Xenopus laevis females (Nasco) were induced to lay by an injection of 600IU of human Chorionic Gonadotropin (ICN) and the eggs in vitro fertilised (24). Embryos were staged as of Nieuwkoop and Faber (25) and total RNA was purified by the Guanidium isothiocyanate-lithium chloride procedure (26). Liver, testis and kidney RNAs made by the same protocol were kindly provided by E.St-Jacques. RT-PCR lOOpmol of the more 3' primer was annealed to 2.5 ,Ag of total RNA in 12 Al of H20 by heating to 75°C for 2 min. and then incubating at 37°C for 10 min. 8A41 of 1.66 x concentrated reverse transcriptase buffer (BRL) and 200 units of M-MLV Reverse Transcriptase (BRL) was then added. After 1 hour at 37°C, 29,tl of PCR buffer (Cetus) containing 2.5mM MgC12 and 50 pmol of the 5' primer and 2.5 units of Taq DNA polymerase (BRL or Pharmacia) was added and each sample subjected to 15 or 25 cycles of amplification (cycle = lmin. at 940C, 1.5 min. at 500C and 1.5min. at 72'C) in a thermal cycler (Ericomp). 1/5 of the reaction was directly loaded onto a 2.5% agarose gel, electrophoresed, blotted, probed with homologous 32p labelled DNA sequences and autoradiographed at -750C with Fuji RX film, using a Cronex intensifying screen (Dupont). Signals were quantified by densitometry of the resulting autoradiogram on a Chromoscan Ill (Joyce-Loebl) within the linear density range. Control RT-PCR was carried out with synthetic miRNA transcribed in vitro (27,28) from linearised pA68 and p2clDy, containing the coding regions of the xUBFlIt and xUBF2f3 cDNAs respectively. All primers were synthesized on a Applied Biosystems 391 PCR-MATE and purified on C-18 Sep-Pak columns (Waters) (29). The experiments in figures 1 & 5 and table 1 used primers 15 (5' GGCTGAAGAAAAGATGG) and 20A (5' TTTTCTCCATATTTAAC). The probe used for the experiment in figure 1 was an equimolar mixture of two subcloned fragments derived from the xUBF1 and xUBF2 cDNAs (19,23) by PCR using primers 15 and 20A. Hybridisation was performed in 6 x SSC at 65 °C and the final wash in 1 x SSC at 65°C. Figure 6 used the primers 10 (5' CTGCACAGTACATGGAG) and 11 (5' GATCTCATGCAAAATCC) for RT-PCR and the product was probed with primer 12 (5' CTGCATGCAGTTTCAGG). In this case hybridisation was performed in 6 x SSC at 37°C and the final wash was in 6 x SSC at 500C. Isolation of genomic clones xubfa:

1.4

x

106 clones from

a

XEMBL4

amplified library

prepared from Sau3A partially digested genomic DNA, kindly provided by T.Sargent, were screened with a randomly primed 32p Sty 1- BamHl fragment (pos. 350 to 1020) of the xUBF2 cDNA (23). A single clone was isolated, plaque purified and BamHl fragments also subcloned into pT7T3 U18.

....f"AAGA-6AAi-AGA *:-~..

-+

- ..

aK

,,

Ier"A. *q, rm" .M:

t

e

.N. . _ .i ......... g.W _~4f

ij '. . }

;

~

.

~

'1F

w *_.,

Figure 1. a) Comparative primary structures of the various UBFs known. Shaded and numbered boxes refer to the HMG-box homologies. The positions and sequences of the primers used in b) have been indicated. b) RT-PCR detection of the xUBF1 and 2 mRNAs from various embryonic stages (St.) (25) and adult tissues. c) Control RT-PCR performed using synthetic xUBF1 and 2 mRNAs in varying molar ratios. Both the actual RNA amounts and the measured ratio (Exp. ratio in c) of xUBF1/xUBF2 signals are given. The actual xUBF1/xUBF2 ratios given in b) were obtained from the measured signals after correction using the actual versus measured xUBF l/xUBF2 ratios in c).

1.2 x 106 clones from a XDash II (Stratagene) amplified library, prepared from BamH1 partially digested Xenopus laevis genomic DNA and kindly provided by S.Tafuri, were screened with a randomly primed (30,31) 32p Sty 1 fragment (pos. 350 to 1137) from the xUBF2 cDNA (19). Several clones were plaque purified and characterised and their BamHl fragments subcloned into pT7T3 U18 (Pharmacia). Hybond-N (Amersham) membranes were used according to the manufacturers recommendations. Hybridisation was performed in 6 x SSC at 65'C in an hybridisation oven (Hybaid). Final washes were in 0.1 xSSC at 65°C for 10 min. Autoradiography was at -75°C with Fuji RX film using a Cronex intensifying screen (Dupont). Double-stranded sequencing was performed using specific primers by a combination of two procedures (32,33) and T7 DNA polymerase (Pharmacia).

xubffl:

Pre-mRNA templates and oocyte splicing Pre-xubfa: A segment of the xubfca gene containing the 3' of exon 12, the 5' of exon 13 and the intervening intron was isolated by PCR using primer 15 (5' GGCTGAAGAAAAGATGG) and primer 20A (5' TTTTCTCCATATTTAAC). The product was cleaved in exon 13 with Taql and subcloned at the Smal-Clal sites of pKS + (Stratagene).

Nucleic Acids Research, Vol. 20, No. 13 3363 xubf a

r-i

r-7 I

Presumptive

I

I

-,. I

n

r--7

r--l

r-7

r-7 r--7

1

3

4

m m-

5

6 7 n

8 -

9 r

-

I

I

rY it

L-1

I

2 ° cw gene stucture-

/

/

,

xubf I

20

10 11 12 13 14 15 16 17 18 19 - -- m ~-- - - - -4---n-

bJ

L1-500 bp -J

Figure 2. The structures of the xUBF genes xubfa and xubf(3 obtained from two lambda clones. The exons are shown boxed and numbered, black and shaded boxes refering to the protein coding regions and incomplete intron sequences are indicated by breaks. The presumptive gene structure was derived by combining the data for the -a and -(3 genes.

Pre-xubfi3: The equivalent segment of the xubf( gene was also

isolated by PCR amplification between nucleotides 1411 and 1520 of the xUBF2 cDNA using primers 15 and 8 (5' GCCAGATTTCTTCGGCG) and was subcloned into the BamHl site of pT7T3 U18 (Pharmacia) after addition of BamHl linkers. Capped 32p labelled pre-mRNAs were transcribed in vitro from the above constructs using T7 RNA polymerase (Pharmacia) (27,28) in the presence of 0.5mM m75'ppp5'G (Pharmacia). The RNAs redissolved in 10yd of H20 and 50 nl was injected into the germinal vesicule of 40 to 60 oocytes. Oocytes were incubated for 24 and 30 hours at 19°C before isolation of total RNA (34). 0.5 oocyte equivalents of the RNA were electrophoresed on a 6% acrylamide, 8M urea gel and autoradiographed.

exon 12

xUBF1

QGWGGAAGA'AAGQATGF0GGTATGAAAAA R Z K G A

K

V

X

ATAACACCCCAGCATCAAAGATG R

T

T

N

P

A

S

K

X

xUBF2

GGCTGAAGAAAAGATGGGTATGCATAGAAAAAGAACTAACACCGCAGCATCAAAGATG

xUBF1

GCCACCGAAGATGCTOCAAACGACATTT,GTTGCGTCTTACTAAGGGTCACCAAGTGTT

A

Z

Z

A T E

xUBF2

---_-

A

K

D

A

----

T O

V

X

G X

H

R

K

R

N

T

T

A

A

S

K M

A

-sb a Z=-__

NA A

m

mm

m

_

-

m

s _--_m a--_--

--

K

xUBF1

TTCATAGATCAGTCGCACAGAGATGTGATCACAATAAAATCTGTCTAGTGCTGATGTTAC

xUBF2

TTCCACCGAGACCTGATCACAATTAAAGCTGTCTAGTGCTGATTTGTTACTGTAGTTGGA

xUBF1

TGTAGTTGGGTGATCCATTTATTCTGTCAATGTGTGCE$3TAAAGAGCAGTCTGGCCAG V KS R S a Q

exon 13

xUBF2 xUBFl

TAATCCATGTTTATTTTTAATGTGTGCTCGGCTGAGCO33TAAGGAOCAGATCTGGACAO V R S R S G Q GCAGACAAGAAGAA A

D K K

K

xUBF2 GCCGAcAAGAAGAA

RESULTS xUBF1 and 2 mRNAs are regulated during differentiation and development We have previously shown that the two different molecular weight species of xUBF seen on SDS-PAGE analysis can at least in part be explained by their expression from two distinct genes (23). Since the two xUBFs identified differed by the insertion/deletion of 22 amino acids between HMG boxes 3 and 4, figure la, it was possible that they were also functionally distinct. The differential regulation of xUBFI and 2 would then be of importance for ribosomal gene regulation. To address the question of differential regulation, the relative expression of the xUBF1 and xUBF2 mRNAs was studied during early development and in various tissues. Reverse transcription coupled with quantitative amplification by the polymerase chain reaction (RT-PCR) (35 -37) (U. Busse, PhD Thesis, Laval University, 1992) was carried out using a single set of primers, figure la & b. The primers used were 100% homologous to the identified xUBF2 cDNA sequence but each carried a single mismatch to the xUBF2 cDNA sequence. In vitro transcribed RNA from the cloned cDNAs was used to quantitate the RT-PCR reaction, figure ic. The results obtained after 15 cycles of PCR, (figure lb & c) or after 25 cycles, (data not shown), were essentially identical and were reproducible. The data showed a strong developmental/differentiation based regulation of mRNAs coding the larger and smaller xUBFs. Differentiated tissues such as the ovary and a Xenopus tissue culture line showed a ratio of xUBF1/xUBF2 mRNAs of about 3.2, while kidney, liver and testis showed significantly lower ratios of 1.4, 0.5 and 0.4 respectively. During development, blastula (stage 10) embryos showed very high relative levels of xUBF1 mRNA (6.9) and as development progressed this ratio reduced to between 2.7 and 3.7, representative of the more differentiated tissues, e.g. ovary and tissue culture. At the two

A

D

K

K

K

Figure 3. Gene sequences covering the region of major heterogeneity between the two previously identified xUBF variants. Coding regions are in bold type and the region coding the 22 variable amino acids are underlined. Putative donor and acceptor splice sites are shown boxed.

extremes, the highly undifferentiated stage 10 embryo and the fully differentiated testis, show nearly a 20 fold relative regulation of xUBFI over xUBF2 mRNA. The data therefore strongly suggested a correlation between the preferential expression of xUBF1 mRNA and the lack of cellular differentiation and/or a high rate of cell division.

Cloning and structure of the xUBF genes Unlike the situation in mammals, Xenopus UBFs are expressed from at least two genes (23). Thus the regulation of xUBFl and 2 mRNAs could result from differential gene transcription, processing or both. In order to resolve this problem, we have cloned the xUBF genes. Two clones were isolated from different banks (see Materials & Methods) and could be identified from their sequences as being from distinct genes, xubfax and xubf(3. Clearly, they also encoded the two cDNAs we had previously isolated (19,23). The intron-exon borders and most of the rest of each clone was sequenced and the results are summarised in figure 2. One clone contained the first 17 exons of xubfa, while

the second encoded the last 13 exons of xubfl3, 10 of the 20 exons being found in both clones. The exon-intron boundaries in xubfia and (3 matched exactly in the region common to both clones, allowing us also to create an presumptive overall gene structure, see again figure 2. To our surprise, exon 12, the region coding the extra 22 amino acids in xUBFI, occured not just in one but in both the xubf genes. Figure 3 shows the sequence of the relevant gene segment.

3364 Nucleic Acids Research, Vol. 20, No. 13 -

%pIitt-

i)plct.

S

rl\.iilli_

IV-

"

-

PrimlS 5'ggcggaagaa aagatgg 3' xUBFla GGCGGAAGAA AAGATGGTGG GTATGAAAAG AAAAAGAACT AACACCCCAG xUBF2p ---T---...... ..........

AN1

exon

i..'i

xUBFly

A

_ _ ..___ ___ ___ __ __44

----------

xUBFlac

:) xubf 1-

*tlt TV

4

..

G---

CATCAAAGAT GGCCACCGAA GATGCTGCAA AGGTAAAGAG CAGGTCTGGC

xUBF2p

..........

xUBFly

----------

xUBFla

CAGGCAGACA AGAAGAAAGC GGCAGAGGAG AGGGCTAAAC TGCCAGAGAC -----C - --A-----T--------C--G---------C---A-----T--------C--G-----

xUBF2 xu bt

-----C----

xUBFly

..........

A

-------C-G A-C------- ------G--- ---A-----A

1 4 9;

xUBFla

CCCCAAAACT GCCGAAGAAA TCTGGCAGCA AAGTGTGATT GGAGACTATC -------A-- ---C-------------T--------CT--------A-----C ------

xUBF2J3

xUBFly

I

xUBFla

xUBF2p

395

xUBF1y-

258

xUBFla

TTGCTCGATT TAAGAATGAT CGCGCTAAAG CCCTGAAGGT CATGGAGGCC G-------C-- C--------C ---------- --------AG -----------C-- C --------C ---------AG -------- G-

'h --1

.

xUBF2P

-

*)1 92:,

xUBFly

la -W

Prim2Oa

ACATGGTTAA ATATGGAGAA GA --G------- ---------- A--G -C ------------------3'caatt tatacctctt ct 5S

Figure 5. Sequence of a novel xUBF mRNA (xUBFI-y) obtained during RTPCR aligned with the relevant sequence segments from the previously identified xUBFla and 2( cDNAs. The primers used in amplifying this clone are shown in lower case.

Figure 4. Differential splicing of the -a and -(3 gene transcripts in oocyte. a) structures of the pre-mRNAs prepared in vitro and their expected splicing products. The sizes of the unspliced and the expected spliced products for each gene construct are indicated. b) Analysis of pre-mRNA products obtained after microinjection. Both 24 and 30hr oocyte incubations are shown and the positions of the expected products indicated with their sizes in bases. M refers to the pBR322-HpaII molecular weight marker.

* 0

of

Table 1. Sequence classification of RT-PCR clones obtained using primers 15 and 20A. mRNA

Gene

Ovary

Stage 10

Liver

Total

4 0 3 4

21 0 7 12

Embryos xUBFI

-a

xUBF2

-a -,B

4 0 4 2

13 0 0 6

The numbers relate to the number of equivalent clones obtained and are classified under RNA source, mRNA type and the gene from which they derived. Since the xUBFI and xUBF2 products were cloned separately, the total numbers of xUBF1 and xUBF2 clones were simply defined by the number of clones analysed. The xUBFI/xUBF2 ratios therefore have no biological meaning and cannot be compared to those in figure 1. The data for Stage 10 RNA was obtained from two independent RT-PCR and cloning steps, similar numbers of clones being analysed from each cloning.

A 5'-GT donor splice site occurred on both genes at the beginning and immediately following the segment encoding the extra 22 amino acids. Both genes therefore had the potential to code a long and a short form of xUBF (xUBFl and 2) via differential

splicing. Differential splicing in oocyte Despite the potential of both xUBF genes to each encode an xUBFI and 2, we had only isolated cDNAs for xUBFI from xubfo and for xUBF2 from xubJJ (19,23). The potential of each gene sequence to be differentially spliced was therefore tested by studying the splicing of in vitro transcripts microinjected into Xenopus oocytes, figure 4, see also Materials and Methods. The xubfcx transcript gave rise to two RNAs having the sizes expected

Figure 6. The mammalian UBF heterogeneity is not detected in Xenopus. a) Differentially spliced segments of the two recognised mammalian UBF mRNAs. The positions of the primer 10 and 11 sequences, used to amplify this region from the Xenopus mRNA and the oligonucletide probe, are shown. b) Electrophoretic separation of the RT-PCR products; track 1, the ethidium bromide staining and track 2, specific hybrisation using the probe shown in a). M refers to the pBR322-HpaII molecular weight marker.

for the two mature differentially spliced products, (201 and 267 bases). It was therefore tentatively concluded that the xubfcx gene sequence contained the splicing information to code for both an xUBF1ca and an xUBF2a The microinjected xubff3 transcript however showed no detectable splicing into either mRNA form, figure 4b. This may have been the result of the particular preRNA construct used for microinjection, despite the fact that the in vitro xubfat and (3 transcripts were very similar in both length and sequence, figure 4a. Alternatively, the xubfi3 pre-RNA may simply be inherently less efficiently spliced.

Differential splicing in vivo The close similarity between the xubfa and (3 gene sequences in the region of exon 12, figure 3, made the task of differentiating the in vivo splicing products of one gene from those of the other somewhat difficult. To overcome this problem, RT-PCR was again performed as in figure 1, but this time the products corresponding to the xUBF1 and xUBF2 mRNAs were isolated by gel electrophoresis, cloned separately and a number of xUBF1 and xUBF2 clones were sequenced. The results for the mRNA

Nucleic Acids Research, Vol. 20, No. 13 3365 from two tissues and from stage 10 embryos clearly demonstrated differential splicing of xubfa and a transcripts in vivo, see table 1. Despite the relatively poor statistics for individual mRNA species within a given tissue, a clear pattern of splicing preferences could be discerned. Of a total of 40 clones sequenced, 21 were selected from clones encoding the extra 22 amino acids of xUBFl and all of these were found to be derived from the xubfa gene. The 19 clones selected from the shorter xUBF2 mRNA were however found to be derived from both the -a and-,8 genes. Thus the -(3 gene was predominantly or exclusively spliced to produce xUBF2 mRNAs while the -a gene produced both mRNA species. In figure 1, it was shown that the xUBF2 mRNAs somewhat predominated in liver, while in stage 10 embryos the longer xUBFI mRNAs greatly predominated, intermediate situations occuring at other stages and in other tissues. Table 1 shows that this appeared to be the result of regulation at the splicing level. In ovary and liver, -a and -(3 gene transcripts were represented equally among the clones encoding xUBF2, whereas in stage 10 embryos, none of the xUBF2 clones were derived from the -a gene. It can therefore be concluded that the xUBFI/xUBF2 mRNA ratio was regulated at the level of xubfat pre-mRNA splicing, the xubft pre-mRNA being constitutively spliced to the xUBF2 form, as shown above.

Expression of a -y gene Apart from the xubfai and ( genes, we have previously demonstrated by Southern blotting the presence in the Xenopus genome of at least one other locus cross-hybridising with the xUBF cDNA (23). However, it was not at that time possible to decide whether this sequence represented a further xUBF gene. While cloning the RT-PCR products discussed above, a single clone was isolated whose sequence diverge significantly from those of the -a and -(3 genes, figure 5. We concluded that this clone, which encoded a fragment of an xUBFI, must have derived from the expression of a third gene, xubfy , figure 5. This adds yet a further degree of heterogeneity to the xUBF population.

The differential splicing which gives rise to the two mammalian UBFs does not occur in Xenopus Two mouse UBFs have been shown to be expressed from a single gene by differential splicing of exon 8 (21). Since comparison of our sequence data with the mouse data demonstrated that the exon boundaries were essentially conserved between mouse and Xenopus, it was possible that this same differential splicing could also occur in Xenopus. A further RT-PCR experiment was therefore carried out between exons 7 and 10, figure 6, see also Materials and Methods. A strong signal at the expected size of 378 b.p. was noted from mRNAs carrying exon 8. However, no shorter (267 b.p.) PCR product, corresponding to mRNAs lacking exon 8, was detected even after very extended exposure of track 2, figure 6. Since the PCR primers matched both the xubf-a and -(3 gene transcripts, it was concluded that neither transcript was subjected to detectable levels of differential splicing of exon 8.

DISCUSSION The isolation of two of the Xenopus genes coding for the ribosomal transcription factor xUBF has allowed us to explain both major and minor levels of heterogeneity in this factor. The

major heterogeneity, a deletion/insertion of 22 a.a. between HMG-boxes 3 and 4, is generated by differential splicing. Both xubfax and (3 genes code these 22 a.a., however only xubfa premRNAs are detectably spliced to give rise to the longer xUBFl mRNA, all -(3 gene transcripts apparently being spliced to the shorter xUBF2 form. The differential splicing of xubfa transcripts was shown to be developmentally regulated and also regulated during differentiation. In very early developmental stages, xubfa transcripts give rise solely to xUBF1 mRNAs, while at later stages and in differentiated tissues, an increasingly larger proportion of these same transcripts were found to be spliced into the xUBF2 form. This regulation of differential splicing gave an overall variation of nearly 20 fold in the ratio of xUBFP to xUBF2 mRNAs. The xUBFl/xUBF2 mRNA ratio was very high in early embryos, lower in later embryos, the ovary and tissue culture and yet lower in fully differentiated tissues such as the kidney, liver and testis. The xUBFP/xUBF2 ratio thus generally correlated with the rate of cellular division or growth. Since ribosomal gene expression is growth regulated, this correlation suggests the possibility that the xUBFP and -2 proteins are functionally distinct. The xubfa and (3 genes give rise to three distinct xUBF species, xUBF1Ia, xUBF2ci and xUBF2(3. The present study also identified an xUBFl mRNA species from a third gene, xubfry, whose existence had been previously deduced from Southern blots. This adds a fourth expressed xUBF species, xUBFI'y. It remains to be seen if transcripts from this third gene can be differentially spliced to also produce an xUBF2 mRNA and whether the xubfl gene may infact produce a low level of an xUBFI mRNA. Thus, at least four different xUBF species are expressed in Xenopus (xUBF1a, xUBF2a, xUBF2( and xUBF1l) and the potential exits for the low level expression of a further two (xUBF1( and xUBF2-y).

ACKNOWLEDGEMENTS We wish to thank Dr Dimcho Bachvarov for advice and assistance during the early stages of this work and Dr Benoit Chabot of Sherbrooke University for discussion on the splicing experiments. This work was supported by the Medical Research Council of Canada (MRC). A.G. was the recipient of a bursary from the FCAR of Quebec and T.M. was a Scholar of the MRC and is presently Chercheur Boursier of the FRSQ, Qu6bec. T.M. is a member of the Centre de Recherche en Canc6rologie de l'Universite Laval which is supported by the FCAR of Qu6bec.

REFERENCES 1. Bell,S.P., Jantzen,H.-M. and Tjian,R. (1990) Genes. Dev., 4, 943-954. 2. Schnapp,A., Clos,J., Hadelt,W., Schreck,R., Cvekl,A. and Gnummt,I. (1990) Nucleic. Acids. Res., 18, 1385-1393. 3. Mishima,Y., Financsek,I., Kominarni,R. and Muramatsu,M. (1982) Nucleic Acids Res., 10, 6659-6670. 4. Tower,J., Culotta,V.C. and Sollner-Webb,B. (1986) Mol. Cell Biol., 6, 3451 -3462. 5. McStay,B., Hu,C.H., Pikaard,C.S. and Reeder,R.H. (1991) EMBO J., 10, 2297-2303. 6. Smith,S.D., Oriahi,E., Lowe,D., Yang-Yen,H.-F., O'Mahony,D., Rose,K., Chen,K. and Rothblum,L.I. (1990) Mol. Cell Biol., 10, 3105-3116. 7. Comai,L., Tanese,N. and Tjian,R. (1992) Cell, 68, 965-976. 8. Jantzen,H.-M., Admon,A., Bell,S.P. and Tjian,R. (1990) Nature., 344, 830-836. 9. Bell,S.P., Pikaard,C.S., Reeder,R.H. and Tjian,R. (1989) Cell, 59, 489-497.

3366 Nucleic Acids Research, Vol. 20, No. 13 10. Schnapp,A., Rosenbauer,H. and Grummt,I. (1991) Mol. Cell Biochem., 104, 137-147. 11. Pikaard,C.S., Smith,S.D., Reeder,R.H. and Rothblum,L. (1990) Mol. Cell Biol., 10, 3810-3812. 12. Reeves,R. and Nissen,M.S. (1990) J. Biol. Chem., 265, 8573-8582. 13. Travis,A., Amsterdam,A., Belanger,C. and Grosschedl,R. (1991) Genes Dev., 5, 880-894. 14. Parisi,M.A. and Clayton,D.A. (1991) Science, 252, 965-969. 15. Kolodrubetz,D. and Burgum,A. (1990) J. Biol. Chem., 265, 3234-3239. 16. Kolodrubetz,D. (1990) Nucleic. Acids. Res., 18, 5565. 17. Sinclair,A.H., Berta,P., Palmer,M.S., Hawkins,J.R., Griffiths,B.L., Smith,M.J., Foster,J.W., Frischauf,A.-M., Lovell-Badge,R. and Goodfellow,P.N. (1990) Nature., 346, 240-244. 18. Gubbay,J., Collignon,J., Koopman,P., Capel,B., Economou,A., Munsterberg,A., Vivian,N., Goodfellow,P. and Lovell-Badge,R. (1990) Nature., 346, 245-250. 19. Bachvarov,D. and Moss,T. (1991) Nucleic Acids Res., 19, 2331-2335. 20. Pikaard,C.S., McStay,B., Schultz,M.C., Bell,S.P. and Reeder,R.H. (1989) Genes Dev., 3, 1779-1788. 21. Hisatake,K., Nishimura,T., Maeda,Y., Hanada,K., Song,C.Z. and Muramatsu,M. (1991) Nucleic Acids Res., 19, 4631-4637. 22. O'Mahony,D.J. and Rothblum,L.I. (1991) Proc. Natl. Acad. Sci. USA., 88, 3180-3184. 23. Bachvarov,D., Normandeau,M. and Moss,T. (1991) FEBS Lett., 288, 55-59. 24. Newport,J. and Kirschner,M. (1982) Cell, 30, 675-686. 25. Nieuwkoop,P.D. and Faber,J. (1967) Normal table of Xenopus laevis (Daudin); A systematical and chronological survey of the developement from the fertilized egg till the end of metamorphosis. North-Holland Publishing Company, Amsterdam. 26. Cathala,G., Savouret,J-F., Mendez,B., West,B.L., Karin,M., Martial,J.A. and Baxter,J.D. (1983) DNA, 2, 329-335. 27. Krieg,P.A. and Melton,D.A. (1987) Methods Enzymol., 155, 397-415. 28. Krieg,P.A. (1990) Nucleic. Acids. Res., 18, 6463. 29. Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. 30. Feinberg,A.P. and Vogelstein,B. (1983) Anal. Biochem., 132, 6-13. 31. Feinberg,A.P. and Vogelstein,B. (1984) Anal. Biochem., 137, 266-267. 32. Riley,D.E. (1989) Gene, 75, 193-196. 33. Del Sal,G., Manfioletti,G. and Schneider,C. (1989) BioTechniques, 7, 514-518. 34. De Winter,R.F.J. and Moss,T. (1986) Cell, 44, 313-318. 35. Kawasaki,E.S., Clark,S.S., Coyne,M.Y., Smith,S.D., Champlin,R., Witte,O.N. and McCormick,F.P. (1988) Proc. Natl. Acad. Sci. USA, 85, 5698-5702. 36. Rappolee,D.A., Mark,D., Banda,M.J. and Werb,Z. (1988) Science, 241, 708-712. 37. Rappolee,D.A., Brenner,C.A., Schultz,R., Mark,D. and Werb,Z. (1988) Science, 241, 1823-1825.