Artificial Cells, Nanomedicine, and Biotechnology, 2015; Early Online: 1–9 Copyright © 2015 Informa Healthcare USA, Inc. ISSN: 2169-1401 print / 2169-141X online DOI: 10.3109/21691401.2015.1011808
Artificial Cells, Nanomedicine, and Biotechnology Downloaded from informahealthcare.com by Kainan University on 04/08/15 For personal use only.
Vascular endothelial growth factor 165-transfected adipose-derived mesenchymal stem cells promote vascularization-assisted fat transplantation Chen Jun-jiang & Xi Huan-jiu Department of Human Anatomy, China Medical University, Liaoning, P. R. China
of ASCs. Conclusion: After transfection with the VEGF165adenoviral vector, ASCs demonstrate sustained expression of the target protein and obviously promote the proliferation of ASCs, which lay the foundation for the in vitro experiments on transplantation of VEGF165 combined with ASCs, for the treatment of tissue defects.
Abstract Objective: To investigate the effect of vascular endothelial growth factor 165 (VEGF165) and adipose-derived mesenchymal stem cells (ASCs) in promoting the survival of fat grafts, and to provide new methods and theoretical evidence for increasing the survival rate of autologous fat particle grafts. Methods: The VEGF165 gene was recombined with the target fragment, and the recombinant gene was introduced into adenovirus pAdEasy-1 system; the virus was then packaged and the titer was detected. The control group received the same processing. ASCs were cultured and subcultured, and then identified with immunohistochemistry and adipogenic differentiation assay. The subsequent experiments were performed in three groups: the VEGF165 gene-virus group, blank virus group, and control group. After the viral solution was transfected into the ASCs, the viral transfection efficiency was detected using a tracing factor, EGFP. The expression of VEGF165 mRNA and protein in the transfected cells were determined. The proliferation of ASCs in each group was detected with the MTT assay. Results: (1) Recombinant adenoviral vector was constructed successfully in the two groups and the packaging was identified. The viral titer was 2.0 108 pfu/ml and 1.9 108 pfu/ml, which was in line with the requirements of the subsequent trans fection experiments. (2) Immunohistochemistry and adipogenic differentiation results showed that the culture of ASCs was successful, and the cultured cells could serve as seed cells in this experiment. (3) The RT-PCR analysis showed that the relative optical density of VEGF165 mRNA expression was 0.76 0.05 in the experimental group, and there were statistically significant differences compared with the values obtained for the other two groups (P 0.05). (4) The western blot analysis showed that the relative optical density of VEGF165 protein expression in the experimental group was significantly higher than that in the other two groups (P 0.05). (5) The proliferation of ASCs was significantly enhanced after transfection in the experimental group, relative to the other two groups (P 0.05). This evidence indicated that VEGF165 significantly promoted the proliferation
Keywords: ASCs, fat transplantation, recombinant adenoviral vectors, VEGF165
Introduction The restoration of soft tissue defects and deficiencies arising due to congenital malformations, trauma, tumor resection, and aesthetic needs is the most common problem in field of reconstructive surgery (Verseijden et al. 2012, Gao et al. 2011). To solve the above problems, collagen injection, dermal grafts, synthetic materials, and free fatty tissue transplantation have been widely implemented in clinical work. The existing reagents for the restoration of soft tissue defects include collagen, hyaluronic acid, polyacrylamide hydrogel, polylactic acid, etc., which are artificial allografts. As an allograft cannot become a part of human body tissue, it is prone to transplantation rejection, tissue infection, and perforation caused by graft displacement, thus greatly limiting the application. Autologous fat tissue is regarded as the ideal material for the restoration, because it is fully accepted by the human body, with no rejection, is available from a wide source range, and has a low cost and high efficacy (Lin et al. 2014, Kim et al. 2012). Over a period of more than a hundred years, the technique of autologous fat tissue grafting has been developed and widely applied in the restoration of soft tissue defects caused by cosmetic surgery. According to a long-term follow-up study, it was found that the survival rate of fat tissue grafts was inconsistent, accounting for a range of 20–80%. At the early transplantation period, there was no
Correspondence: Xi Huan-jiu, China Medical University, Shenyang 110005, Liaoning Province, China. Tel: 86 0416-4197105. E-mail: [email protected] (Received 8 January 2015; accepted 21 January 2015)
1
Artificial Cells, Nanomedicine, and Biotechnology Downloaded from informahealthcare.com by Kainan University on 04/08/15 For personal use only.
2 C. Jun-jiang & X. Huan-jiu blood supply established between the fat grafts and the recipient area, so the main nutrient source of adipose tissue relied on the exudation from surrounding tissues, with the oozing distance of 100–200 mm only. At this time, the fat grafts were subject to acute hypoxic-ischemic conditions, a large number of adipose tissue became necrotic in the central transplantation area, and consequently, the necrotic adipose tissue was replaced by fibrous connective tissue (Paek et al. 2014, Donaldson et al. 2014, Zografou et al. 2011). Therefore, at the early period of autologous fat transplantation, a timely establishment of adequate blood supply is very critical for the survival of the fat graft. To improve the survival rate of transplanted adipose tissue, increasing emphasis has turned to cell therapy, especially cell-assisted fat transplantation (Lin et al. 2014, Bahn et al. 2012). So far, adipose-derived mesenchymal stem cell (ASC)-assisted autologous fat transplantation has been proven to effectively improve the survival rate of fat grafts. Compared with bone marrow-derived stromal stem cells, ASCs are considered as the optimal option for the cell-assisted fat transplantation, because a lot of ASCs can be obtained through a liposuction. As a precursor of adipose cells, ASCs are involved in the reconstruction of various adipose tissues, including growth and development, morbid obesity, post-injury or post-hypoxia repair, as well as tissue expansion induced by mechanical forces. The process of adipose tissue reconstruction is mediated by the balance between adipocyte necrosis or apoptosis and adipose tissue regeneration, accompanied by the reconstruction of capillaries. During the process of adipose tissue reconstruction, ASCs differentiate into adipocytes or vascular endothelial cells, and release pro-angiogenic growth factors, thus promoting remodeling and angiogenesis of the adipose tissue (Uysal et al. 2014, Shen et al. 2013, Chua et al. 2013). Previous studies have shown that increasing the survival rate of fat granule grafts is closely attributed to many factors (Strassburg et al. 2013, Ni et al. 2014, Joo et al. 2012). The vascular endothelial growth factor (VEGF) is one of the most important pro-angiogenic factors, and plays an important role in vascular regeneration. VEGF can promote the proliferation and migration of vascular endothelial cells, promote angiogenesis, prolong the viability of vascular endothelial cells, enhance vascular permeability, and change the extracellular matrix; it also contributes to tissue repair and wound healing, inflammation, and tumorigenesis. In addition, VEGF promotes revascularization and increases the survival of the fat grafts (Nauta et al. 2013, Kim et al. 2014). In this study, we transfected ASCs with the VEGF165 gene and established ASCs that stably express the VEGF165 gene, in an effort to explore the effect of the VEGF165 gene in fat transplantation and the double the effects of VEGF165 and ASCs in promoting the survival of fat grafts. Further, we clarified the molecular mechanisms associated with the survival rate of fat grafts from the perspective of cytokines, providing new methods and theoretical bases for increasing the survival rate of fat granule grafts.
Materials and methods Reagents The donor plasmid containing the human VEGF165 gene was purchased from ATCC (USA). The adenovirus pAdEasy-1 system and the viral titer detection kit were provided by Stratagene (USA). The DNA ligation kit, gel extraction kit, plasmid extraction kit, DNA/RNA Marker, RT-PCR kit, and restriction enzymes were purchased from TaKaRa Co. Ltd. (Japan). The Ultrapure plasmid extraction kit was provided by QIAGEN (Germany). Lipofectamine 2000, Opti-MEM and TRIzol reagents were purchased from Invitrogen Corporation (USA). Rabbit anti-human VEGF165 monoclonal antibody, secondary antibody, and b-actin were provided by Santa Cruz Biotechnology Inc. (USA). DMEM medium, trypsin, and fetal bovine serum were purchased from Gibco (USA). HEK293A cells, DH5a competent cells and conventional reagents were provided by the Central Laboratory at the First Affiliated Hospital of Liaoning Medical University.
Adipose tissue preparation Adipose tissue samples were harvested from patients with abdominal liposuction, irrespective of gender, who had no infectious or endocrine diseases. The adipose tissue was aspired and frozen at the Biobank in the First Affiliated Hospital of Liaoning Medical University. All involved patients signed the informed consent forms, and the experiments were approved by the Ethics Committee of the Affiliated First Hospital of Liaoning Medical University.
Primer sequence The primers were designed and synthesized, and gene sequencing was performed at TaKaRa Company (Table I).
Construction and packaging of the recombinant adenoviral vector The donor plasmid containing the human VEGF165 gene served as a template for PCR amplification. The PCR parameters were as follows: 98°C for 10 s, 55°C for 10 s, and 72°C for 30 s, for 30 cycles, followed by 72°C for 10 min. The product fragments at about 580 bp were retrieved and digested with Sal I/Pst I, purified, and precipitated with ethanol. In the pAdEasy-1 system, the pShuttle vector was used as a substrate for the double restriction enzyme digestion reaction, and the pShuttle vector fragment of approximately 8.9 kb was retrieved and connected with the aforementioned fragments. Positive clones were screened after recombination, and the sequencing was identified to construct a recombinant adenovirus shuttle body (pShuttle-VEGF165-IRESEGFP-1). The above products were digested with Pme I and mixed with BJ5183-competent cells in pAdEasy-1, receiving an electric shock in an electroporation device at 200 W, Table I. PCR primer sequence. Name VEGF165-F VEGF165-R b-actin-F b-actin-R
Sequence (5′-3′) GACGGATCCATGAACTTTCTGCTCTCTTGGGTGC TGAAAGCTTTCACCGCCTTGGCTTGTCAC GGGACCTGACTGACTACCTC TCATACTCCTGCTTGCTGAT
Effect of VEGF165 and ASCs in promoting fat transplantation 3
Artificial Cells, Nanomedicine, and Biotechnology Downloaded from informahealthcare.com by Kainan University on 04/08/15 For personal use only.
2.5 kV, 25 mF. The pAd-VEGF165-IRES-EGFP-1 recombinants were constructed and extracted, the ultrapure fragment was digested with Pac, and the HEK293A cells were transfected with Lipofectamine 2000 for 7 days for the virus package. Transfection efficiency was observed with a tracing factor EGFP; then the Ad-VEGF165-IRES-EGFP-1 viral solution was obtained through three repeated freezing-thawing cycles, and stored at 80°C after viral titers were determined. The control virus Ad-IRES-EGFP-1 was packaged with the same methods.
Culture and subculture of human ASCs The adipose tissue obtained through liposuction was repeatedly washed three times with PBS and digested with 0.25% type I collagenase in a water bath at 37°C for 30 min, followed by three concussions. Subsequently, the collagenase solution was thoroughly mixed with the adipose tissue suspension, and the collagenase digestion was terminated with an equal volume of complete culture medium (including high-glucose DMEM 10% fetal calf serum 1% double antibodies). The suspension was then filtered with a 200mesh to remove undigested fibrous connective tissue, and centrifuged at 1200 g for 5 min to remove the suspended adipocytes and lipid droplets. After the supernatant was discarded, cells were resuspended in 1 mL of complete culture medium and incubated with six times the volume of red blood cell lysate at room temperature in a sterile solution for 6 min, and centrifuged at 1200 g/min for 5 min. The cells were counted under a microscope after the removal of supernatant, and then resuspended in the complete medium and incubated at 1 106 cells/dish on the 10 cm culture dish, with an appropriate volume of complete culture medium. The culture medium was replenished every 3 days, and cells were subcultured at the ratio of 1/3. After subculture, the complete medium was discarded, the subcultured cells were rinsed with PBS twice, and visualized with trypsin solution under a microscope. When the cells reached 80–90% confluence, the complete medium containing fetal bovine serum was added to terminate the digestion, and the cells adhering at the bottom of the culture flask were removed by repeated pipetting. Subsequently, the cell suspension was transferred to a centrifuge tube, at 1200 g/min for 5 min, followed by the removal of the supernatant. The cells were resuspended in complete culture medium and inoculated in a petri dish. Passage 3 ASCs were used for the present study.
Immunohistochemical staining of ASCs ASCs at the third generation were digested with 2% trypsin solution and seeded onto the coverslips in 6-well plates at 37°C in the humidified incubator of 5% CO2. The cells were then rinsed with PBS three times, fixed in 1 mL of 4% paraformaldehyde at room temperature for 20 min (without shaking), infiltrated with 1 mL of PBC containing 0.5% Triton X-100 for 5 min (without shaking), treated with 50–100 mL of 3% hydrogen peroxide for 10 min, and blocked with 50–100 mL of 5% bovine serum albumin for 30 min. After blockage, cells were incubated with antibodies (1/300; CD45 for hematopoietic stem/progenitor cells and fibroblasts, and CD106 for bone marrow stem cells) at 4°C in the wet box
overnight, and with secondary antibody (1/300) at 37°C for 30 min. The cultured cells were visualized with fresh DAB chromogenic reagent (third antibody) at room temperature for 20 min, counterstained with hematoxylin, mounted and observed under the microscope.
Adipogenic induction and differentiation of ASCs ASCs at the third generation were digested with trypsin solution and inoculated onto the coverslips in 6-well culture plates at the density of 105 cells per hole, at 37°C in the humidified environment of 5% CO2, overnight. After cells began to adhere, the culture medium was changed to an adipogenic induction medium, twice per week. Only the control medium was added to the control group. At 2 weeks after culture, cells in the control group and the induction group were stained with Oil Red O, to confirm the presence of lipid droplets.
Experimental grouping The two kinds of viral solutions mentioned above were collected and transfected at the multiplicity of infection (MOI) 100 for 72 h, and the transfection efficiency was observed under an inverted fluorescence microscope (Table II).
RT-PCR detection of VEGF165 mRNA expression in cells Total RNA in cells was extracted with TRIzol reagent, the ratio of optical density at 260 nm/280 nm was calculated and arranged between 1.8 and 2.0. The RT-PCR reaction was performed at the following parameters: 50°C for 30 min, 94°C for 2 min; 30 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 1 min. After the reaction, 5 mL of the reaction solution was directly electrophoresed with 1% agarose gel. The optical density (OD) of each band was analyzed using the gel imaging system. The experiment was repeated three times, and the average OD values were obtained.
Western blot analysis of VEGF165 gene expression in cells Total RNA in cells was extracted with TRIzol reagent, and protein concentration was detected according to the instructions on the BCA kit. Next, 5% stacking gel and 8% separating gel were formulated for polyacrylamide gel electrophoresis at 60 V for 30 min and 150 V for 1 h, and then the separating gel was washed three times and transferred to the transmembrane device at 100 mA for 30 min. Subsequently, the cells were incubated with primary antibody (1/1500) at 4°C overnight, rinsed, and incubated with the secondary antibody. The cells were then developed and incubated at room temperature in the dark for 30 min. The developing reaction was Table II. Experimental groups. Group A (experimental group) B (control group) C (control group)
Treatment ASCs were transfected with VEGF165 gene-containing viral solution (Ad-VEGF165-IRES-EGFP-1) ASCs were transfected with blank viral solution (Ad-IRES-EGFP-1) ASCs were not transfected with viral solution
Note: Cells in the three groups were routinely cultured for 72 h.
4 C. Jun-jiang & X. Huan-jiu data were expressed as the mean standard deviation (x s), and the differences among groups were compared using the one-way analysis of variance (one-way ANOVA). A value of P 0.05 was considered a significant difference.
Results
Artificial Cells, Nanomedicine, and Biotechnology Downloaded from informahealthcare.com by Kainan University on 04/08/15 For personal use only.
Construction and packaging of the recombinant adenoviral vector
Figure 1. Comparison of recombinant adenoviral vectors by agarose gel electrophoresis. Lane 1: Marker; Lane 2: Electrophoretic band of the experimental group [VEGF165 adenoviral vector (Ad-VEGF165IRES-EGFP-1) was digested with Pac I]; Lane 3: Electrophoretic band of the control group [blank adenoviral vector (Ad-IRES-EGFP-1) was digested with Pac I].
terminated by washing the eluents three times. The OD values of the target band and internal reference were analyzed using the gel imaging system. The experiment was repeated three times and the average OD values were obtained.
ASCs proliferation in each group After ASCs in each group were cultured for 24 h and digested with trypsin, the cells were seeded onto the 96-well culture plates at 2 103 cells/hole for 24 h, each group containing ten counter holes. After the cells became adherent, 20 mL (15 g/L) of MTT solution was added to each hole and the cells were cultured for a further 4 h. Then, the supernatant was discarded and 200 mL of DMSO was added to each hole, and the cells were oscillated for 10 min. The optical density at 490 nm was determined using a microplate reader, and the rates of cell growth and proliferation were calculated.
Statistical analysis Statistical analysis was performed using the SPSS 19.0 software for Windows (SPSS, Chicago, IL, USA). Measurement
The gene sequencing results showed that the VEGF165 gene was fully connected to the recombinant adenoviral vector. The imaging results of gel electrophoresis showed that two bands at 3 kb and 30 kb were visible after Ad-VEGF165-IRESEGFP-1 and Ad-IRES-EGFP-1 were digested with Pac I, suggesting that the recombinant adenoviral vectors in the two groups had been successfully constructed (Figure 1). After the HEK293A cells were transfected with two recombinant viral vectors, a large number of green fluorescent proteins were expressed in the cells, observed under a fluorescence microscope (Figure 2). A similar cytopathic effect was observed in the two groups, for example, cell antennae were recovered, cells became swollen and round, and some cells were detached and suspended (Figure 3). The viral titers were detected as 2.0 108 pfu/mL and 1.9 108 pfu/mL, respectively, which was in line with the requirements of the subsequent transfection experiments.
Morphology of the cultured ASCs When the cells were incubated, a large amount of lipid droplets, and a small amount of red blood cells and fibroblasts were observed. As the duration of culture was prolonged, the culture medium was replenished many times and the cells were basically cleared away. After 24 h of culture, a small amount of large cells began to adhere, and flat monolayer cells were visible under an inverted microscope. Some cells had long bodies, like fibroblasts. After 48 h of culture, most of the ASCs adhered and extended into a fusiform shape, showing thick protrusions. At 5–7 days after culture, the cells gradually divided and fused into a single layer, distributing in clusters. The subcultured ASCs were spindle-shaped, with nuclei in the center; the majority of the cells had one nucleolus (Figure 4A) and occasionally had two nuclei (Figure 4B), round or oval; the mixed cells gradually decreased as the
Figure 2. Green fluorescence distribution after HEK293A cells were transfected with the adenoviral vector ( 40). (A) Expression of green fluorescence protein after HEK293A cells were transfected with VEGF165 adenoviral vectors. (B) Expression of green fluorescence protein after HEK293A cells were transfected with empty adenoviral vectors.
Artificial Cells, Nanomedicine, and Biotechnology Downloaded from informahealthcare.com by Kainan University on 04/08/15 For personal use only.
Effect of VEGF165 and ASCs in promoting fat transplantation 5
Figure 3. Viral packaging map after HEK293A cells were transfected with the adenoviral vector ( 40). (A–B) After HEK293A cells were transfected with VEGF165 adenoviral vectors and empty adenoviral vectors, similar cytopathic effects were found in the two groups.
subculture duration increased. The average amplification time was 60 h.
group), no fluorescent effect was found under a fluorescence microscope (Figure 9).
Immunohistochemical identification of ASCs
RT-PCR assay results
ASCs at the third generation were subject to immunohistochemical staining. The results of immunohistochemical staining showed that CD44 and CD49d antigen-positive expression was found in cultured cells (Figure 5A and B), while no CD45 or CD106 antigen was expressed (Figure 6A and B).
The relative OD values of VEGF165 mRNA expression in the control group and the blank group were 0.43 0.04 and 0.39 0.04, respectively, there was no significant difference between the two groups (P 0.05). The relative OD values of VEGF165 mRNA expression in the experimental group was significantly increased compared with values in the other two groups, accounting for 0.76 0.05 (P 0.05) (Figure 10).
Adipogenic induction and differentiation of ASCs ASCs at the third generation were subjected to adipogenic differentiation, and stained with Oil Red O, 2 weeks later. In the adipogenic differentiation group, intracellular lipid droplets were visible in the ASCs after 2 weeks of culture (Figure 7A and B). The subsequent staining with Oil Red O showed positive results in the adipogenic induction group and negative results in the control group (Figure 8A and B).
Expression in the ASCs after viral transfection After ASCs were transfected with two viral packaging solutions (experimental group and control group), a strong green fluorescent protein expression was observed under a fluorescence microscope, with a large amount of ASCs expressing green fluorescent protein and having high transfection efficiency. In the ASCs without any transfection (control
Western blot assay results The relative OD values of VEGF165 protein expression in the experimental group, control group, and blank group were 1.08 0.11, 0.31 0.09, and 0.29 0.05, respectively. There was no significant difference between the control group and the blank group (P 0.05); the experimental group had a significantly higher OD value than the other two groups (P 0.05) (Figure 11).
ASC proliferation after transfection After ASCs in the three groups had been cultured for 24, 48, 72, 96, and 120 h, the OD value of the cultured ASCs was determined by the MTT assay, and the cell proliferation curve was plotted according to the OD values measured on the microplate reader. The results showed that ASCs in the
Figure 4. Common shapes of adipose-derived mesenchymal stem cells, with one nucleolus (A) or several nuclei (B) ( 400).
Artificial Cells, Nanomedicine, and Biotechnology Downloaded from informahealthcare.com by Kainan University on 04/08/15 For personal use only.
6 C. Jun-jiang & X. Huan-jiu
Figure 5. CD44 (A) and CD49d (B) antigen were positively expressed in ASCs ( 400).
Figure 6. CD45 (A) and CD106 (B) antigens were negatively expressed in ASCs ( 400).
Figure 7. Formation of lipid droplets after adipogenic induction of ASCs. (A) Lipid droplets formed within 2 weeks after adipogenic induction ( 200). (B) Intracellular lipid droplets ( 1000).
Figure 8. Oil Red O staining after adipogenic induction of ASCs. (A) Positive results at 2 weeks after adipogenic induction ( 400). (B) Negative results in the control group ( 400).
Artificial Cells, Nanomedicine, and Biotechnology Downloaded from informahealthcare.com by Kainan University on 04/08/15 For personal use only.
Effect of VEGF165 and ASCs in promoting fat transplantation 7
Figure 9. Green fluorescence distribution in the ASCs ( 200). (A) Green fluorescence expression in the ASCs of the experimental group. (B) Green fluorescence expression in the ASCs of the control group. (C) The untransfected ASCs under the fluorescence microscope.
control group and the blank group grew slowly, with no significant difference between the two groups (P 0.05). After transfection, the proliferation of ASCs in the experimental group was significantly increased compared with that in the other two groups (P 0.05), indicating that VEGF165 significantly improves the growth and proliferation of ASCs (Figure 12).
Discussion Screening of seed cells The existing methods of treating tissue defects have many shortcomings, such as necrosis and absorption, lack of sources, and scar at donor area. Therefore, it is urgent that we search for the optimal therapy for tissue defects, and the development of tissue engineering introduces a novel avenue. With the advances in gene transfection,
cell transplantation and tissue engineering technologies, gene therapy has achieved a rapid progress in promoting angiogenesis in ischemic tissue. The key in tissue engineering is to create a three-dimensional complex with seed cells and scaffolds, in which the choice of seed cells is very important (Cianfarani et al. 2013, Chung et al. 2013, Ferraro et al. 2013). A variety of stem cells have been successfully isolated using modern medical technologies, which provide evidence for the exploration of biological regulation mechanisms of stem cells and the evaluation of therapeutic potential in many human diseases. Stem cells can be generally divided into embryonic stem cells and adult stem cells. Although theoretically, embryonic stem cells have the best effect, their immunogenicity, difficulty in harvesting, ethical and religious issues restrict their application. Adult stem cells have a poorer differentiation capacity than embryonic stem
Figure 10. VEGF165 mRNA expression in each group.
Artificial Cells, Nanomedicine, and Biotechnology Downloaded from informahealthcare.com by Kainan University on 04/08/15 For personal use only.
8 C. Jun-jiang & X. Huan-jiu
Figure 11. VEGF165 gene protein expression in each group.
cells, but have attracted wide attention because the social and ethical disputes can be avoided. Previous studies have demonstrated that adult stem cells isolated from the bone marrow could greatly amplify and exert pluripotent proliferation potential in vitro. As both adipose tissue and bone marrow are located in mesodermal tissue, some scholars have hypothesized that adipose tissue contains similar stem cells, and this hypothesis has been subsequently confirmed by a series of experiments (Razmkhah et al. 2014, Hollenbeck et al. 2012). ASCs have the capacity to differentiate into adipocytes, chondrocytes, osteoblasts, muscle cells, and cardiac cells, and can be used as seed cells for tissue engineering (Trojahn et al. 2013). Due to their easy accessibility, rapid amplification, and pluripotent differentiation potential, ASCs are regarded as a kind of adult stem cell with potential application prospects. A recent study found that ASCS are prone to be introduced through exogenous genes, and therefore are also used as the target gene vectors for gene therapy. Regardless of the kind of vector (adenoviral vector, plasmid vector, or retroviral vector), these vectors carrying the target gene can be used to transfect ASCs and efficiently express for a long term in vivo, while the characteristics of stem cells are maintained all the time (Hsiao et al. 2013).
Figure 12. Proliferation curves of ASCs at different time points after transfection.
Selection of growth factors As one of the three elements for the construction of tissue engineering, especially those that promote local revascularization, the cell growth factor plays an important role in promoting tissue restoration. An adequate blood supply is beneficial for the survival, proliferation, and differentiation of seed cells, and also accelerates the restoration of tissue defects. The mechanism responsible for the angiogenesis factors has been an issue of concern in recent years, and a series of cytokines have been discovered and cloned to promote angiogenesis and accelerate collateral circulation. Among the pro-angiogenic cytokines, VEGF is the most powerful factor. There are four subtypes in the VEGF family, arising due to differences in mRNA splicing, and the VEGF can be divided as: VEGF121, 165, 189, and 206, which refer to the number of amino acid residues. Among them, VEGF165 has the strongest activity and the most distribution, so it is regarded as the main pattern in vivo (Yuan et al. 2013, Kim et al. 2014). VEGF165 can specifically act on vascular endothelial cells, promote their division, inhibit apoptosis, and improve the formation of new blood vessels through paracrine mechanisms. Firstly, VEGF binds with its receptors through the regulation of heparin-like molecules, and causes receptor autophosphorylation, activates mitogen-activated protein kinase, selectively enhances the mitosis of endothelial cells, stimulates the proliferation of endothelial cells, and promotes angiogenesis; in addition, increasing the vascular permeability, especially in small blood vessels, could offer nutrients for cell growth and for capillary network construction (Yan et al. 2011, Lee et al. 2013). Based on the above considerations, this experiment adopted VEGF165 to promote angiogenesis in adipose tissue. Due to the specific pro-angiogenesis effects of VEGF, many scholars propose VEGF in the treatment of ischemic diseases. Other scholars have directly applied VEGF protein to promote tissue healing and have achieved certain effects, but VEGF protein interventions require continuous sources because of its short half-life, which is too expensive and inconvenient to be tolerated by the patients, thus limiting the application of in vivo therapy. We found that the above shortcomings could be avoided when the exogenous gene was introduced into the cells and ectopic expression within cells was allowed. Therefore, a gene therapy using local expression of VEGF protein has emerged, to promote tissue regeneration
Effect of VEGF165 and ASCs in promoting fat transplantation 9 and accelerate the restoration of necrotic tissue (Zografou et al. 2013, Uysal et al. 2012).
Artificial Cells, Nanomedicine, and Biotechnology Downloaded from informahealthcare.com by Kainan University on 04/08/15 For personal use only.
Mutual benefits of recombinant adenoviral vector VEGF165 combined with ASCs In this study, we transfected the target gene into ASCs via the adenoviral vector, and then transplanted it into the body, avoiding rejection reactions. The results of the present study showed that after adenoviral vector transfection, VEGF165 mRNA and protein expression levels in the ASCs were significantly upregulated, to levels which can be detected. This evidence indicated that the target genes are expressed in vivo for several weeks or months and then disappear, which is reasonable for the restoration of tissue defects, although no benefits are evident for the treatment of genetic diseases and chronic diseases. Expressed over a period of time, cytokines are qualified for tissue repair, posing no problems of excessive tissue regeneration, abnormal alterations and possible tumorigenicity caused by over-expression. At 24 h of adenoviral transfection, the proliferation of ASCs was much greater than that seen in the control group or the blank group. This evidence leads us to infer that the transfection of the VEGF165 gene-containing adenovirus can not only lead to sustained expression of the target protein, but also significantly promote the proliferation of ASCs, which is a win-win situation and provides evidence for in vitro experiments on the VEGF165-combined ASC transplantation.
Declaration of interest The authors report no declarations of interest. The authors alone are responsible for the content and writing of the paper.
References Bahn JJ, Chung JY, Im W, Kim M, Kim SH. 2012. Suitability of autologous serum for expanding rabbit adipose-derived stem cell populations. J Vet Sci. 13:413–417. Chua KH, Raduan F, Wan Safwani WK, Manzor NF, Pingguan-Murphy B, Sathapan S. 2013. Effects of serum reduction and VEGF supplementation on angiogenic potential of human adipose stromal cells in vitro. Cell Prolif. 46:300–311. Chung E, Nam SY, Ricles LM, Emelianov SY, Suggs LJ. 2013. Evaluation of gold nanotracers to track adipose-derived stem cells in a PEGylated fibrin gel for dermal tissue engineering applications. Int J Nanomedicine. 8:325–336. Cianfarani F, Toietta G, Di Rocco G, Cesareo E, Zambruno G, Odorisio T. 2013. Diabetes impairs adipose tissue-derived stem cell function and efficiency in promoting wound healing. Wound Repair Regen. 21:545–553. Donaldson EE, Ko JM, Kuiper JJ, Chamogeorgakis T, Roberts CW. 2014. Fat in the ventricular septum. Proc (Bayl Univ Med Cent). 27:231–232. Ferraro GA, De Francesco F, Nicoletti G, Paino F, Desiderio V, Tirino V, D’Andrea F. 2013. Human adipose CD34 CD90 stem cells and collagen scaffold constructs grafted in vivo fabricate loose connective and adipose tissues. J Cell Biochem. 114:1039–1049. Gao W, Qiao X, Ma S, Cui L. 2011. Adipose-derived stem cells accelerate neovascularization in ischaemic diabetic skin flap via expression of hypoxia-inducible factor-1a. J Cell Mol Med. 15:2575–2585. Hollenbeck ST, Senghaas A, Komatsu I, Zhang Y, Erdmann D, Klitzman B. 2012. Tissue engraftment of hypoxic-preconditioned adipose-derived stem cells improves flap viability. Wound Repair Regen. 20:872–878. Hsiao ST, Lokmic Z, Peshavariya H, Abberton KM, Dusting GJ, Lim SY, Dilley RJ. 2013. Hypoxic conditioning enhances the angiogenic paracrine activity of human adipose-derived stem cells. Stem Cells Dev. 22:1614–1623.
Joo HH, Jo HJ, Jung TD, Ahn MS, Bae KB, Hong KH, et al. 2012. Adiposederived stem cells on the healing of ischemic colitis: a therapeutic effect by angiogenesis. Int J Colorectal Dis. 27:1437–1443. Kim H, Choi K, Kweon OK, Kim WH. 2012. Enhanced wound healing effect of canine adipose-derived mesenchymal stem cells with lowlevel laser therapy in athymic mice. J Dermatol Sci. 68:149–156. Kim JH, Kim WK, Sung YK, Kwack MH, Song SY, Choi JS, et al. 2014. The molecular mechanism underlying the proliferating and preconditioning effect of vitamin C on adipose-derived stem cells. Stem Cells Dev. 23:1364–1376. Kim KI, Park S, Im GI. 2014. Osteogenic differentiation and angiogenesis with cocultured adipose-derived stromal cells and bone marrow stromal cells. Biomaterials. 35:4792–4804. Lee CS, Watkins E, Burnsed OA, Schwartz Z, Boyan BD. 2013. Tailoring adipose stem cell trophic factor production with differentiation medium components to regenerate chondral defects. Tissue Eng Part A. 19:1451–1464. Lin CY, Chang YH, Sung LY, Chen CL, Lin SY, Li KC, et al. 2014. Longterm tracking of segmental bone healing mediated by genetically engineered adipose-derived stem cells: focuses on bone remodeling and potential side effects. Tissue Eng Part A. 20:1392–1402. Lin RZ, Moreno-Luna R, Li D, Jaminet SC, Greene AK, Melero-Martin JM. 2014. Human endothelial colony-forming cells serve as trophic mediators for mesenchymal stem cell engraftment via paracrine signaling. Proc Natl Acad Sci U S A. 111:10137–10142. Nauta A, Seidel C, Deveza L, Montoro D, Grova M, Ko SH, et al. 2013. Adipose-derived stromal cells overexpressing vascular endothelial growth factor accelerate mouse excisional wound healing. Mol Ther. 21:445–455. Ni X, Sun W, Sun S, Yu J, Wang J, Nie B, et al. 2014. Therapeutic potential of adipose stem cells in tissue repair of irradiated skeletal muscle in a rabbit model. Cell Reprogram. 16:140–150. Paek HJ, Kim C, Williams SK. 2014. Adipose stem cell-based regenerative medicine for reversal of diabetic hyperglycemia. World J Diabetes. 5:235–243. Razmkhah M, Jaberipour M, Ghaderi A. 2014. Downregulation of MMP2 and Bcl-2 in adipose derived stem cells (ASCs) following transfection with IP-10 gene. Avicenna J Med Biotechnol. 6:27–37. Shen T, Pan ZG, Zhou X, Hong CY. 2013. Accelerated healing of diabetic wound using artificial dermis constructed with adipose stem cells and poly (L-glutamic acid)/chitosan scaffold. Chin Med J (Engl). 126:1498–1503. Strassburg S, Nienhueser H, Stark GB, Finkenzeller G, Torio-Padron N. 2013. Human adipose-derived stem cells enhance the angiogenic potential of endothelial progenitor cells, but not of human umbilical vein endothelial cells. Tissue Eng Part A. 19:166–1674. Trojahn Kølle SF, Oliveri RS, Glovinski PV, Kirchhoff M, Mathiasen AB, Elberg JJ, et al. 2013. Pooled human platelet lysate versus fetal bovine serum-investigating the proliferation rate, chromosome stability and angiogenic potential of human adipose tissue-derived stem cells intended for clinical use. Cytotherapy. 15:1086–1097. Uysal CA, Tobita M, Hyakusoku H, Mizuno H. 2012. Adipose-derived stem cells enhance primary tendon repair: biomechanical and immunohistochemical evaluation. J Plast Reconstr Aesthet Surg. 65:1712–1719. Uysal CA, Tobita M, Hyakusoku H, Mizuno H. 2014. The effect of bone-marrow-derived stem cells and adipose-derived stem cells on wound contraction and epithelization. Adv Wound Care (New Rochelle). 3:405–413. Verseijden F, Posthumus-van Sluijs SJ, van Neck JW, Hofer SO, Hovius SE, van Osch GJ. 2012. Comparing scaffold-free and fibrin-based adipose-derived stromal cell constructs for adipose tissue engineering: an in vitro and in vivo study. Cell Transplant. 21:2283–2297. Yan A, Avraham T, Zampell JC, Haviv YS, Weitman E, Mehrara BJ. 2011. Adipose-derived stem cells promote lymphangiogenesis in response to VEGF-C stimulation or TGF-b1 inhibition. Future Oncol. 7:1457–1473. Yuan Y, Gao J, Liu L, Lu F. 2013. Role of adipose-derived stem cells in enhancing angiogenesis early after aspirated fat transplantation: induction or differentiation? Cell Biol Int. 37:547–550. Zografou A, Papadopoulos O, Tsigris C, Kavantzas N, Michalopoulos E, Chatzistamatiou T, et al. 2013. Autologous transplantation of adipose-derived stem cells enhances skin graft survival and wound healing in diabetic rats. Ann Plast Surg. 71:225–232. Zografou A, Tsigris C, Papadopoulos O, Kavantzas N, Patsouris E, Donta I, Perrea D. 2011. Improvement of skin-graft survival after autologous transplantation of adipose-derived stem cells in rats. J Plast Reconstr Aesthet Surg. 64:1647–1656.
Artificial Cells, Nanomedicine, and Biotechnology Downloaded from informahealthcare.com by Kainan University on 04/08/15 For personal use only.
Vascular endothelial growth factor 165-transfected adipose-derived mesenchymal stem cells promote vascularization-assisted fat transplantation Chen Jun-jiang & Xi Huan-jiu Department of Human Anatomy, China Medical University, Liaoning, P. R. China
of ASCs. Conclusion: After transfection with the VEGF165adenoviral vector, ASCs demonstrate sustained expression of the target protein and obviously promote the proliferation of ASCs, which lay the foundation for the in vitro experiments on transplantation of VEGF165 combined with ASCs, for the treatment of tissue defects.
Abstract Objective: To investigate the effect of vascular endothelial growth factor 165 (VEGF165) and adipose-derived mesenchymal stem cells (ASCs) in promoting the survival of fat grafts, and to provide new methods and theoretical evidence for increasing the survival rate of autologous fat particle grafts. Methods: The VEGF165 gene was recombined with the target fragment, and the recombinant gene was introduced into adenovirus pAdEasy-1 system; the virus was then packaged and the titer was detected. The control group received the same processing. ASCs were cultured and subcultured, and then identified with immunohistochemistry and adipogenic differentiation assay. The subsequent experiments were performed in three groups: the VEGF165 gene-virus group, blank virus group, and control group. After the viral solution was transfected into the ASCs, the viral transfection efficiency was detected using a tracing factor, EGFP. The expression of VEGF165 mRNA and protein in the transfected cells were determined. The proliferation of ASCs in each group was detected with the MTT assay. Results: (1) Recombinant adenoviral vector was constructed successfully in the two groups and the packaging was identified. The viral titer was 2.0 108 pfu/ml and 1.9 108 pfu/ml, which was in line with the requirements of the subsequent trans fection experiments. (2) Immunohistochemistry and adipogenic differentiation results showed that the culture of ASCs was successful, and the cultured cells could serve as seed cells in this experiment. (3) The RT-PCR analysis showed that the relative optical density of VEGF165 mRNA expression was 0.76 0.05 in the experimental group, and there were statistically significant differences compared with the values obtained for the other two groups (P 0.05). (4) The western blot analysis showed that the relative optical density of VEGF165 protein expression in the experimental group was significantly higher than that in the other two groups (P 0.05). (5) The proliferation of ASCs was significantly enhanced after transfection in the experimental group, relative to the other two groups (P 0.05). This evidence indicated that VEGF165 significantly promoted the proliferation
Keywords: ASCs, fat transplantation, recombinant adenoviral vectors, VEGF165
Introduction The restoration of soft tissue defects and deficiencies arising due to congenital malformations, trauma, tumor resection, and aesthetic needs is the most common problem in field of reconstructive surgery (Verseijden et al. 2012, Gao et al. 2011). To solve the above problems, collagen injection, dermal grafts, synthetic materials, and free fatty tissue transplantation have been widely implemented in clinical work. The existing reagents for the restoration of soft tissue defects include collagen, hyaluronic acid, polyacrylamide hydrogel, polylactic acid, etc., which are artificial allografts. As an allograft cannot become a part of human body tissue, it is prone to transplantation rejection, tissue infection, and perforation caused by graft displacement, thus greatly limiting the application. Autologous fat tissue is regarded as the ideal material for the restoration, because it is fully accepted by the human body, with no rejection, is available from a wide source range, and has a low cost and high efficacy (Lin et al. 2014, Kim et al. 2012). Over a period of more than a hundred years, the technique of autologous fat tissue grafting has been developed and widely applied in the restoration of soft tissue defects caused by cosmetic surgery. According to a long-term follow-up study, it was found that the survival rate of fat tissue grafts was inconsistent, accounting for a range of 20–80%. At the early transplantation period, there was no
Correspondence: Xi Huan-jiu, China Medical University, Shenyang 110005, Liaoning Province, China. Tel: 86 0416-4197105. E-mail: [email protected] (Received 8 January 2015; accepted 21 January 2015)
1
Artificial Cells, Nanomedicine, and Biotechnology Downloaded from informahealthcare.com by Kainan University on 04/08/15 For personal use only.
2 C. Jun-jiang & X. Huan-jiu blood supply established between the fat grafts and the recipient area, so the main nutrient source of adipose tissue relied on the exudation from surrounding tissues, with the oozing distance of 100–200 mm only. At this time, the fat grafts were subject to acute hypoxic-ischemic conditions, a large number of adipose tissue became necrotic in the central transplantation area, and consequently, the necrotic adipose tissue was replaced by fibrous connective tissue (Paek et al. 2014, Donaldson et al. 2014, Zografou et al. 2011). Therefore, at the early period of autologous fat transplantation, a timely establishment of adequate blood supply is very critical for the survival of the fat graft. To improve the survival rate of transplanted adipose tissue, increasing emphasis has turned to cell therapy, especially cell-assisted fat transplantation (Lin et al. 2014, Bahn et al. 2012). So far, adipose-derived mesenchymal stem cell (ASC)-assisted autologous fat transplantation has been proven to effectively improve the survival rate of fat grafts. Compared with bone marrow-derived stromal stem cells, ASCs are considered as the optimal option for the cell-assisted fat transplantation, because a lot of ASCs can be obtained through a liposuction. As a precursor of adipose cells, ASCs are involved in the reconstruction of various adipose tissues, including growth and development, morbid obesity, post-injury or post-hypoxia repair, as well as tissue expansion induced by mechanical forces. The process of adipose tissue reconstruction is mediated by the balance between adipocyte necrosis or apoptosis and adipose tissue regeneration, accompanied by the reconstruction of capillaries. During the process of adipose tissue reconstruction, ASCs differentiate into adipocytes or vascular endothelial cells, and release pro-angiogenic growth factors, thus promoting remodeling and angiogenesis of the adipose tissue (Uysal et al. 2014, Shen et al. 2013, Chua et al. 2013). Previous studies have shown that increasing the survival rate of fat granule grafts is closely attributed to many factors (Strassburg et al. 2013, Ni et al. 2014, Joo et al. 2012). The vascular endothelial growth factor (VEGF) is one of the most important pro-angiogenic factors, and plays an important role in vascular regeneration. VEGF can promote the proliferation and migration of vascular endothelial cells, promote angiogenesis, prolong the viability of vascular endothelial cells, enhance vascular permeability, and change the extracellular matrix; it also contributes to tissue repair and wound healing, inflammation, and tumorigenesis. In addition, VEGF promotes revascularization and increases the survival of the fat grafts (Nauta et al. 2013, Kim et al. 2014). In this study, we transfected ASCs with the VEGF165 gene and established ASCs that stably express the VEGF165 gene, in an effort to explore the effect of the VEGF165 gene in fat transplantation and the double the effects of VEGF165 and ASCs in promoting the survival of fat grafts. Further, we clarified the molecular mechanisms associated with the survival rate of fat grafts from the perspective of cytokines, providing new methods and theoretical bases for increasing the survival rate of fat granule grafts.
Materials and methods Reagents The donor plasmid containing the human VEGF165 gene was purchased from ATCC (USA). The adenovirus pAdEasy-1 system and the viral titer detection kit were provided by Stratagene (USA). The DNA ligation kit, gel extraction kit, plasmid extraction kit, DNA/RNA Marker, RT-PCR kit, and restriction enzymes were purchased from TaKaRa Co. Ltd. (Japan). The Ultrapure plasmid extraction kit was provided by QIAGEN (Germany). Lipofectamine 2000, Opti-MEM and TRIzol reagents were purchased from Invitrogen Corporation (USA). Rabbit anti-human VEGF165 monoclonal antibody, secondary antibody, and b-actin were provided by Santa Cruz Biotechnology Inc. (USA). DMEM medium, trypsin, and fetal bovine serum were purchased from Gibco (USA). HEK293A cells, DH5a competent cells and conventional reagents were provided by the Central Laboratory at the First Affiliated Hospital of Liaoning Medical University.
Adipose tissue preparation Adipose tissue samples were harvested from patients with abdominal liposuction, irrespective of gender, who had no infectious or endocrine diseases. The adipose tissue was aspired and frozen at the Biobank in the First Affiliated Hospital of Liaoning Medical University. All involved patients signed the informed consent forms, and the experiments were approved by the Ethics Committee of the Affiliated First Hospital of Liaoning Medical University.
Primer sequence The primers were designed and synthesized, and gene sequencing was performed at TaKaRa Company (Table I).
Construction and packaging of the recombinant adenoviral vector The donor plasmid containing the human VEGF165 gene served as a template for PCR amplification. The PCR parameters were as follows: 98°C for 10 s, 55°C for 10 s, and 72°C for 30 s, for 30 cycles, followed by 72°C for 10 min. The product fragments at about 580 bp were retrieved and digested with Sal I/Pst I, purified, and precipitated with ethanol. In the pAdEasy-1 system, the pShuttle vector was used as a substrate for the double restriction enzyme digestion reaction, and the pShuttle vector fragment of approximately 8.9 kb was retrieved and connected with the aforementioned fragments. Positive clones were screened after recombination, and the sequencing was identified to construct a recombinant adenovirus shuttle body (pShuttle-VEGF165-IRESEGFP-1). The above products were digested with Pme I and mixed with BJ5183-competent cells in pAdEasy-1, receiving an electric shock in an electroporation device at 200 W, Table I. PCR primer sequence. Name VEGF165-F VEGF165-R b-actin-F b-actin-R
Sequence (5′-3′) GACGGATCCATGAACTTTCTGCTCTCTTGGGTGC TGAAAGCTTTCACCGCCTTGGCTTGTCAC GGGACCTGACTGACTACCTC TCATACTCCTGCTTGCTGAT
Effect of VEGF165 and ASCs in promoting fat transplantation 3
Artificial Cells, Nanomedicine, and Biotechnology Downloaded from informahealthcare.com by Kainan University on 04/08/15 For personal use only.
2.5 kV, 25 mF. The pAd-VEGF165-IRES-EGFP-1 recombinants were constructed and extracted, the ultrapure fragment was digested with Pac, and the HEK293A cells were transfected with Lipofectamine 2000 for 7 days for the virus package. Transfection efficiency was observed with a tracing factor EGFP; then the Ad-VEGF165-IRES-EGFP-1 viral solution was obtained through three repeated freezing-thawing cycles, and stored at 80°C after viral titers were determined. The control virus Ad-IRES-EGFP-1 was packaged with the same methods.
Culture and subculture of human ASCs The adipose tissue obtained through liposuction was repeatedly washed three times with PBS and digested with 0.25% type I collagenase in a water bath at 37°C for 30 min, followed by three concussions. Subsequently, the collagenase solution was thoroughly mixed with the adipose tissue suspension, and the collagenase digestion was terminated with an equal volume of complete culture medium (including high-glucose DMEM 10% fetal calf serum 1% double antibodies). The suspension was then filtered with a 200mesh to remove undigested fibrous connective tissue, and centrifuged at 1200 g for 5 min to remove the suspended adipocytes and lipid droplets. After the supernatant was discarded, cells were resuspended in 1 mL of complete culture medium and incubated with six times the volume of red blood cell lysate at room temperature in a sterile solution for 6 min, and centrifuged at 1200 g/min for 5 min. The cells were counted under a microscope after the removal of supernatant, and then resuspended in the complete medium and incubated at 1 106 cells/dish on the 10 cm culture dish, with an appropriate volume of complete culture medium. The culture medium was replenished every 3 days, and cells were subcultured at the ratio of 1/3. After subculture, the complete medium was discarded, the subcultured cells were rinsed with PBS twice, and visualized with trypsin solution under a microscope. When the cells reached 80–90% confluence, the complete medium containing fetal bovine serum was added to terminate the digestion, and the cells adhering at the bottom of the culture flask were removed by repeated pipetting. Subsequently, the cell suspension was transferred to a centrifuge tube, at 1200 g/min for 5 min, followed by the removal of the supernatant. The cells were resuspended in complete culture medium and inoculated in a petri dish. Passage 3 ASCs were used for the present study.
Immunohistochemical staining of ASCs ASCs at the third generation were digested with 2% trypsin solution and seeded onto the coverslips in 6-well plates at 37°C in the humidified incubator of 5% CO2. The cells were then rinsed with PBS three times, fixed in 1 mL of 4% paraformaldehyde at room temperature for 20 min (without shaking), infiltrated with 1 mL of PBC containing 0.5% Triton X-100 for 5 min (without shaking), treated with 50–100 mL of 3% hydrogen peroxide for 10 min, and blocked with 50–100 mL of 5% bovine serum albumin for 30 min. After blockage, cells were incubated with antibodies (1/300; CD45 for hematopoietic stem/progenitor cells and fibroblasts, and CD106 for bone marrow stem cells) at 4°C in the wet box
overnight, and with secondary antibody (1/300) at 37°C for 30 min. The cultured cells were visualized with fresh DAB chromogenic reagent (third antibody) at room temperature for 20 min, counterstained with hematoxylin, mounted and observed under the microscope.
Adipogenic induction and differentiation of ASCs ASCs at the third generation were digested with trypsin solution and inoculated onto the coverslips in 6-well culture plates at the density of 105 cells per hole, at 37°C in the humidified environment of 5% CO2, overnight. After cells began to adhere, the culture medium was changed to an adipogenic induction medium, twice per week. Only the control medium was added to the control group. At 2 weeks after culture, cells in the control group and the induction group were stained with Oil Red O, to confirm the presence of lipid droplets.
Experimental grouping The two kinds of viral solutions mentioned above were collected and transfected at the multiplicity of infection (MOI) 100 for 72 h, and the transfection efficiency was observed under an inverted fluorescence microscope (Table II).
RT-PCR detection of VEGF165 mRNA expression in cells Total RNA in cells was extracted with TRIzol reagent, the ratio of optical density at 260 nm/280 nm was calculated and arranged between 1.8 and 2.0. The RT-PCR reaction was performed at the following parameters: 50°C for 30 min, 94°C for 2 min; 30 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 1 min. After the reaction, 5 mL of the reaction solution was directly electrophoresed with 1% agarose gel. The optical density (OD) of each band was analyzed using the gel imaging system. The experiment was repeated three times, and the average OD values were obtained.
Western blot analysis of VEGF165 gene expression in cells Total RNA in cells was extracted with TRIzol reagent, and protein concentration was detected according to the instructions on the BCA kit. Next, 5% stacking gel and 8% separating gel were formulated for polyacrylamide gel electrophoresis at 60 V for 30 min and 150 V for 1 h, and then the separating gel was washed three times and transferred to the transmembrane device at 100 mA for 30 min. Subsequently, the cells were incubated with primary antibody (1/1500) at 4°C overnight, rinsed, and incubated with the secondary antibody. The cells were then developed and incubated at room temperature in the dark for 30 min. The developing reaction was Table II. Experimental groups. Group A (experimental group) B (control group) C (control group)
Treatment ASCs were transfected with VEGF165 gene-containing viral solution (Ad-VEGF165-IRES-EGFP-1) ASCs were transfected with blank viral solution (Ad-IRES-EGFP-1) ASCs were not transfected with viral solution
Note: Cells in the three groups were routinely cultured for 72 h.
4 C. Jun-jiang & X. Huan-jiu data were expressed as the mean standard deviation (x s), and the differences among groups were compared using the one-way analysis of variance (one-way ANOVA). A value of P 0.05 was considered a significant difference.
Results
Artificial Cells, Nanomedicine, and Biotechnology Downloaded from informahealthcare.com by Kainan University on 04/08/15 For personal use only.
Construction and packaging of the recombinant adenoviral vector
Figure 1. Comparison of recombinant adenoviral vectors by agarose gel electrophoresis. Lane 1: Marker; Lane 2: Electrophoretic band of the experimental group [VEGF165 adenoviral vector (Ad-VEGF165IRES-EGFP-1) was digested with Pac I]; Lane 3: Electrophoretic band of the control group [blank adenoviral vector (Ad-IRES-EGFP-1) was digested with Pac I].
terminated by washing the eluents three times. The OD values of the target band and internal reference were analyzed using the gel imaging system. The experiment was repeated three times and the average OD values were obtained.
ASCs proliferation in each group After ASCs in each group were cultured for 24 h and digested with trypsin, the cells were seeded onto the 96-well culture plates at 2 103 cells/hole for 24 h, each group containing ten counter holes. After the cells became adherent, 20 mL (15 g/L) of MTT solution was added to each hole and the cells were cultured for a further 4 h. Then, the supernatant was discarded and 200 mL of DMSO was added to each hole, and the cells were oscillated for 10 min. The optical density at 490 nm was determined using a microplate reader, and the rates of cell growth and proliferation were calculated.
Statistical analysis Statistical analysis was performed using the SPSS 19.0 software for Windows (SPSS, Chicago, IL, USA). Measurement
The gene sequencing results showed that the VEGF165 gene was fully connected to the recombinant adenoviral vector. The imaging results of gel electrophoresis showed that two bands at 3 kb and 30 kb were visible after Ad-VEGF165-IRESEGFP-1 and Ad-IRES-EGFP-1 were digested with Pac I, suggesting that the recombinant adenoviral vectors in the two groups had been successfully constructed (Figure 1). After the HEK293A cells were transfected with two recombinant viral vectors, a large number of green fluorescent proteins were expressed in the cells, observed under a fluorescence microscope (Figure 2). A similar cytopathic effect was observed in the two groups, for example, cell antennae were recovered, cells became swollen and round, and some cells were detached and suspended (Figure 3). The viral titers were detected as 2.0 108 pfu/mL and 1.9 108 pfu/mL, respectively, which was in line with the requirements of the subsequent transfection experiments.
Morphology of the cultured ASCs When the cells were incubated, a large amount of lipid droplets, and a small amount of red blood cells and fibroblasts were observed. As the duration of culture was prolonged, the culture medium was replenished many times and the cells were basically cleared away. After 24 h of culture, a small amount of large cells began to adhere, and flat monolayer cells were visible under an inverted microscope. Some cells had long bodies, like fibroblasts. After 48 h of culture, most of the ASCs adhered and extended into a fusiform shape, showing thick protrusions. At 5–7 days after culture, the cells gradually divided and fused into a single layer, distributing in clusters. The subcultured ASCs were spindle-shaped, with nuclei in the center; the majority of the cells had one nucleolus (Figure 4A) and occasionally had two nuclei (Figure 4B), round or oval; the mixed cells gradually decreased as the
Figure 2. Green fluorescence distribution after HEK293A cells were transfected with the adenoviral vector ( 40). (A) Expression of green fluorescence protein after HEK293A cells were transfected with VEGF165 adenoviral vectors. (B) Expression of green fluorescence protein after HEK293A cells were transfected with empty adenoviral vectors.
Artificial Cells, Nanomedicine, and Biotechnology Downloaded from informahealthcare.com by Kainan University on 04/08/15 For personal use only.
Effect of VEGF165 and ASCs in promoting fat transplantation 5
Figure 3. Viral packaging map after HEK293A cells were transfected with the adenoviral vector ( 40). (A–B) After HEK293A cells were transfected with VEGF165 adenoviral vectors and empty adenoviral vectors, similar cytopathic effects were found in the two groups.
subculture duration increased. The average amplification time was 60 h.
group), no fluorescent effect was found under a fluorescence microscope (Figure 9).
Immunohistochemical identification of ASCs
RT-PCR assay results
ASCs at the third generation were subject to immunohistochemical staining. The results of immunohistochemical staining showed that CD44 and CD49d antigen-positive expression was found in cultured cells (Figure 5A and B), while no CD45 or CD106 antigen was expressed (Figure 6A and B).
The relative OD values of VEGF165 mRNA expression in the control group and the blank group were 0.43 0.04 and 0.39 0.04, respectively, there was no significant difference between the two groups (P 0.05). The relative OD values of VEGF165 mRNA expression in the experimental group was significantly increased compared with values in the other two groups, accounting for 0.76 0.05 (P 0.05) (Figure 10).
Adipogenic induction and differentiation of ASCs ASCs at the third generation were subjected to adipogenic differentiation, and stained with Oil Red O, 2 weeks later. In the adipogenic differentiation group, intracellular lipid droplets were visible in the ASCs after 2 weeks of culture (Figure 7A and B). The subsequent staining with Oil Red O showed positive results in the adipogenic induction group and negative results in the control group (Figure 8A and B).
Expression in the ASCs after viral transfection After ASCs were transfected with two viral packaging solutions (experimental group and control group), a strong green fluorescent protein expression was observed under a fluorescence microscope, with a large amount of ASCs expressing green fluorescent protein and having high transfection efficiency. In the ASCs without any transfection (control
Western blot assay results The relative OD values of VEGF165 protein expression in the experimental group, control group, and blank group were 1.08 0.11, 0.31 0.09, and 0.29 0.05, respectively. There was no significant difference between the control group and the blank group (P 0.05); the experimental group had a significantly higher OD value than the other two groups (P 0.05) (Figure 11).
ASC proliferation after transfection After ASCs in the three groups had been cultured for 24, 48, 72, 96, and 120 h, the OD value of the cultured ASCs was determined by the MTT assay, and the cell proliferation curve was plotted according to the OD values measured on the microplate reader. The results showed that ASCs in the
Figure 4. Common shapes of adipose-derived mesenchymal stem cells, with one nucleolus (A) or several nuclei (B) ( 400).
Artificial Cells, Nanomedicine, and Biotechnology Downloaded from informahealthcare.com by Kainan University on 04/08/15 For personal use only.
6 C. Jun-jiang & X. Huan-jiu
Figure 5. CD44 (A) and CD49d (B) antigen were positively expressed in ASCs ( 400).
Figure 6. CD45 (A) and CD106 (B) antigens were negatively expressed in ASCs ( 400).
Figure 7. Formation of lipid droplets after adipogenic induction of ASCs. (A) Lipid droplets formed within 2 weeks after adipogenic induction ( 200). (B) Intracellular lipid droplets ( 1000).
Figure 8. Oil Red O staining after adipogenic induction of ASCs. (A) Positive results at 2 weeks after adipogenic induction ( 400). (B) Negative results in the control group ( 400).
Artificial Cells, Nanomedicine, and Biotechnology Downloaded from informahealthcare.com by Kainan University on 04/08/15 For personal use only.
Effect of VEGF165 and ASCs in promoting fat transplantation 7
Figure 9. Green fluorescence distribution in the ASCs ( 200). (A) Green fluorescence expression in the ASCs of the experimental group. (B) Green fluorescence expression in the ASCs of the control group. (C) The untransfected ASCs under the fluorescence microscope.
control group and the blank group grew slowly, with no significant difference between the two groups (P 0.05). After transfection, the proliferation of ASCs in the experimental group was significantly increased compared with that in the other two groups (P 0.05), indicating that VEGF165 significantly improves the growth and proliferation of ASCs (Figure 12).
Discussion Screening of seed cells The existing methods of treating tissue defects have many shortcomings, such as necrosis and absorption, lack of sources, and scar at donor area. Therefore, it is urgent that we search for the optimal therapy for tissue defects, and the development of tissue engineering introduces a novel avenue. With the advances in gene transfection,
cell transplantation and tissue engineering technologies, gene therapy has achieved a rapid progress in promoting angiogenesis in ischemic tissue. The key in tissue engineering is to create a three-dimensional complex with seed cells and scaffolds, in which the choice of seed cells is very important (Cianfarani et al. 2013, Chung et al. 2013, Ferraro et al. 2013). A variety of stem cells have been successfully isolated using modern medical technologies, which provide evidence for the exploration of biological regulation mechanisms of stem cells and the evaluation of therapeutic potential in many human diseases. Stem cells can be generally divided into embryonic stem cells and adult stem cells. Although theoretically, embryonic stem cells have the best effect, their immunogenicity, difficulty in harvesting, ethical and religious issues restrict their application. Adult stem cells have a poorer differentiation capacity than embryonic stem
Figure 10. VEGF165 mRNA expression in each group.
Artificial Cells, Nanomedicine, and Biotechnology Downloaded from informahealthcare.com by Kainan University on 04/08/15 For personal use only.
8 C. Jun-jiang & X. Huan-jiu
Figure 11. VEGF165 gene protein expression in each group.
cells, but have attracted wide attention because the social and ethical disputes can be avoided. Previous studies have demonstrated that adult stem cells isolated from the bone marrow could greatly amplify and exert pluripotent proliferation potential in vitro. As both adipose tissue and bone marrow are located in mesodermal tissue, some scholars have hypothesized that adipose tissue contains similar stem cells, and this hypothesis has been subsequently confirmed by a series of experiments (Razmkhah et al. 2014, Hollenbeck et al. 2012). ASCs have the capacity to differentiate into adipocytes, chondrocytes, osteoblasts, muscle cells, and cardiac cells, and can be used as seed cells for tissue engineering (Trojahn et al. 2013). Due to their easy accessibility, rapid amplification, and pluripotent differentiation potential, ASCs are regarded as a kind of adult stem cell with potential application prospects. A recent study found that ASCS are prone to be introduced through exogenous genes, and therefore are also used as the target gene vectors for gene therapy. Regardless of the kind of vector (adenoviral vector, plasmid vector, or retroviral vector), these vectors carrying the target gene can be used to transfect ASCs and efficiently express for a long term in vivo, while the characteristics of stem cells are maintained all the time (Hsiao et al. 2013).
Figure 12. Proliferation curves of ASCs at different time points after transfection.
Selection of growth factors As one of the three elements for the construction of tissue engineering, especially those that promote local revascularization, the cell growth factor plays an important role in promoting tissue restoration. An adequate blood supply is beneficial for the survival, proliferation, and differentiation of seed cells, and also accelerates the restoration of tissue defects. The mechanism responsible for the angiogenesis factors has been an issue of concern in recent years, and a series of cytokines have been discovered and cloned to promote angiogenesis and accelerate collateral circulation. Among the pro-angiogenic cytokines, VEGF is the most powerful factor. There are four subtypes in the VEGF family, arising due to differences in mRNA splicing, and the VEGF can be divided as: VEGF121, 165, 189, and 206, which refer to the number of amino acid residues. Among them, VEGF165 has the strongest activity and the most distribution, so it is regarded as the main pattern in vivo (Yuan et al. 2013, Kim et al. 2014). VEGF165 can specifically act on vascular endothelial cells, promote their division, inhibit apoptosis, and improve the formation of new blood vessels through paracrine mechanisms. Firstly, VEGF binds with its receptors through the regulation of heparin-like molecules, and causes receptor autophosphorylation, activates mitogen-activated protein kinase, selectively enhances the mitosis of endothelial cells, stimulates the proliferation of endothelial cells, and promotes angiogenesis; in addition, increasing the vascular permeability, especially in small blood vessels, could offer nutrients for cell growth and for capillary network construction (Yan et al. 2011, Lee et al. 2013). Based on the above considerations, this experiment adopted VEGF165 to promote angiogenesis in adipose tissue. Due to the specific pro-angiogenesis effects of VEGF, many scholars propose VEGF in the treatment of ischemic diseases. Other scholars have directly applied VEGF protein to promote tissue healing and have achieved certain effects, but VEGF protein interventions require continuous sources because of its short half-life, which is too expensive and inconvenient to be tolerated by the patients, thus limiting the application of in vivo therapy. We found that the above shortcomings could be avoided when the exogenous gene was introduced into the cells and ectopic expression within cells was allowed. Therefore, a gene therapy using local expression of VEGF protein has emerged, to promote tissue regeneration
Effect of VEGF165 and ASCs in promoting fat transplantation 9 and accelerate the restoration of necrotic tissue (Zografou et al. 2013, Uysal et al. 2012).
Artificial Cells, Nanomedicine, and Biotechnology Downloaded from informahealthcare.com by Kainan University on 04/08/15 For personal use only.
Mutual benefits of recombinant adenoviral vector VEGF165 combined with ASCs In this study, we transfected the target gene into ASCs via the adenoviral vector, and then transplanted it into the body, avoiding rejection reactions. The results of the present study showed that after adenoviral vector transfection, VEGF165 mRNA and protein expression levels in the ASCs were significantly upregulated, to levels which can be detected. This evidence indicated that the target genes are expressed in vivo for several weeks or months and then disappear, which is reasonable for the restoration of tissue defects, although no benefits are evident for the treatment of genetic diseases and chronic diseases. Expressed over a period of time, cytokines are qualified for tissue repair, posing no problems of excessive tissue regeneration, abnormal alterations and possible tumorigenicity caused by over-expression. At 24 h of adenoviral transfection, the proliferation of ASCs was much greater than that seen in the control group or the blank group. This evidence leads us to infer that the transfection of the VEGF165 gene-containing adenovirus can not only lead to sustained expression of the target protein, but also significantly promote the proliferation of ASCs, which is a win-win situation and provides evidence for in vitro experiments on the VEGF165-combined ASC transplantation.
Declaration of interest The authors report no declarations of interest. The authors alone are responsible for the content and writing of the paper.
References Bahn JJ, Chung JY, Im W, Kim M, Kim SH. 2012. Suitability of autologous serum for expanding rabbit adipose-derived stem cell populations. J Vet Sci. 13:413–417. Chua KH, Raduan F, Wan Safwani WK, Manzor NF, Pingguan-Murphy B, Sathapan S. 2013. Effects of serum reduction and VEGF supplementation on angiogenic potential of human adipose stromal cells in vitro. Cell Prolif. 46:300–311. Chung E, Nam SY, Ricles LM, Emelianov SY, Suggs LJ. 2013. Evaluation of gold nanotracers to track adipose-derived stem cells in a PEGylated fibrin gel for dermal tissue engineering applications. Int J Nanomedicine. 8:325–336. Cianfarani F, Toietta G, Di Rocco G, Cesareo E, Zambruno G, Odorisio T. 2013. Diabetes impairs adipose tissue-derived stem cell function and efficiency in promoting wound healing. Wound Repair Regen. 21:545–553. Donaldson EE, Ko JM, Kuiper JJ, Chamogeorgakis T, Roberts CW. 2014. Fat in the ventricular septum. Proc (Bayl Univ Med Cent). 27:231–232. Ferraro GA, De Francesco F, Nicoletti G, Paino F, Desiderio V, Tirino V, D’Andrea F. 2013. Human adipose CD34 CD90 stem cells and collagen scaffold constructs grafted in vivo fabricate loose connective and adipose tissues. J Cell Biochem. 114:1039–1049. Gao W, Qiao X, Ma S, Cui L. 2011. Adipose-derived stem cells accelerate neovascularization in ischaemic diabetic skin flap via expression of hypoxia-inducible factor-1a. J Cell Mol Med. 15:2575–2585. Hollenbeck ST, Senghaas A, Komatsu I, Zhang Y, Erdmann D, Klitzman B. 2012. Tissue engraftment of hypoxic-preconditioned adipose-derived stem cells improves flap viability. Wound Repair Regen. 20:872–878. Hsiao ST, Lokmic Z, Peshavariya H, Abberton KM, Dusting GJ, Lim SY, Dilley RJ. 2013. Hypoxic conditioning enhances the angiogenic paracrine activity of human adipose-derived stem cells. Stem Cells Dev. 22:1614–1623.
Joo HH, Jo HJ, Jung TD, Ahn MS, Bae KB, Hong KH, et al. 2012. Adiposederived stem cells on the healing of ischemic colitis: a therapeutic effect by angiogenesis. Int J Colorectal Dis. 27:1437–1443. Kim H, Choi K, Kweon OK, Kim WH. 2012. Enhanced wound healing effect of canine adipose-derived mesenchymal stem cells with lowlevel laser therapy in athymic mice. J Dermatol Sci. 68:149–156. Kim JH, Kim WK, Sung YK, Kwack MH, Song SY, Choi JS, et al. 2014. The molecular mechanism underlying the proliferating and preconditioning effect of vitamin C on adipose-derived stem cells. Stem Cells Dev. 23:1364–1376. Kim KI, Park S, Im GI. 2014. Osteogenic differentiation and angiogenesis with cocultured adipose-derived stromal cells and bone marrow stromal cells. Biomaterials. 35:4792–4804. Lee CS, Watkins E, Burnsed OA, Schwartz Z, Boyan BD. 2013. Tailoring adipose stem cell trophic factor production with differentiation medium components to regenerate chondral defects. Tissue Eng Part A. 19:1451–1464. Lin CY, Chang YH, Sung LY, Chen CL, Lin SY, Li KC, et al. 2014. Longterm tracking of segmental bone healing mediated by genetically engineered adipose-derived stem cells: focuses on bone remodeling and potential side effects. Tissue Eng Part A. 20:1392–1402. Lin RZ, Moreno-Luna R, Li D, Jaminet SC, Greene AK, Melero-Martin JM. 2014. Human endothelial colony-forming cells serve as trophic mediators for mesenchymal stem cell engraftment via paracrine signaling. Proc Natl Acad Sci U S A. 111:10137–10142. Nauta A, Seidel C, Deveza L, Montoro D, Grova M, Ko SH, et al. 2013. Adipose-derived stromal cells overexpressing vascular endothelial growth factor accelerate mouse excisional wound healing. Mol Ther. 21:445–455. Ni X, Sun W, Sun S, Yu J, Wang J, Nie B, et al. 2014. Therapeutic potential of adipose stem cells in tissue repair of irradiated skeletal muscle in a rabbit model. Cell Reprogram. 16:140–150. Paek HJ, Kim C, Williams SK. 2014. Adipose stem cell-based regenerative medicine for reversal of diabetic hyperglycemia. World J Diabetes. 5:235–243. Razmkhah M, Jaberipour M, Ghaderi A. 2014. Downregulation of MMP2 and Bcl-2 in adipose derived stem cells (ASCs) following transfection with IP-10 gene. Avicenna J Med Biotechnol. 6:27–37. Shen T, Pan ZG, Zhou X, Hong CY. 2013. Accelerated healing of diabetic wound using artificial dermis constructed with adipose stem cells and poly (L-glutamic acid)/chitosan scaffold. Chin Med J (Engl). 126:1498–1503. Strassburg S, Nienhueser H, Stark GB, Finkenzeller G, Torio-Padron N. 2013. Human adipose-derived stem cells enhance the angiogenic potential of endothelial progenitor cells, but not of human umbilical vein endothelial cells. Tissue Eng Part A. 19:166–1674. Trojahn Kølle SF, Oliveri RS, Glovinski PV, Kirchhoff M, Mathiasen AB, Elberg JJ, et al. 2013. Pooled human platelet lysate versus fetal bovine serum-investigating the proliferation rate, chromosome stability and angiogenic potential of human adipose tissue-derived stem cells intended for clinical use. Cytotherapy. 15:1086–1097. Uysal CA, Tobita M, Hyakusoku H, Mizuno H. 2012. Adipose-derived stem cells enhance primary tendon repair: biomechanical and immunohistochemical evaluation. J Plast Reconstr Aesthet Surg. 65:1712–1719. Uysal CA, Tobita M, Hyakusoku H, Mizuno H. 2014. The effect of bone-marrow-derived stem cells and adipose-derived stem cells on wound contraction and epithelization. Adv Wound Care (New Rochelle). 3:405–413. Verseijden F, Posthumus-van Sluijs SJ, van Neck JW, Hofer SO, Hovius SE, van Osch GJ. 2012. Comparing scaffold-free and fibrin-based adipose-derived stromal cell constructs for adipose tissue engineering: an in vitro and in vivo study. Cell Transplant. 21:2283–2297. Yan A, Avraham T, Zampell JC, Haviv YS, Weitman E, Mehrara BJ. 2011. Adipose-derived stem cells promote lymphangiogenesis in response to VEGF-C stimulation or TGF-b1 inhibition. Future Oncol. 7:1457–1473. Yuan Y, Gao J, Liu L, Lu F. 2013. Role of adipose-derived stem cells in enhancing angiogenesis early after aspirated fat transplantation: induction or differentiation? Cell Biol Int. 37:547–550. Zografou A, Papadopoulos O, Tsigris C, Kavantzas N, Michalopoulos E, Chatzistamatiou T, et al. 2013. Autologous transplantation of adipose-derived stem cells enhances skin graft survival and wound healing in diabetic rats. Ann Plast Surg. 71:225–232. Zografou A, Tsigris C, Papadopoulos O, Kavantzas N, Patsouris E, Donta I, Perrea D. 2011. Improvement of skin-graft survival after autologous transplantation of adipose-derived stem cells in rats. J Plast Reconstr Aesthet Surg. 64:1647–1656.
