17

5-HT1-like receptor agonist, for the treatment of severe migraine. Lancet 1988; i: 1309-11. 13. Tfelt-Hansen P, Brand J, Dano P, et al. Early clinical experience with subcutaneous GR43175 in acute migraine: an overview. Cephalalgia 1989; 9 (suppl 9): 73-77. 14. Headache Classification Committee of the International Headache Society. Classification and diagnostic criteria for headache disorders, cranial neuralgias and facial pain. Cephalalgia 1988; 8 (suppl 7): 1-96. 15. Lassen NA, Sveinsdottir E, Kanno I, Stokely EM, Rommer P. A fast rotating single photon emission tomograph for regional cerebral blood flow studies in man. J Comput Assist Tomogr 1978; 2: 661-62. 16. Celsis P, Goldman T, Henriksen L, Lassen NA. A method for calculating regional cerebral blood flow from emission computed tomography of inert gas concentrations. J Comput Assist Tomogr 1981; 5: 641-45. 17. Atkins HL, Robertson JS, Croft BY, et al. Estimates of radiation absorbed doses from radioxenon in lung imaging. J Nucl Med 1980; 21: 459-62. 18. Iversen HK, Nielsen TH, Olesen J, Tfelt-Hansen P. Arterial responses during migraine headache. Lancet 1990; 336: 837-39. 19. Jensen K, Olesen J. Temporal muscle blood flow in common migraine. Acta Neurol Scand 1985; 72: 561-70. 20. Jensen K. Subcutaneous blood flow in the temporal region of migraine patients. Acta Neurol Scand 1987; 75: 310-18. 21. Thie A, Fuhlendorf A, Spitzer K, Kunze K. Transcranial doppler evaluation of common and classic migraine. Part II. Ultrasonic features during attacks. Headache 1990; 30: 209-15. 22. De Clerek F, Reneman RS. Platelet-derived serotonin and abnormal

SHORT REPORT Vertical transmission of C virus

hepatitis

There is evidence that hepatitis C virus (HCV) may be vertically transmitted from infected mothers to their children. To test this hypothesis, we prospectively studied 10 pregnant women at high risk from parenterally or sexually transmitted diseases with the polymerase chain reaction. HCV RNA was found in 8 newborn babies delivered by women who were anti-HCV seropositive, and persisted for 2-19 months of follow-up. Anti-HCV detected in 7 infants cleared by 9 months and remained undetectable thereafter. Serum alanine aminotransferase was raised in 3 infants. The findings provide evidence of vertical transmission of HCV and suggest that perinatal infection may initiate a silent disease process or chronic carrier state.

Blood transfusions and intravenous drug abuse are established sources of HCV infection. Nonetheless, a history of parenteral exposure is rarely encountered in symptom-free carriers (at least 1% of the world’s population) and is not reported by most patients with cryptogenic liver disease or primary hepatocellular carcinoma who are anti-HCV seropositive. 1-3 Recent

tissue perfusion. In: Vanhoutte PM, ed. Serotonin and the cardiovascular system. New York: Raven Press, 1985; 155-64. 23. Harper AM, MacKenzie ET. Effects of 5-hydroxytryptamine in pial arteriolar calibre in anaesthetized cats. J Physiol (London) 1977; 271: 735-46. 24. Young AR, Hamel E, MacKenzie ET, Seylaz J, Vierecchia C. The multiple actions of 5-hydroxytryptamine on cerebrovascular smooth muscle. In: Nobin A, Owman C, Arneklo-Nobin B, eds. Neuronal messengers in vascular function. Amsterdam: Elsevier, 1987: 57-74. 25. Humphrey PPA, Feniuk W, Perrin MJ, et al. GR 43175—a selective agonist for functional 5HT1-like receptors in dog isolated saphenous vein. Br J Pharmacol 1988; 94: 1123-32. 26. Feniuk W, Humphrey PPA, Perrin MJ. The selective carotid arterial vasoconstrictor action of GR45173 in anaesthetised dogs. Br J Pharmacol 1989; 96: 83-90. 27. Parsons AA, Whalley ET, Feniuk W, Connor HE, Humphrey PPA. 5-HT1-like receptors mediate 5-hydroxytryptamine-induced contraction of human isolated basilar artery. Br J Pharmacol 1989; 96: 434-49. 28. Edvinsson L, Jansen I. Characterization of 5-HT receptors mediating contraction of human cerebral, meningeal and temporal arteries: target for GR 43175 in acute treatment of migraine. Cephalagia 1989; 9 (suppl 10): 39-40. 29. Moskowitz MA, Henrikson BM, Markowitz S, Saito K. Intra- and extracranial nociceptive mechanisms and the pathogenesis of head pain. In: Olesen J, Edvinsson L, eds. Basic mechanisms of headache. Amsterdam: Elsevier, 1988: 429-37.

serological data suggest that HCV may be vertically transmitted from mother to infant.4,5 We used the polymerase chain reaction (PCR) to investigate prospectively the passage of HCV from pregnant women to newborn babies and the subsequent course of infection in these children. We studied 10 pregnant women at high risk from parenterally or sexually transmitted diseases who had been admitted to the Bay Area Perinatal AIDS Center at the University of California, San Francisco, from March, 1989, to the end of February, 1991. HCV and other pathogens prevalent to this population were assayed prospectively during pregnancy and at delivery, in cord blood, and in infants during subsequent outpatient visits. Blood was collected aseptically, and cord blood was taken with angiocatheters to prevent

contamination with maternal blood. Plasma was screened with the Ortho anti-HCV EIA and re-assayed with Chiron’s recombinant immunoblot assay (RIBA). Alanine aminotransferase (ALT) was measured in mothers near to or at delivery, in all infants between 4 and 6 months of age, and at intervals thereafter. HCV RNA was sought in plasma by a cDNA/PCR procedure that used a highly conserved nucleotide sequence from the 5’ untranslated region of the HCV genome described by Han et al.6 RNA was extracted from 100 1 of plasma and converted into cDNA with 50 pmoles of a reverse transcriptase primer JHC51 (CCCAACACTACTCGGCTA, nucleotide position 252 to 268 in the HCV genome) in a 50 III reaction volume. The cDNA was amplified for 35 cycles (94°C 1 -5 min, 60°C 2 min, and 70°C 3 min) by Taq DNA polymerase with 50 pmoles each of primers JHC93 (TTGGCGGCCGCACTCCACCATGAATCACTCCCC, position 23 to 46) and JHC52 (AGTCTTGCGGCCGCACGCCCAAATC, position 234 to 248). Part of this PCR product was analysed by Southern blot hybridisation with A89 (CCATAGTGGTCTGCGGAACCGGTGAGTACA, position 138 to 168) as a probe. This probe detects a band of 240 nucleotides as an HCV-specific PCR product (primers and a detailed protocol available on request). Possible contamination of the sample with HCV sequences was monitored by the addition of a water control with each RNA extraction, cDNA synthesis, and PCR amplification step. Randomly selected plasma samples negative for both HCV antibody and RNA were often used as negative controls; plasma from an experimentally infected chimpanzee used for the cloning of prototype HCV was the positive control.

Maternal risk factors included intravenous drug use and sex partners. HIV infection was recorded in 5 women. 8 women (A-H) were anti-HCV positive and PCR

multiple

18

TABLE I-HCV STATUS AND ALT IN MOTHERS AT DELIVERY

user, MSP=multiple sex partners, ND=not done, immunoblot RIBA=recomblnant EIA=enzyme assay, immunoassay, PCR=polymerase chain reaction, ALT=a!anme aminotransferase (normal

IVDU=lntravenous drug

range=2-64!U/)).

ALT values were raised in 4 (table I). 7 of the 8 children of anti-HCV-positive women were anti-HCV positive by EIA at birth and/or during the first 5 postnatal days; the 2 born to seronegative women were non-reactive. At follow-up, anti-HCV was no longer detectable in infant C at 2 months; in infants B, D, and H at 4 months; in infant G at 5 months; and in infant A at 9 months of age. Thereafter, anti-HCV was not detected in any infant under surveillance for periods from 10 to 22 months. HIV infection was established in 1 anti-HCV-positive infant

positive.

(table II). HCV RNA was present in plasma of all 8 seropositive infants (table ll)—continuously from birth for follow-up TABLE II-HCV STATUS AND ALT IN INFANTS I

1

-

2 to 19 months in infants A-E, and intermittently in infant G. In infant F, HCV RNA was initially detected at 12 months of age. The last seropositive infant (H) was PCR positive at birth but became negative at 4 months, 2 weeks before his death with sudden infant death syndrome. He and 2 other infants (A and B) had moderate increases in ALT without other signs of liver disease. HCV RNA was not detected in children of seronegative women (I and J). This report presents the first direct evidence of HCV infection by vertical transmission. 7 of 8 infants of HCV-infected women acquired the infection at birth; the other (F) became RNA-positive at 12 months of age. Failure to elicit an earlier PCR signal in infant F may have reflected viral titres below detectable levels, or an infection acquired within the household several months after birth.3 Similarly, the intermittent HCV RNA pattern observed in infant G may have been due to a transient decline in viral titres. That passage of HCV to offspring occurred in HIV-infected and uninfected women suggests that co-infection is not an absolute requirement for vertical transmission of HCV. Nonetheless, each agent may contribute to the pathogenicity of the other agent in early infancy.4°’ Passive transfer of anti-HCV from mother to infant has been reported by other investigators.4,5 Our PCR data indicate that production of endogenous antibody may be deficient or delayed in HCV-infected infants after clearance of maternal antiHCV. An attenuated antibody response and absence of liver disease beyond occasional moderate ALT increases are clinical features consistent with a carrier state. The contribution of such vertically transmitted infections to the global HCV reservoir and their possible association with chronic liver disease or primary hepatocellular carcinoma later in life remains to be clarified.

periods of

We thank Dr Philip Barr for synthesis of oligonucleotides used in these studies. This study was supported in part by the UC University-wide AIDS Research Program grant no R90SF225, the Bay Area Perinatal AIDS Center grant no NICHD 24640, and the Pediatrics Clinical Research Center grant no RR 01271.

REFERENCES 1. Choo

Q-L, Weiner AJ, Overby LR, et al. Hepatitis C virus: the major causative agent of non-A, non-B hepatitis. Br Med Bull 1990; 46: 423-41. 2. Alter MJ. Hepatitis C: and miles to go before we sleep. N Engl J Med 1989; 321: 1538-40. 3. Alter MJ, Hadler SC, Judson FN, et al. Risk factors for acute non-A, non-B hepatitis in the United States and association with hepatitis C virus infection. JAMA 1990; 246: 2231-35. 4. Giovanninni M, Tagger A, Ribero ML, et al. Maternal-infant transmission of hepatitis C virus and HIV infections: a possible interaction. Lancet 1990; 335: 1166. 5. Reesink HW, Wong VCW, Ip HMH, et al. Mother-to-infant transmission and hepatitis C virus. Lancet 1990; 335: 1216-17. 6. Han JM, Shyamala V, Richman KH, et al. Characterization of terminal regions of hepatitis C viral RNA: identification of conserved sequences in the 5’ untranslated region and poly(A) tails at the 3’ end. Proc Natl Acad Sci USA 1991; 88: 1711-15. 7. Weintrub PS, Veereman G, Cowan MJ, Thaler MM. Vertically transmitted hepatitis C/HIV co-infection: a cause of infantile liver disease. Hepatology 1990; 12: 49 (abstr).

Abbreviations

as

for table i *At 2

mo

only

tAt 6

mo

only

ADDRESSES Department of Pediatrics (Prof M M Thaler, MD, Prof D W Wara, MD, G. Veereman-Wauters, MD), Department of Obstetrics, Gynecology and Reproductive Sciences (D. V Landers, MD, Prof. R. L. Sweet, MD), University of California, San Francisco, California; Department of Internal Medicine, College of Medicine, Hallym University, Chuncheon, Korea (C-K. Park, MD); and Chiron Corporation (M. Houghton, PhD, J. H. Han, PhD), Emeryville, California, USA. Correspondence to Prof M. M Thaler, Department of Pediatrics, M 680, Box 0136, University of California, San Francisco, California 94143, USA.

Vertical transmission of hepatitis C virus.

There is evidence that hepatitis C virus (HCV) may be vertically transmitted from infected mothers to their children. To test this hypothesis, we pros...
280KB Sizes 0 Downloads 0 Views