Journal of General Virology (2014), 95, 2716–2726

DOI 10.1099/vir.0.070011-0

Virulent and attenuated strains of duck hepatitis A virus elicit discordant innate immune responses in vivo Cuiping Song,1 Ying Liao,1 Wei Gao,2 Shengqing Yu,1 Yingjie Sun,1 Xvsheng Qiu,1 Lei Tan,1 Anchun Cheng,3 Mingshu Wang,3 Zhiyong Ma1 and Chan Ding1 Correspondence Chan Ding [email protected]

1

Shanghai Veterinary Research Institute, the Chinese Academy of Agricultural Sciences, 518 Ziyue Road, Shanghai 200241, PR China

2

Yangzhou University, College of Veterinary Medicine, 88 South University Avenue, Yangzhou 225009, PR China

3

Avian Disease Research Center, College of Veterinary Medicine, Sichuan Agricultural University, 46 Xinkang Road, Ya’an 625014, PR China

Received 10 July 2014 Accepted 10 September 2014

Previous studies of duck hepatitis A virus infection have focused only on the pathogenicity and host response of one strain. Here, we show that the virulent SH strain and the attenuated FC64 strain induced varied pathogenicity, apoptosis and immune responses in the livers of 1-day-old ducklings. SH infection caused apoptosis and visible lesions in the liver; serum aspartate aminotransferase, alanine transaminase, alkaline phosphatase, c-glutamyltransferase and total bilirubin activities were markedly upregulated; and ducklings died at 36 h post-infection (p.i.). However, FC64 infection did not induce significant symptoms or impair liver function, and all of the infected ducklings remained healthy. In addition, both virus strains replicated well in the liver, spleen and intestine, whilst the SH strain replicated more efficiently than FC64. IFN-c, IL-2, inducible nitric oxide synthase and nitric oxide were strongly induced by SH infection, and may be associated with the pathogenicity of the SH strain. IFN-a, IFN-b, IFN-stimulated transmembrane protein 1, IFN-stimulated gene 12, 29,59-oligoadenylate synthetase-like and IL-6 were moderately induced by SH infection at 24 h p.i., and dramatically induced by FC64 infection at 36 h p.i. The intensive induction of cytokines by FC64 may be involved in restriction of virus replication and stimulation of adaptive immune responses. Ducklings inoculated with FC64 produced high levels of antiviral antibodies within 45 days p.i. The low virulence and strong immune response of FC64 rendered this strain a good vaccine candidate, as confirmed by a protective assay in this study.

INTRODUCTION Duck hepatitis A virus (DHAV; family Picornaviridae, genus Avihepatovirus) (Ding & Zhang, 2007; Kim et al., 2006; Tseng et al., 2007; Varghese et al., 2010–2011) was first identified in the United States in 1949 (Levine & Fabricant, 1950). DHAV strains are genetically divided into three different types: the original type DHAV-1 (Asplin, 1958; Levine & Fabricant, 1950), DHAV-2 isolated in Taiwan (Tseng & Tsai, 2007) and DHAV-3 isolated in South Korea and China (Fu et al., 2008; Kim et al., 2007). In China, duck viral hepatitis is mainly caused by DHAV-1 and DHAV-3, as DHAV-2 has not yet been isolated. The DHAV genome contains a single, long ORF encoding a polyprotein, which is cleaved into a leader protein, three structural proteins (VP0, VP1 and VP3) and eight nonstructural proteins (2A1, 2A2, 2B, 2C, 3A, 3B, 3C and 3D). 2716

DHAV causes an acute, highly lethal infection in young ducklings usually ,4 weeks of age. Different DHAV strains cause diverse symptoms and pathology. Attenuated virus strains usually cause transient infection, whereas virulent strains often lead to severe contagious diseases resulting in mortality rates of up to 95 % in 1-week-old ducklings (Li et al., 2013; Xu, 1990). Gross lesions tend to be restricted to the liver, which becomes swollen and presents multiple punctuate or coalescing haemorrhage sites (Bi 2in & Bidin, 2008; Woolcock & Crighton, 1979). An early innate immune response is necessary to limit the initial infection and is a first-line defence response to virus infection (Everett & McFadden, 1999). Virus-associated molecules can be recognized by host pattern recognition receptors, which then initiate antiviral responses, including induction of type I IFNs (IFN-a/b), IFN-stimulated genes 070011 G 2014 The Authors

Printed in Great Britain

Discordant innate immune responses to DHAV

(ISGs) and ILs. ISGs act to inhibit viral infection at the early infection stage, where ILs activate adaptive immune responses and therefore eliminate virus infection at the later infection stage (Janeway & Medzhitov, 2002; Kawai & Akira, 2006; Theofilopoulos et al., 2005). Thus, the innate immune response plays an important role in defence against viral infection (Galiana-Arnoux & Imler, 2006). Apoptosis is a crucial factor for disease onset and development as well as tissue homeostasis (Grossmann, 2002). Previous studies reported that DHAV infection causes hepatic necrosis and apoptosis, resulting in liver injury, which plays an important role in disease pathogenesis (Ding, 1996; Sheng et al., 2014). Although DHAV has been studied extensively, previous studies of DHAV have focused only on the pathogenicity and host response of one strain; relatively few reports have compared the host response and pathology induced by different virus strains to variation in virulence. Here, we hypothesized that the host immune responses and pathogenicity of different virulent DHAV strains are diverse. We compared the pathology, apoptosis, virus replication, cytokine induction and nitric oxide (NO) production in 1-day-old ducklings infected with the virulent SH strain (GenBank accession number HQ265433) (Song et al., 2011b) or attenuated FC64 strain (GenBank accession number HQ232302) (Song et al., 2011a). The liver, spleen and intestine were found to be the main target organs of both DHAV strains. Infection with the SH strain was lethal to the ducklings at 36 h post-infection (p.i.), whilst the FC64 strain was non-pathogenic. The induction of type I IFNs, ISGs and IL-6 by FC64 infection was several hundred-fold greater than that of SH infection. Inducible nitric oxide synthase (iNOS) and NO production were strongly upregulated by SH infection, which may contribute to the pathogenicity of SH. The low virulence and strong immune response rendered FC64-infected ducklings capable of being protected against attack by virulent SH. The aim of this study was to provide a basis to elucidate the pathogenesis of DHAV and facilitate vaccine development.

More severe blisters, degeneration, local steatosis and a small amount of local heterophilic neutrophil infiltration in the small blood vessels were observed at 24 h p.i. (Fig. 1b). Moreover, hepatocyte morphology was characterized by fuzzy cell boundaries, necrosis, collapse, perivascular lymphocyte infiltration, wide spread of large numbers of granulocytes (marked by arrow) and many necrotic focal points in liver specimens at 36 h p.i. (Fig. 1c). However, fewer pathological changes were observed in liver specimens from FC64-infected ducklings compared with SHinfected ducklings. The livers of FC64-infected ducklings appeared only slightly inflamed, with vesicular degeneration and a small number of inflammatory lesions (Fig. 1d–f). These results confirmed that the livers of SHinfected ducklings had more lesions than those infected with FC64. Biochemical detection of serum aspartate aminotransferase (AST), alanine transaminase (ALT), alkaline phosphatase (ALP), c-glutamyltransferase (GGT) and total bilirubin (T-Bil) Levels of the serum biochemical markers AST, ALP, ALT and T-Bil are associated with liver function (Hu & Cheng, 1996). As liver lesions were observed in SH-infected ducklings, each of these biochemical markers of liver function were measured in ducklings infected with SH or FC64. Mockinfected liver specimens were included as negative controls. As shown in Fig. 1(g), there were higher serum ALT, AST, ALP, GGT and T-Bil levels in liver specimens from SH-infected ducklings than those from FC64- or mockinfected ducklings, indicating that liver function was severely impaired by SH infection. There were no significant differences in AST, ALT, ALP, GGT and T-Bil levels between FC64- and mock-infected ducklings, demonstrating that the liver function of FC64-infected ducklings was not impaired. Apoptosis in SH- or FC64-infected duckling livers

All 1-day-old ducklings infected with SH showed neurological symptoms as early as 24 h p.i. and died by 36 h p.i. Post-mortem examination revealed typical visible lesions in the ‘piebald liver’, as described previously (Song et al., 2013), whilst none of the FC64-infected or mock-infected ducklings displayed clinical signs or died.

Apoptosis in liver specimens from SH- and FC64-infected ducklings was examined using the terminal deoxynucleotidyltransferase dUTP nick end labelling (TUNEL) assay. In SH-infected ducklings, many TUNEL-positive cells with brown-stained nuclei were observed in the sliced liver specimens at 24 and 36 h p.i., which appeared as small rounded or granular patterns (Fig. 2a, b). However, few TUNEL-positive cells were found in sliced liver specimens of FC64-infected ducklings (Fig. 2c, d). These results demonstrated that SH infection, but not FC64 infection, induced apoptosis in the duckling liver.

Histological analysis of the liver specimens revealed significant differences between virulent SH- and attenuated FC64-infected ducklings. All SH-infected ducklings exhibited asystematic cell swelling and vesicular degeneration (hydropic degeneration) in the liver at 16 h p.i. (Fig. 1a).

To confirm that apoptosis was caused by SH infection, caspase-3 cleavage was analysed by Western blot analysis of duckling liver specimens infected with SH or FC64. As shown in Fig. 2(e), the 17- and 19 kDa caspase-3 cleavage forms were detected in the SH-infected duckling liver at

RESULTS Clinical signs and histopathological analysis of DHAV-infected ducklings

http://vir.sgmjournals.org

2717

C. Song and others

(a)

(b)

(c)

(d)

(e)

(f)

(g)

150

250

*

*

*

*

SH FC64 Mock

100

AST (U l–1)

ALT (U l–1)

200 *

*

50

150

*

* 100 50

8

40

* * 4 2 0

20 10

h 24

h 24

h

0 16

h 24

16

h

0

*

*

30

h

200

6

*

*

16

400

*

*

T-Bil (mmol l–1)

GGT (U l–1)

*

24

h 16

h

*

* *

ALP (U l–1)

24

h 16

600

h

0

0

Fig. 1. Histopathological analysis of duckling livers and liver function serum marker levels in ducklings infected with strain SH or FC64. (a) Vesicular degeneration in duckling liver infected with SH at 16 h p.i. is marked with an arrow. (b) Widespread and scattered steatosis in various eosinophilic granulocytes in duckling liver infected with SH at 24 h p.i. is indicated with arrows. (c) Necrosis, collapse, perivascular lymphocyte infiltration and many necrotic focal points in duckling liver infected with SH at 36 h p.i. are indicated. (d–f) Slight hepatitis lesions in duckling livers infected with FC64 at 16, 24 and 36 h p.i. respectively, exhibited vesicular degeneration and inflammatory lesions (arrow). Bar, 200 mm. (g) Sera of infected ducklings were collected and subjected to chemical analysis, and the results were analysed using SPSS v. 13.0 software. Values are presented as mean±SD (n54). *P,0.05 indicates significant difference using Student’s t-test.

36 h p.i., but not in the FC64-infected duckling liver. These results demonstrated that SH infection, but not FC64 infection, induced apoptosis in the duckling liver, which 2718

was in agreement with the TUNEL assay results. Apoptosis induced by virulent SH infection may play a critical role in pathogenesis. Journal of General Virology 95

Discordant innate immune responses to DHAV

of inoculation than SH (Fig. 3a), significantly more SH virus RNA copies than FC64 were detected in each organ (Fig. 3b). These results demonstrated that SH replicated more efficiently than FC64 in ducklings.

(a)

(b)

(c)

(d) SH

(e)

DHAV replicates most efficiently in the liver; therefore, SH and FC64 invasive efficiencies in the liver were compared using a time-course assay. Total RNA was extracted from liver tissue at 16, 24 and 36 h p.i., and levels were determined by qRT-PCR. As shown in Fig. 3(c), there were significantly higher levels of SH RNA copies than FC64 at all three time points, especially at 24 and 36 h p.i. These results further confirmed that SH replicated more efficiently than FC64 at all time points in duckling liver. FC64

16 h 24 h 36 h 16 h 24 h 36 h Mock Cleaved caspase-3 Actin

Fig. 2. Apoptosis in SH- or FC64-infected duckling liver. (a, b) TUNEL assay of duckling liver sections infected with SH at 24 and 36 h p.i. (c, d) TUNEL assay of duckling liver sections infected with FC64 at 24 and 36 h p.i. Bar, 50 mm. (e) Caspase-3 cleavage in duckling livers infected with SH or FC64. Duckling livers were collected at 24 and 36 h p.i., and then subjected to Western blot analysis using anti-caspase-3 antibodies. Actin was included as loading control.

Viral genomic RNA copies of inoculation and the replication efficiency of SH and FC64 in ducklings To compare the number of inoculated virus copies, the viral genomic RNA copies of 1 LD50 SH or 1 ELD50 (embryonic LD50) FC64 were determined by quantitative real-time (qRT)-PCR. The virus 3D gene was detected to monitor the quantity of viral genomic RNA. As shown in Fig. 3(a), the quantity of genomic RNA copies of 1 LD50 SH was about two-thirds that of 1 ELD50 FC64, reflecting that the number of inoculated virus copies of 103 LD50 SH was less than that of 103 ELD50 FC64. The invasive properties of SH and FC64 in different organs in ducklings were then compared. RNA was extracted from the heart, spleen, lung, kidney, brain, intestine and muscle of SH- and FC64-infected ducklings at 36 h p.i. and subjected to qRT-PCR, which revealed high levels of SH and FC64 RNA in the liver, spleen and intestine, moderate levels in the kidney, muscle, lung and heart, and low levels in the brain (Fig. 3b). SH and FC64 showed similar tissue tropism in the liver, spleen and intestine, suggesting that the three organs are targeted by these two DHAV strains, whilst the intestine might be the initial infection and proliferation site during natural infection. Moreover, although there was a higher number of FC64 virus copies http://vir.sgmjournals.org

Innate immune response in DHAV-infected duckling liver To determine the mechanisms of replication efficiency disparities between SH and FC64, the levels of cytokines and ISGs in the infected duckling livers were examined. The RNA levels of five cytokines (IFN-a, IFN-b, IFN-c, IL6 and IL-2) and three ISGs [IFN-stimulated transmembrane protein 1 (IFITM1), IFN-stimulated gene 12 (ISG12) and 29,59-oligoadenylate synthetase-like (OASL)] were examined by qRT-PCR. As shown in Fig. 4(a), all of the cytokines and ISGs were induced in a time-dependent manner following infection by either virus strain. In SHinfected ducklings, cytokine production was increased until 24 h p.i. (increases of 26-fold for IFN-a, 23-fold for IFN-b, 19-fold for IFN-c, 170-fold for IL-6 and 130-fold for IL-2), when peak values were reached. After this peak, the concentration of each cytokine decreased by 36 h p.i. However, production of ISGs increased until 36 h p.i. (increases of 13-fold for IFITM1, 22-fold for ISG12 and 48fold for OASL), when peak values were reached. However, in FC64-infected ducklings, dramatically increased levels of cytokines and ISGs (increases of 1150-fold for IFN-a, 165fold for IFN-b, 14.5-fold for IFN-c, 15 414-fold for IL-6 and 4.8-fold for IL-2) and ISGs (increases of 329-fold for IFITM1, 7963-fold for ISG12 and 7250-fold for OASL) were observed until 36 h p.i., when peak values were reached. These results indicated that SH infection induced an earlier innate immune response than FC64 and that FC64 induced a significantly stronger innate immunity response at a later infection stage than SH. Notably, concentrations of ISGs (IFITM1, ISG12 and OASL) peaked at 36 h p.i. by both SH and FC64 infection. The differences in innate immune responses were correlated with replication efficiency and virulence of these two virus strains, and contributed to the variation in pathogenesis. Induction of iNOS and NO by SH infection Accumulated evidence suggests that NO and oxygen radicals are key molecules in the pathogenesis of various infectious diseases. NO biosynthesis, particularly through expression of iNOS, occurs in a variety of virus infections. 2719

C. Song and others

4

2

te In

h

h

36

h

24

16

h

h

36

cl e

h

0

M us

st

Br ai n

ey

rt ea H

in e

0

*

6

16

** 2

8

24

**

**

Ki dn

0

**

ng

1

4

Lu

2

**

n

3

**

Sp le e

**

4

**

6

Li ve r

Virus RNA [log copies (mg tissue)–1]

5

SH FC64

(c) Virus RNA [log copies (mg tissue)–1]

(b)

SH FC 64

Virus RNA (log copies LD50–1 or ELD50–1)

(a)

Fig. 3. Viral 3D gene expression. (a) Log of virus RNA copies in 1 LD50 SH and 1 ELD50 FC64. RNA was extracted from 1 LD50 SH or 1 ELD50 FC64 and subjected to qRT-PCR. (b) Log of virus RNA copies in the heart, spleen, lung, kidney, brain, intestine and muscle of SH- or FC64-infected ducklings. Total RNA was extracted from different tissues at 36 h p.i. and subjected to qRT-PCR using specific primers. The error bars show the mean±SD from four liver specimens (n54). (c) The log of virus RNA copies in livers of SH- and FC64-infected ducks. Total RNA was extracted from livers at 16, 24 and 36 h p.i., and subjected to qRT-PCR using specific primers. Values represent mean±SD (n54). Virus titres were determined by comparing input RNA : Ct ratios. **P,0.01 and *P,0.05 indicate significant difference in gene expression using Student’s t-test.

Fold change

20

**

15 10 5

(b)15 h 36

Nitrate (mM)

b 5

h

a

36

h

h 16

24

Fold change

h

10

a

a

a

iNOS

0

10

16

h

m

oc

k

20

16

Fold change

*

**

16 h S h H F 24 C6 h 4 m o 24 ck 24 h S h H FC 64

30 **

6 4 2 0

c

**

50 40 30 20 10 10 8 6 4 2 0

IL-2 **

h 36

h 24

h 16

h 36

h

0

24

Fold change

30000 20000 10000

36

h 24

16

h

30 20 10 0

150 100 50

h 24

h 16

h 36

h 24

16

Fold change h 36

SH FC64

OASL **

h

h 24 h 24

h

20000 15000 10000 5000

36 **

*

16

IFN-γ **

25

0

h 36

h 24

h 16 16 20000 15000 10000 5000 200 150 100 50 8 6 4 2 0

**

ISG12

**

**

h

Fold change

IFITM1

400 300 200 100 20 15 10 5 4 3 2 1 0

IFN-β

200 150 100 50 25 20 15 10 5 0

h

Fold change

Fold change

30 20 10 0

IL-6

Fold change

**

h

IFN-α

1500 1000 500

16

(a)

Fig. 4. Upregulation of IFN genes, ISGs, pro-inflammatory cytokines and iNOS mRNA in duckling livers and NO production in duckling serum infected with SH or FC64. (a) Total RNA was extracted from livers at 16, 24 and 36 h p.i. and subjected to qRTPCR using specific primers. Gene fold changes were quantified and normalized with those in mock-infected ducklings. Values represent mean±SD (n54). *P,0.05 and **P,0.01 indicate cytokines with significant increases, as indicated by Student’s ttest. (b) Total nitrate and nitrite concentrations produced by NO in serum samples were detected at 16 and 24 h p.i., and normalized to the total protein content in the filtered sera. Values are presented as the mean±SD (n54). Different lower-case italic letters indicate significant differences of the means (P,0.05). 2720

Journal of General Virology 95

http://vir.sgmjournals.org

1000 1000 1000 1000 1000 1000 SH SH SH SH SH SH 104.5 103.5 102.5 101.5 100.5 – Control

1 2 3 4 5 6

FC64 FC64 FC64 FC64 FC64 –

1 1 1 1 1 –

Challenge virus Inoculation age (days)

Experiment group

To examine the antibody levels of FC64-vaccinated ducklings, sera of ducklings immunized with 103.5 ELD50 (0.2 ml)–1 FC64 were collected 5, 10, 15, 30 and 45 days

Virus

To investigate the underlying mechanisms of the protective effect, livers of four ducklings were collected to examine the expression levels of innate immune response-related genes 5 days after FC64 inoculation. Results showed that levels of all innate immune response-related genes were upregulated by FC64 infection in a dose-dependent manner (Fig. 5). Compared with the peak induction level at 36 h p.i. (Fig. 4a), the induction of these genes was notably reduced to a low level at 5 days p.i. (Fig. 5), showing that the innate immune response is an early defence response to infection.

Group

As FC64 has low virulence and induced a very intensive innate immunity response, it is a potential vaccine candidate. To assess the protective effect of the FC64 strain against the virulent SH strain, 1-day-old ducklings were immunized with diluted FC64 and then challenged with virulent SH virus 5 days p.i.. As shown in Table 1, all ducklings challenged directly with SH died quickly, with typical clinical features such as appetite loss, wasting, ataxia, wryneck and opisthotonus. When the ducklings were immunized with FC64 at 104.5 or 103.5 ELD50 (0.2 ml)–1, none died after SH challenge, demonstrating the protective effect of FC64 against SH infection. When the inoculation of FC64 copy numbers was reduced to 102.5, 101.5 or 100.5 ELD50 (0.2 ml)–1, fewer ducklings survived after challenge with SH, showing that the protective effect of FC64 against SH was dose-dependent.

Table 1. Protective effects of the attenuated FC64 strain

FC64-immunized ducklings resist virulent SH virus infection

Inoculation dose [ELD50 (0.2 ml)–1]

Challenge age (days)

These data were further verified by measuring serum NO levels in SH- and FC64-infected ducklings. In SH-infected ducklings, serum NO concentrations increased in a timedependent manner, with peak values at 24 h p.i. (Fig. 4b). In FC64-infected ducklings, NO levels were maintained at low levels similar to those in mock-infected ducklings. SH infection induced significantly greater NO production than FC64 infection. The high level of NO production induced by SH infection may correlate with apoptosis and pathogenesis.

6 6 6 6 6 6

Challenge dose [LD50 (0.2 ml)–1]

Results (survival/total)

iNOS is an indicator of NO in the tissues of infected animals (Burggraaf et al., 2011). To examine whether SH and FC induced iNOS and NO production, iNOS expression in DHAV-infected duckling liver was determined by qRT-PCR. As shown in Fig. 4(a), iNOS expression levels gradually increased in a time-dependent manner by SH infection, with increases of sixfold at 16 h p.i., 18-fold at 24 h p.i. and 23-fold at 36 h p.i. However, in FC64-infected ducklings, iNOS induction was at a relatively low level, with increases of fourfold at 16 h p.i., sixfold at 24 h p.i. and ninefold at 36 h p.i. These results demonstrated that SH infection induced higher levels of iNOS than FC64 infection.

10/10 10/10 6/10 1/10 0/10 0/10

Discordant innate immune responses to DHAV

2721

C. Song and others

104.5 ELD50 (0.2 ml)–1 103.5 ELD50 (0.2 ml)–1 10

102.5 ELD50 (0.2 ml)–1 101.5 ELD50 (0.2 ml)–1

Fold change

8

100.5 ELD50 (0.2 ml)–1

6 4 2

-2 IL

-6 IL

O AS L

IS G 12

IF IT M 1

-γ IF N

-β IF N

IF N

-α

0

Fig. 5. The mRNA levels of IFN, ISGs and pro-inflammatory cytokines in duckling livers inoculated with FC64 before challenge with SH. Total RNA was extracted from liver specimens on day 5 p.i. and then subjected to qRT-PCR analysis using specific primers. Gene fold changes were quantified and normalized with those in mock-infected ducklings. Values represent mean±SD (n54).

p.i. and subjected to a neutralization antibody assay. The results in Table 2 show that the neutralization titre of antibodies in serum was 23.8 at 5 days post-immunization and gradually increased to 24.7 at 10 days post-immunization, 25.1 at 15 days post-immunization and peaked at 26.5 at 30 days post-immunization. At 45 days post-immunization, the neutralization titres of FC64 antibodies slightly decreased to 25.6, which was higher than the protective titre of 23.8 at 5 days. The results showed that the immune duration was maintained for 45 days by a single immunization of FC64, which effectively protected the ducks against DHAV infection during the susceptible period. Altogether, these results demonstrated that FC64 provided effective protection against SH infection in ducklings by inducing the adaptive immune response.

DISCUSSION Different DHAV strains cause disease ranging from mild to severe in infected ducklings. The severe form is lifethreatening and causes significant economic losses to the duck-breeding industry. However, most previous studies of DHAV infection have focused only on the pathogenicity and host response of one virus strain (Song et al., 2013). In the current study, we compared differences in pathogenicity and innate immune responses induced by the virulent SH strain and attenuated FC64 strain in ducklings. As the attenuated FC64 strain did not cause fatalities, an inoculation of 103 ELD50 was used in this study. Although fewer SH virus copies were used for inoculation of the ducklings than FC64 virus copies (determined by genomic RNA level), greater numbers of SH virus RNA copies were detected in different organs at 36 h p.i., suggesting that the 2722

SH strain replicated more efficiently than the FC64 strain in ducklings. Our results showed that the liver, spleen and intestine are the primary target organs of these two DHAV strains. Increased liver lesions, liver dysfunction, apoptosis, serum NO levels and death were observed by SH infection, but not by FC64 infection. SH induced a moderate innate immune response at 24 h p.i., whilst FC64 induced an intensive innate immunity response at 36 h p.i. Moreover, FC64 infection stimulated production of high anti-DHAV antibody levels in infected ducklings. The strong immunostimulatory effect and low virulence of FC64 indicates that it is a good candidate for vaccine development. The liver is the primary target organ of DHAV infection, resulting in liver dysfunction. Microscopic analysis revealed condensed nuclei and focal necrosis of hepatocytes together with the presence of acidophilic bodies and increased heterophilic infiltration after infection with SH, in accordance with the findings of a previous study (Hu et al., 2002). Less pathological change was observed in FC64-infected duckling livers. The impaired liver function by SH infection was also reflected by enhanced expression of the serum biochemical markers ALT, AST, ALP, GGT and T-Bil. The TUNEL assay results and caspase-3 cleavage showed that SH infection induced apoptosis in the duckling liver, which was the most prominent site of apoptosis and sustained the most severe DHAV-induced pathological change. No apoptosis was observed in FC64infected duckling livers. The induction of apoptosis by SH infection may be correlated with the observed liver lesions and subsequent liver dysfunction, and may be attributed to virus virulence (Ito et al., 2002). The innate immune response is an early host defence response to pathogen infection and can constrain the initial Journal of General Virology 95

Discordant innate immune responses to DHAV

Table 2. Antibody levels of ducklings immunized with FC64 Sera from FC64-immunized ducklings were collected at 5, 10, 15, 30 and 45 days p.i., and subjected to neutralization assay using chicken embryos. Sera from ducklings vaccinated with AV2111 and from normal ducklings were used as positive and negative controls, respectively. Chick embryos inoculated with FC64 were also included as controls. Group

Serum

Experiment group

FC64

Control

DHAVpositive -negative FC64

Collection time (days p.i.)

Results (total dead/total tested) 1:2

1:4

1:8

1 : 16

1 : 32

1 : 64

1 : 128

5 10 15 30 45 –

0/5 – – – – –

0/5 0/5 0/5 – – –

0/5 0/5 0/5 – – –

3/5 1/5 0/5 0/5 1/5 0/5

5/5 3/5 2/5 0/5 2/5 0/5

5/5 5/5 5/5 1/5 2/5 2/5

– – – 4/5 5/5 4/5

– – – 5/5 – 5/5

23.8 24.7 25.1 26.5 25.6 26.3

– –

5/5

5/5

5/5

5/5

– 5/5

–

–

–

0 0

infection (Everett & McFadden, 1999). It was noted that the virulent SH strain induced a cytokine response during the early infection stage (24 h p.i.), which decreased during the late infection stage (36 h p.i.). The rapid induction of cytokines may be due to the rapid and high-level replication of this virus strain. Also, the decline in cytokine levels at 36 h p.i. indicates that this strain may antagonize cytokine production through an unknown mechanism, which benefits virus replication and infection. In FC64infected ducklings, IFN levels were persistently elevated and peaked at 36 h p.i. (IFN-a, 1150-fold increase; IFN-b, 165fold increase) and declined by 5 days p.i. The induction of cytokines by FC64 at 36 h p.i. was more intensive than that induced by SH infection, which may help the host to limit FC64 replication and further induce the adaptive immune response.

1 : 256

Neutralization titre

antiviral defence (Darnell et al., 1994; Takaoka & Taniguchi, 2003). In FC64-infected ducklings, IFITM1 expression was increased up to 329-fold, ISG12 up to 7963-fold and OASL up to 7250-fold. The robust induction of ISGs by FC64 infection is key to restricting FC64 to low replication levels, thereby aiding the host duckling to clear the virus and remain healthy. Meanwhile, the relatively low induction level of IFN and ISGs by SH infection may contribute to the robust replication and pathogenicity observed with this strain.

Amongst all the cytokines induced by DHAV infection, IL6 functions to stimulate the immune response and induces production of major acute-phase proteins (Andus et al., 1987; Gauldie et al., 1987), as well as the production of neutrophils in the bone marrow. IL-6 also supports the growth of B cells and is antagonistic to regulatory T cells, as well as playing an important role against pathogen infection (Wong et al., 1988). In this study, SH infection induced a 170-fold increase in IL-6 expression at 24 h p.i. and maintained this level until 36 h p.i. However, FC64 infection induced a 44-fold increase in IL-6 expression, which dramatically increased to 15 414-fold at 36 h p.i. The intensive induction of IL-6 by FC64 infection may help the host animal to clear the viral infection and activate the adaptive immune response. Indeed, antiviral antibodies were produced in FC64-infected ducklings by 5 days p.i.; the antibodies were persistently elevated and peaked by 30 days p.i., effectively protecting them from SH attack.

Amongst the cytokines induced by DHAV infection, only IL-2 and IFN-c were strongly upregulated by SH infection, and IL-2 may be the inducer of IFN-c (Ye et al., 1995). Previous reports have shown that IFN-c production upregulated iNOS mRNA expression (Chan & Riches, 2001; Lorsbach et al., 1993; Melillo et al., 1994). The high levels of iNOS and NO in SH-infected ducklings may be correlated with the induction level of IFN-c. NO is produced primarily as an effecter molecule as part of the host defence response against viral infection (Bogdan et al., 2000; Karupiah et al., 1993; Kreil & Eibl, 1996) and also plays a role in pathogenesis (Suzuki et al., 2014). An abundance of NO reacts with superoxide anion to form peroxynitrite, which has a wider range of chemical targets. Peroxynitrite is able to change the catalytic activity of enzymes, alter cytoskeleton organization, impair cell signal transduction, and induce apoptosis and necrosis. Peroxynitrite can also break DNA strands and inhibit DNA ligase activity, which increases the frequency of DNA strand breaks and activates DNA repair mechanisms, including poly(ADP) ribose polymerase. Therefore, in SH-infected ducklings, upregulation of IL-2 and IFN-c expression may induce expression of iNOS and NO production, contributing to apoptosis and pathologies.

The induction of IFN induced expression of a set of antiviral proteins (ISGs), including IFITM1, ISG12 and OASL. IFN and ISGs may inhibit virus replication in the infected cells and provoke uninfected cells to mount an

In conclusion, our findings demonstrated that the innate immune response contributes to disease severity and viral replication efficiency in ducklings infected with different DHAV strains. However, further studies are required to

http://vir.sgmjournals.org

2723

C. Song and others

identify viral factors that contribute to the different host innate immune responses. Considering that the attenuated FC64 strain replicates at low levels in vivo, induces slight liver damage, provokes a strong innate immune response, induces high levels of antibodies and provides ducklings with effective protection against virulent DHAV strain infection, it is a good DHAV vaccine candidate. Hence, further work is in progress to develop DHAV as a mature vaccine.

METHODS Virus preparation. Two DHAV strains were used in this study: SH (GenBank accession number HQ265433) and FC64 (GenBank accession number HQ232303). Both SH and FC64 strains belong to DHAV-1, and were propagated in embryonated duck eggs and embryonated chicken eggs, respectively (Song et al., 2011a, b). The SH strain was isolated from a duckling with liver ascites in Shanghai, China, whilst the attenuated FC64 strain was originally passaged for 64 generations in specific pathogen-free eggs from the FC strain isolated from Fujian Province, China. The LD50 of the SH strain was determined as 104.6 LD50 (0.2 ml)–1 and the ELD50 of the FC64 strain was determined as 107.5 ELD50 (0.2 ml)–1. Both viruses were stored at 280 uC for further use. Duckling and virus inoculation. One-day-old Peking ducklings

(n536) were purchased from Zhuang Hang Duck Farm, and housed in cages with free access to food and water during the study period. The temperature was maintained at 28–30 uC and the air was changed 8–10 times h–1. All ducklings were obtained from flocks with no prior exposure to DHAV, as confirmed by negative antibody test results. The ducklings were randomly divided into three groups: two experimental groups received subcutaneous injections of 103 LD50 (SH strain) or 103 ELD50 (FC64 strain), respectively, to the nape of the neck, whilst the third group served as a control. All ducklings were maintained in accordance with the Institutional Animal Care and Use Committee guidelines of the Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Science. Pathological identification and histological examination.

Clinical signs of the experimental and control duckling groups were recorded daily following DHAV infection. Infected ducklings were sacrificed and the livers were collected for histological analysis, which was performed as described previously (Cheng et al., 2001). After fixing in 4 % formalin for 24 h, the liver samples were dehydrated using graded alcohol, embedded in paraffin and sliced into 4 mm sections, which were stained with haematoxylin and eosin and observed under a light microscope (Eclipse TS100; Nikon). Measurement of AST, ALT, ALP, GGT and T-Bil activity. The

serum concentrations of the enzymes ALT, AST, ALP, GGT and T-Bil were determined using a BS-200 chemical analyser (Mindray). All statistical analyses were performed using SPSS v. 13.0 software (SPSS). The results are expressed as mean±SD (P,0.05). TUNEL assay. The 4 mm sections were examined by TUNEL whilst

mounted on poly-L-lysine-coated slides, subsequently de-waxed by immersion in fresh xylene for 5 min at room temperature and then rehydrated in a series of graded alcohol. In situ detection of fragmented DNA was performed using a Cell Death Detection kit (POD; Roche Diagnostics) according to the manufacturer’s instructions. Apoptotic cells were observed under a light microscope. Western blot analysis. Western blot analysis was performed

to assess caspase-3 cleavage. Briefly, 1 g infected liver tissue was harvested at 16, 24 and 36 h p.i., ground, and then lysed in lysis buffer 2724

(Beyotime). The samples were subjected to 10 % SDS-PAGE and Western blot analysis. Briefly, proteins were transferred onto PVDF membranes (Bio-Rad) and the membranes were blocked with 5 % BSA in Tris-buffered saline with Tween 20 (TBST) for 1 h. Membranes were then incubated with anti-caspase-3 antibody (Abcam) at a dilution of 1 : 1000 in blocking buffer for 1 h at room temperature. After washing three times with TBST, the membranes were incubated with anti-rabbit HRP-conjugated secondary antibodies (diluted to 1 : 1000 in blocking buffer) at room temperature for 1 h. After washing three times with TBST, signals were developed using an enhanced chemiluminescence detection system (Amersham Pharmacia Biotech) and exposed to X-ray film (Fuji Film). RNA extraction and qRT-PCR. Total RNA from 0.1 g SH- or FC64-

infected liver tissues was extracted using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions and then treated with DNase to remove genomic DNA. Total RNA (3 mg) was used to perform reverse transcription using Moloney murine leukemia virus reverse transcriptase (TaKaRa) and oligo-dT primers. An equal volume of cDNA was then subjected to qRT-PCR using SYBR Green Real-Time RT-PCR Master Mix Plus (Promega) and appropriate primers. The primers for IFN-a (Cagle et al., 2011), IFN-b, IFN-c, IFITM1, ISG12, OASL (Vanderven et al., 2012), IL-6, IL-2, iNOS and Arbp (acidic ribosomal phosphoprotein) are listed in Table 3. Arbp was used as a control (Sun et al., 2013). Reactions were performed in triplicate using a ABI PRISM 7500 Real-Time RT-PCR System (Applied Biosystems). Expression fold was determined using the 2–DDCt method with Arbp as an endogenous reference gene to normalize the level of target gene expression. Virus titres of inoculation and virus titres in heart, spleen, lung, kidney, brain, intestine and muscle were determined by detection of the expression levels of the DHAV 3D gene using a one-step real-time TaqMan RT-PCR assay (Yang et al., 2008). Primers for DHAV 3D and DHAV FP are listed in Table 1. Briefly, a standard plasmid encoding the DHAV 3D gene was constructed, serially diluted 10-fold and quantified using real-time TaqMan RT-PCR assay. A regression curve was constructed to plot the threshold cycle values versus the logarithm of the copies. Analysis was based on the data for generating the standard curve to obtain an equation and Ct values for each sample were determined. Reactions were performed in triplicate using a ABI PRISM 7500 Real-Time PCR System (Applied Biosystems). NO assay. NO level was measured in serum collected at 16 and 24 h

p.i. from four ducklings from each group. Serum was passed through a 10 kDa ultrafilter (Millipore) prior to analysis. The total protein content in the filtered serum was measured using a DC Protein Assay (Bio-Rad). A NO Synthase Assay kit (Calbiochem-Novabiochem) was used to measure the NO content in 40 ml filtered serum according to the manufacturer’s instructions (Cagle et al., 2011; Pantin-Jackwood et al., 2012). Values were normalized to the total protein content in the filtered serum. Protective test. One-day-old ducklings were randomly divided into experimental and control groups (n510 each). Ducklings in the experimental group were subcutaneously inoculated with attenuated FC64 virus in 10-fold serial dilutions. Five days later, all ducklings were challenged with 103 LD50 of virulent SH virus to observe the protective effects of the attenuated FC64 strain. Neutralization test. After immunization with 103.5 ELD50 (0.2 ml)–1

FC64, sera of ducklings were collected at different time points to examine the antibody levels by neutralization test; 103.5 ELD50 (0.2 ml)–1 FC64 was used as the virus copy number sufficient to protect ducklings from SH attack (Table 2). Briefly, serum from four FC64-immunized ducklings was mixed and inactivated at 56 uC for 30 min, and diluted in 221, 222, 223, 224, 225, 226, 227 and 228 Journal of General Virology 95

Discordant innate immune responses to DHAV

Table 3. Primers used in this study Targets IFN-a IFN-b IFN-c IL-6 IL-2 IFITM1 OASL ISG12 DHAV 3D DHAV FP iNOS Arbp

Forward primer (5§A3§)

Reverse primer (5§A3§)

GGGCCCCGCAACCTT CCTCAACCAGATCCAGCATT CCTCGTGGAACTGTCAAACCTT TTCGACGAGGAGAAATGCTT CTGGCAAACTCTGCAATGTTACT CACCGCCAAGTACCTGAACA GACCAACACACACTGCAGCACTA AAAATGGCTGACCGAAACGT TGATGAGATATGGCAGGTAGAAGGA FAM-TGTGTTCAGGATCCCCATGTACTACCGTG-TAMRA CCACCAGGAGATGTTGAATATGTC CGACCTGGAAGTCCAACTAC

serial dilutions. The diluted sera were then mixed with FC64 strain [final concentration 100 ELD50 (0.2 ml)–1] in a 1 : 1 ratio at 37 uC for 1 h. Each mixture was inoculated into five 9-day-old chicken embryos through the urinary cavity. The number of dead chicken embryos was recorded and neutralization titres were calculated using the Reed– Muench method. Sera from four ducklings immunized with the AV2111 strain (purchased from China Institute of Veterinary Drugs Control) were included in the neutralization test as positive controls and sera from four normal ducklings were included in the neutralization test as negative controls. Chick embryos directly inoculated with 100 ELD50 (0.2 ml)–1 FC64 were also included as controls.

CTGTAGGTGTGGTTCTGGAGGAA GGATGAGGCTGTGAGAGGAG CTCACAGCCTTGCGTTGGA CCTTATCGTCGTTGCCAGAT TGGGGGAATTAGGTCCATAAGTT CGATCAGGGCGATGATGAG CCGTAGCCGCAGAAGCA TGTGTGAAGCAAGCGAACCT CACGCAAGCTGATTCACAATAGA CCAGATGTGTGTTTTCCATGCA ATCTGCTGCATCTGCTTG

Chan, E. D. & Riches, D. W. (2001). IFN-c+LPS induction of iNOS is

modulated by ERK, JNK/SAPK, and p38MAPK in a mouse macrophage cell line. Am J Physiol Cell Physiol 280, C441–C450.

Cheng, A.-C., Wang, M.-S., Chen, X.-Y., Guo, Y.-F., Liu, Z.-Y. & Fang, P.-F. (2001). Pathogenic and pathological characteristic of new type

gosling viral enteritis first observed in China. World J Gastroenterol 7, 678–684. Darnell, J. E., Jr, Kerr, I. M. & Stark, G. R. (1994). Jak–STAT pathways

and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science 264, 1415–1421. Ding, C. & Zhang, D. (2007). Molecular analysis of duck hepatitis

virus type 1. Virology 361, 9–17.

ACKNOWLEDGEMENTS This work was funded by grants from the National Natural Science Foundation of China (31302099), Chinese Special Fund for Agricultural Sciences Research in the Public Interest (201003012) and the Chinese National High-tech R&D Program (863 Program, 2011AA10A209).

Ding, L. (1996). Apoptosis of liver. Chin J Pathol 25, 118–120. Everett, H. & McFadden, G. (1999). Apoptosis: an innate immune

response to virus infection. Trends Microbiol 7, 160–165. Fu, Y., Pan, M., Wang, X., Xu, Y., Yang, H. & Zhang, D. (2008).

Molecular detection and typing of duck hepatitis A virus directly from clinical specimens. Vet Microbiol 131, 247–257. Galiana-Arnoux, D. & Imler, J. L. (2006). Toll-like receptors and

innate antiviral immunity. Tissue Antigens 67, 267–276.

REFERENCES Andus, T., Geiger, T., Hirano, T., Northoff, H., Ganter, U., Bauer, J., Kishimoto, T. & Heinrich, P. C. (1987). Recombinant human B cell stimulatory factor 2 (BSF-2/IFN-b 2) regulates b-fibrinogen and

albumin mRNA levels in Fao-9 cells. FEBS Lett 221, 18–22. Asplin, F. (1958). An attenuated strain of duck hepatitis virus. Vet Rec

70, 1226–1230. Bi 2in, Z. & Bidin, Z. (2008). Diseases of Poultry. Zagreb: University of

Zagreb. Bogdan, C., Ro¨llinghoff, M. & Diefenbach, A. (2000). Reactive oxygen

and reactive nitrogen intermediates in innate and specific immunity. Curr Opin Immunol 12, 64–76. Burggraaf, S., Bingham, J., Payne, J., Kimpton, W. G., Lowenthal, J. W. & Bean, A. G. (2011). Increased inducible nitric oxide synthase

Gauldie, J., Richards, C., Harnish, D., Lansdorp, P. & Baumann, H. (1987). Interferon beta 2/B-cell stimulatory factor type 2 shares

identity with monocyte-derived hepatocyte-stimulating factor and regulates the major acute phase protein response in liver cells. Proc Natl Acad Sci U S A 84, 7251–7255. Grossmann, J. (2002). Molecular mechanisms of ‘‘detachment-

induced apoptosis – Anoikis’’. Apoptosis 7, 247–260. Hu, X., Su, J., Cheng, G. & Zhou, S. (2002). Histopathology of

experimental infectious duckling with new type duck hepatitis virus. Chin J Vet Sci 22, 549–551. Hu, X. & Cheng, G. (1996). [The study of the pathogenesis of duckling viral hepatitis]. J Huazhong Agric Univ 15, 254–256 (in Chinese). Ito, T., Kobayashi, Y., Morita, T., Horimoto, T. & Kawaoka, Y. (2002).

Virulent influenza A viruses induce apoptosis in chickens. Virus Res 84, 27–35.

expression in organs is associated with a higher severity of H5N1 influenza virus infection. PLoS ONE 6, e14561.

Janeway, C. A., Jr & Medzhitov, R. (2002). Innate immune recogni-

Cagle, C., To, T. L., Nguyen, T., Wasilenko, J., Adams, S. C., Cardona, C. J., Spackman, E., Suarez, D. L. & Pantin-Jackwood, M. J. (2011).

Karupiah, G., Xie, Q. W., Buller, R. M., Nathan, C., Duarte, C. & MacMicking, J. D. (1993). Inhibition of viral replication by interferon-

Pekin and Muscovy ducks respond differently to vaccination with a H5N1 highly pathogenic avian influenza (HPAI) commercial inactivated vaccine. Vaccine 29, 6549–6557.

Kawai, T. & Akira, S. (2006). Innate immune recognition of viral

http://vir.sgmjournals.org

tion. Annu Rev Immunol 20, 197–216.

gamma-induced nitric oxide synthase. Science 261, 1445–1448. infection. Nat Immunol 7, 131–137. 2725

C. Song and others

Kim, M. C., Kwon, Y. K., Joh, S. J., Lindberg, A. M., Kwon, J. H., Kim, J. H. & Kim, S. J. (2006). Molecular analysis of duck hepatitis virus

innate immunity against Newcastle disease virus infections. Mol Immunol 53, 321–327.

type 1 reveals a novel lineage close to the genus Parechovirus in the family Picornaviridae. J Gen Virol 87, 3307–3316.

Suzuki, C., Aoki-Yoshida, A., Kimoto-Nira, H., Kobayashi, M., Sasaki, K. & Mizumachi, K. (2014). Effects of strains of Lactococcus

Kim, M. C., Kwon, Y. K., Joh, S. J., Kim, S. J., Tolf, C., Kim, J. H., Sung, H. W., Lindberg, A. M. & Kwon, J. H. (2007). Recent Korean isolates of

duck hepatitis virus reveal the presence of a new geno- and serotype when compared to duck hepatitis virus type 1 type strains. Arch Virol 152, 2059–2072. Kreil, T. R. & Eibl, M. M. (1996). Nitric oxide and viral infection: NO

antiviral activity against a flavivirus in vitro, and evidence for contribution to pathogenesis in experimental infection in vivo. Virology 219, 304–306. Levine, P. & Fabricant, J. (1950). A hitherto-undescribed virus disease

of ducks in North America. Cornell Vet 40, 71–86. Li, J., Bi, Y., Chen, C., Yang, L., Ding, C. & Liu, W. (2013). Genetic

characterization of Duck Hepatitis A Viruses isolated in China. Virus Res 178, 211–216. Lorsbach, R. B., Murphy, W. J., Lowenstein, C. J., Snyder, S. H. & Russell, S. W. (1993). Expression of the nitric oxide synthase gene in

mouse macrophages activated for tumor cell killing. Molecular basis for the synergy between interferon-gamma and lipopolysaccharide. J Biol Chem 268, 1908–1913. Melillo, G., Cox, G. W., Biragyn, A., Sheffler, L. A. & Varesio, L. (1994).

Regulation of nitric-oxide synthase mRNA expression by interferongamma and picolinic acid. J Biol Chem 269, 8128–8133. Pantin-Jackwood, M. J., Smith, D. M., Wasilenko, J. L., Cagle, C., Shepherd, E., Sarmento, L., Kapczynski, D. R. & Afonso, C. L. (2012).

Effect of age on the pathogenesis and innate immune responses in Pekin ducks infected with different H5N1 highly pathogenic avian influenza viruses. Virus Res 167, 196–206.

lactis on the production of nitric oxide and cytokines in murine macrophages. Inflammation doi:10.1007/s10753-014-9901-6 [Epub ahead of print]. Takaoka, A. & Taniguchi, T. (2003). New aspects of IFN-alpha/beta

signalling in immunity, oncogenesis and bone metabolism. Cancer Sci 94, 405–411. Theofilopoulos, A. N., Baccala, R., Beutler, B. & Kono, D. H. (2005). Type I interferons (a/b) in immunity and autoimmunity. Annu Rev

Immunol 23, 307–335. Tseng, C. H. & Tsai, H. J. (2007). Sequence analysis of a duck

picornavirus isolate indicates that it together with porcine enterovirus type 8 and simian picornavirus type 2 should be assigned to a new picornavirus genus. Virus Res 129, 104–114. Tseng, C. H., Knowles, N. J. & Tsai, H. J. (2007). Molecular analysis of

duck hepatitis virus type 1 indicates that it should be assigned to a new genus. Virus Res 123, 190–203. Vanderven, H. A., Petkau, K., Ryan-Jean, K. E., Aldridge, J. R., Jr, Webster, R. G. & Magor, K. E. (2012). Avian influenza rapidly

induces antiviral genes in duck lung and intestine. Mol Immunol 51, 316–324. Varghese, S. S., Sunil, P. M. & Madhavan, R. N. (2010–2011).

Expression of inducible nitric oxide synthase (iNOS) in oral precancer and oral squamous cell carcinoma: an immunohistochemical study. Cancer Biomark 8, 155–160. Wong, G. G., Witek-Giannotti, J. S., Temple, P. A., Kriz, R., Ferenz, C., Hewick, R. M., Clark, S. C., Ikebuchi, K. & Ogawa, M. (1988).

Sheng, X. D., Zhang, W. P., Zhang, Q. R., Gu, C. Q., Hu, X. Y. & Cheng, G. F. (2014). Apoptosis induction in duck tissues during duck

Stimulation of murine hemopoietic colony formation by human IL-6. J Immunol 140, 3040–3044.

hepatitis A virus type 1 infection. Poult Sci 93, 527–534. Song, C., Han, X., Qiu, X. & Ding, C. (2011a). [Complete sequence and analysis of duck hepatitis virus type 1strain FC64]. Prog Vet Med 32, 17–20 (in Chinese). Song, C., Qiu, X., Chen, H. & Ding, C. (2011b). [Characterization and complete sequencing of a duck hepatitis virus type 1 isolate from a duckling with ascites]. Ascites J Anim Infect Dis 19, 39–44 (in Chinese).

Woolcock, P. R. & Crighton, G. W. (1979). Duck virus hepatitis: serial

passage of attenuated virus in ducklings. Vet Rec 105, 30–32. Xu, F., Chen, F. & Li, J. (1990). [Studies of pathology in ducklings to

different virulent duck hepatitis viruses]. Anim Husband Vet Med 4, 154–155 (in Chinese). Yang, M., Cheng, A., Wang, M. & Xing, H. (2008). Development and

Song, C., Yu, S., Duan, Y., Hu, Y., Qiu, X., Tan, L., Sun, Y., Wang, M., Cheng, A. & Ding, C. (2014). Effect of age on the pathogenesis of

application of a one-step real-time Taqman RT-PCR assay for detection of Duck hepatitis virus type1. J Virol Methods 153, 55– 60.

DHV-1 in Pekin ducks and on the innate immune responses of ducks to infection. Arch Virol 159, 905–914.

Ye, J., Ortaldo, J. R., Conlon, K., Winkler-Pickett, R. & Young, H. A. (1995). Cellular and molecular mechanisms of IFN-gamma produc-

Sun, Y., Ding, N., Ding, S. S., Yu, S., Meng, C., Chen, H., Qiu, X., Zhang, S., Yu, Y. & other authors (2013). Goose RIG-I functions in

tion induced by IL-2 and IL-12 in a human NK cell line. J Leukoc Biol 58, 225–233.

2726

Journal of General Virology 95