Plant Physiology and Biochemistry 101 (2016) 132e140
Contents lists available at ScienceDirect
Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy
Research article
Volatiles released by endophytic Pseudomonas fluorescens promoting the growth and volatile oil accumulation in Atractylodes lancea Jia-Yu Zhou a, Xia Li b, Jiao-Yan Zheng a, Chuan-Chao Dai a, * a Jiangsu Key Laboratory for Microbes and Functional Genomics, Jiangsu Engineering and Technology Research Center for Industrialization of Microbial Resources, College of Life Sciences, Nanjing Normal University, Nanjing, Jiangsu Province, 210023, China b Jiangsu High Quality Rice Research and Development Center, Nanjing Branch of China National Center Rice Improvement, Institute of Food Crops, Jiangsu Academy of Agricultural Sciences, Nanjing, Jiangsu Province, 210014, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 24 November 2015 Received in revised form 29 January 2016 Accepted 31 January 2016 Available online 2 February 2016
Atractylodes lancea is a well-known, but endangered, Chinese medicinal plant whose volatile oils are its main active components. As the volatile oil content in cultivated A. lancea is much lower than that in the wild herb, the application of microbes or related elicitors to promote growth and volatile oil accumulation in the cultivated herb is an important area of research. This study demonstrates that the endophytic bacterium Pseudomonas fluorescens ALEB7B isolated from the geo-authentic A. lancea can release several nitrogenous volatiles, such as formamide and N,N-dimethyl-formamide, which significantly promote the growth of non-infected A. lancea. Moreover, the main bacterial volatile benzaldehyde significantly promotes volatile oil accumulation in non-infected A. lancea via activating plant defense responses. Notably, the bacterial nitrogenous volatiles cannot be detected in the A. lancea e Pseudomonas fluorescens symbiont while the benzaldehyde can be detected, indicating the nitrogenous volatiles or their precursors may have been consumed by the host plant. This study firstly demonstrates that the interaction between plant and endophytic bacterium is not limited to the commonly known physical contact, extending the ecological functions of endophyte in the phytosphere and deepening the understandings about the symbiotic interaction. © 2016 Elsevier Masson SAS. All rights reserved.
Keywords: Atractylodes lancea Bacterial volatiles Endophytic bacterium Non-contact co-culture Plant growth promotion Pseudomonas fluorescens Volatile oil accumulation
1. Introduction Atractylodes lancea is a traditional Chinese medicinal plant and is a main ingredient of many popular Chinese medicines, which are used to treat rheumatic diseases, digestive disorders, night blindness, and influenza (Wang et al., 2008). Volatile oils are the active components in A. lancea, and consist mainly of hinesol, b-eudesmol, atractylone, and atractylodin (Ren and Dai, 2012). The quality of A. lancea is closely linked to its producing area and A. lancea grown in the Maoshan area of the Jiangsu Province is the geo-authentic herb (Ouyang et al., 2012). In recent years, geo-authentic A. lancea has become endangered due to habitat destruction and over-
Abbreviation: ANOVA, a one-way analysis of variance; CFU, colony forming units; FW, fresh weight; GC, gas chromatography; GC-MS, gas chromatographymass spectrometer; LB, Luria-Bertani; MS, Murashige-Skoog; NAA, naphthaleneacetic acid; NIST, National Institute of Standards and Technology; SD, standard deviations. * Corresponding author. E-mail address: [email protected] (C.-C. Dai). http://dx.doi.org/10.1016/j.plaphy.2016.01.026 0981-9428/© 2016 Elsevier Masson SAS. All rights reserved.
exploitation (Yuan et al., 2009). Although cultivation can ensure the yield of medicinal materials, the volatile oil content in cultivated A. lancea is much lower than that in the wild herb. We have tried to promote growth and volatile oil accumulation in cultivated A. lancea by applying microbes or related elicitors (Wang et al., 2012). Our previous study demonstrates that the endophytic fungus Acremonium strictum AL16 can enhance the drought tolerance of A. lancea (Yang et al., 2015). The endophytic fungus Gilmaniella sp. AL12 and endophytic bacterium Acinetobacter sp. ALEB16 can promote volatile oil accumulation in A. lancea plantlets (Wang et al., 2011, 2015). However, the efficiencies of these endophytes in promoting volatile oil accumulation in A. lancea do not meet the requirements for cultivation. We have isolated endophytic bacteria from the geo-authentic A. lancea and screened out an endophytic bacterium Pseudomonas fluorescens ALEB7B, which has plant growth-promoting ability and can also promote the volatile oil accumulation more efficiently than other reported endophytes (Zhou et al., 2013). This endophytic bacterium can establish a stable symbiotic relationship with A. lancea and help the host plant to fight against Southern Blight (Zhou et al., 2014).
J.-Y. Zhou et al. / Plant Physiology and Biochemistry 101 (2016) 132e140
133
Previous studies demonstrate that proteins and polysaccharides secreted by P. fluorescens ALEB7B can promote volatile oil accumulation in A. lancea, but the bacterial proteins and polysaccharides are not as effective as endophytic bacterial infection (unpublished data). Therefore, we propose that there are other components of P. fluorescens ALEB7B that have beneficial effects on volatile oil accumulation apart from these bacterial extracellular macromolecules. Several studies have shown that volatiles released by rhizospheric bacteria can promote plant growth and secondary metabolite accumulation (Ryu et al., 2003; Banchio et al., 2009; Santoro et al., 2011). When grown on Luria-Bertani (LB) agar, P. fluorescens ALEB7B releases abundant volatiles (Zhou et al., 2014). Therefore, we propose that volatiles released by P. fluorescens ALEB7B can affect growth and volatile oil accumulation in A. lancea. As growth on LB agar, which is rich in nutrients, is different from the in planta environment, Murashige-Skoog (MS) agar is used in this study to culture the endophytic bacterium, in order to better mimic the growth conditions in planta (Blom et al., 2011). Volatiles released by P. fluorescens ALEB7B grown on MS agar were collected, identified, and tested for their impacts on A. lancea. This study provides a theoretical basis for the application of P. fluorescens ALEB7B in the cultivation of A. lancea and sheds further light on the symbiotic interaction between these two organisms.
In the treatment of endophytic bacterial inoculation (Bacterium), A. lancea aseptic tissue culture plantlets were sprayed with 200 mL of bacterial suspension, which flowed from the leaf surfaces to the roots. In the treatment of endophytic bacterial volatiles (Volatiles), a non-contact co-culture system was established (Fig. 1). 200 ml of bacterial suspension was cultured on 2 ml of MS rooting agar in a small Petri dish (Blom et al., 2011), which was placed beside A. lancea aseptic tissue culture plantlet. The plant tissue culture containers were sealed with parafilm. Other plantlets treated with 200 mL of sterile double-distilled water were set as control (Control). All treated and control plantlets were randomized in the growth chamber.
2. Methods
Inoculated with 200 mL of bacterial suspension and cultured for 30 days, the A. lancea aseptic tissue culture plantlets were sampled and surface sterilized (Zhou et al., 2013). The amount of P. fluorescens ALEB7B inside A. lancea was estimated using bacterial cell culture and quantitative PCR (qPCR) according to Zhou et al. (2016). The number of colony forming units (CFU) per gram of
2.1. A. lancea plantlets and growth conditions A. lancea aseptic tissue culture plantlets were established as previously described (Wang et al., 2012, 2015). Buds were collected from cultivated A. lancea and washed under running water, after which all procedures were conducted aseptically. Buds were surface sterilized by immersing in 75% (V/V) ethanol for 30 s, soaking in 1% (W/V) mercury chloride for 10 min, and thoroughly rinsing 5 times in sterile double-distilled water. Several buds were randomly selected, homogenized, and inoculated on potato dextrose agar to confirm the absence of endophytes (Zhou et al., 2014). Intact, surface sterilized buds were then transferred to 100 mL of MS agar supplemented with 0.3 mg L1 naphthaleneacetic acid (NAA) and 2.0 mg L1 6-benzyladenine in sealed 500-mL plant tissue culture containers. When enough buds had germinated, they were separated and transplanted into 100 mL of MS rooting agar supplemented with 0.1 mg L1 NAA in sealed 500-mL plant tissue culture containers to develop into plantlets. All aseptic tissue culture plantlets were kept in a growth chamber with a photoperiod of 12 h, a light density of 3400 lm m2, and a temperature cycle of 25/18 C day/night. Plantlets used in this study were 4 weeks old.
2.3. Chemicals and treatments Formamide, N,N-dimethyl-formamide, and benzaldehyde were purchased from SigmaeAldrich (St. Louis, MO) and sterilized by filtering through 0.22-mm sterile filters. The final concentrations of formamide, N,N-dimethyl-formamide, and benzaldehyde in the plant tissue culture containers were 0.006, 0.010, and 0.025 ml ml1 air, respectively, which accorded with their concentrations detected in the non-contact co-culture system. 2.4. Enumeration of P. fluorescens ALEB7B inside A. lancea
2.2. Endophytic bacterium and treatments P. fluorescens ALEB7B was isolated from the geo-authentic A. lancea grown in the Maoshan area of the Jiangsu Province (Zhou et al., 2013) and preserved at the China Center for Type Culture Collection (CCTCC AB 2013331). The molecular identification of P. fluorescens ALEB7B was confirmed and its colonization inside A. lancea was observed by scanning electron microscope in our previous study (Zhou et al., 2014). Moreover, the colonization of P. fluorescens ALEB7B inside A. lancea was further verified by the reisolation of this strain and the existence of a specific gene of P. fluorescens in planta (Zhou et al., 2016). Bacterium was grown in LB broth at 30 C with agitation (220 rpm) for 24 h and bacterial cells were collected and re-suspended in sterile double-distilled water, with the concentration adjusted to 106 cells mL1.
Fig. 1. The sketch (A) and picture (B) of non-contact co-culture system of A. lancea and P. fluorescens ALEB7B. 200 ml of bacterial suspension was cultured on 2 ml of MS rooting agar in a small Petri dish, which was placed beside A. lancea aseptic tissue culture plantlet. The plant tissue culture containers were sealed with parafilm. Other plantlets treated with 200 mL of sterile double-distilled water were set as control.
134
J.-Y. Zhou et al. / Plant Physiology and Biochemistry 101 (2016) 132e140
plant fresh weight (FW) was calculated as the number of P. fluorescens ALEB7B in planta. The 16S rRNA sequence of the reisolated strain had the highest similarity (100%) with the 16S rRNA sequence of the original strain (KF460526), confirming the reisolation of P. fluorescens ALEB7B from A. lancea. The number of gyrB gene copies per nanogram of total DNA extracted from A. lancea inoculated with P. fluorescens ALEB7B was calculated as the concentration of P. fluorescens ALEB7B in planta. Primers were gyrBqPCR-F (TTGGCGACAGCGAAACCACC) and gyrB-qPCR-R (GCCACCCTCGTACTTGAACAGC). 2.5. Plant growth and photosynthetic parameter measurements Harvested plantlets were dried at 36 C to constant weights and weighed (Wang et al., 2015). Net photosynthetic rate was monitored using a Li-Cor 6400 Portable Photosynthesis System (Lincoln, Nebraska, USA) according to Li and Wang (2013). Compressed air containing 350 mmol mol1 CO2 was used as a gas source, and the photosynthetic photon flux density was 200 mmol m2 s1. Measurements were conducted from 9:00 a.m. to 10:00 a.m.
2.6. Volatile oil extraction and gas chromatography analysis Volatile oils were extracted from A. lancea according to Wang et al. (2015). One gram of dried plantlets were ground and extracted in 4 mL of cyclohexane for 10 h. After sonication and centrifugation, total volatile oils were dried over anhydrous sodium sulfate and filtered through 0.22-mm sterile filters before gas chromatography (GC) analysis. GC analysis used an Agilent 7890A GC equipped with a fame ionization detector (Agilent Technologies, Santa Clara, CA, USA) as previously described (Wang et al., 2015). An Agilent DB-1HT capillary chromatographic column (30 m, 0.32-mm inside diameter, 0.1-mm film) was used with the following temperature program: initial temperature of 100 C for 4 min, increased to 140 C at 10 C min1 for 10 min, increased to 220 C at 10 C min1 for 10 min, and increased to 260 C at 10 C min1 for 2 min. The injector and detector temperatures were 240 C and 350 C, respectively. High-purity nitrogen was used as the carrier gas with a flow rate of 0.8 ml min1. The injection volume was 1 ml, and the spilt ratio was 5:1. Qualitative analyses of hinesol, b-eudesmol, atractylone, and atractylodin were performed according to retention times of authentic standards (Ren and Dai, 2012). Quantitative analyses were determined in comparison to standard curves that were constructed according to concentrations and peak areas of the standards in the gas chromatograms. 2.7. Plant defense response analysis Impacts of P. fluorescens ALEB7B and its volatiles on defense responses in A. lancea plantlets were indicated by changes of defense-related enzyme activities (Wang et al., 2013). For each assay, the leaf samples were ground in liquid nitrogen and homogenized in corresponding buffers. After centrifugation at 14,000 g and 4 C for 10 min, the supernatants were set as crude enzyme solutions. Superoxide dismutase and catalase activities were measured using the superoxide dismutase and catalase assay kits, respectively (Nanjing Jiancheng Bio-engineering Institute, China) (Wang et al., 2013). Polyphenol oxidase activity was measured according to Kumar et al. (2008) and phenylalanine ammonia lyase activity was measured according to Zhang et al. (2009a).
2.8. Bacterial volatile collection and identification The volatiles released by P. fluorescens ALEB7B were collected zquez-Becerra et al. (2011). 200 ml and identified according to Vela of bacterial suspension was inoculated on 2 ml of MS rooting agar in a sealed headspace bottle and cultured in the growth chamber for 8 days, because most plant defense-related enzyme activities increased by bacterial volatiles peaked at this time point. The bacterial volatiles were collected using a solid-phase microextraction fiber (65 mm polydimethylsiloxane/divinylbenzene, Supelco, Bellefonte, PA, USA) by exposing the fiber to the headspace of bacterial culture at 30 C for 30 min. Then the fiber was thermally desorbed in the injector of an Agilent 6890 series GC connected to a 5975 insert mass selective detector (scanned range m/z: 50e500) fitted up with a DB-5ms capillary chromatographic column (60 m, 0.25-mm inside diameter, 0. 25-mm film) for 2 min. The temperature program was set as follows: initial temperature of 40 C for 5 min, and increased to 300 C at 10 C min1. The injector temperature was 280 C. High-purity helium was used as the carrier gas with a flow rate of 1 ml min1. The splitless injection was used and the purge time was 0.6 min. Because no volatiles were detected from non-inoculated MS rooting agar, the electron impact mass spectral data (70 eV) of each peak in the total ion chromatorgraphy of volatiles released by P. fluorescens ALEB7B was obtained and compared in the National Institute of Standards and Technology (NIST) database to identify the corresponding compound. To detect whether endophytic bacterial volatiles existing in the A. lancea e P. fluorescens symbiont, volatiles released by tissue pieces of A. lancea plantlets infected by P. fluorescens ALEB7B were detected as described by Dandurishvili et al. (2011). The profile of volatiles released by tissue pieces of infected plantlets was compared with the profile of standard substance to confirm whether endophytic bacterial volatiles were released in planta. The profile of volatiles released by tissue pieces of non-infected plantlets was detected as the control. And the profile of volatiles released by tissue pieces of plantlets inoculated with Escherichia coli was detected to confirm that the bacterial volatiles detected in tissue pieces of plantlets infected by P. fluorescens ALEB7B were not produced by plants themselves because of microbe-induced defense responses. 2.9. Statistical analysis All experiments were performed in triplicate with three biological replicates in each repeat. As similar results were shown in all repeats, only one typical example is shown for each experiment. The means and standard deviations (SD) were calculated using SPSS Statistics 17.0 software (SPSS Inc., Chicago, USA), and the final experimental data is represented as the mean ± SD. When an analysis only consisted of a control and an experimental group, an independent t-test was performed using SPSS Statistics 17.0 software, and when three or more groups are compared, a one-way analysis of variance (ANOVA) was performed followed by Tukey's multiple-comparison test (P < 0.05). 3. Results 3.1. Colonization of P. fluorescens ALEB7B inside A. lancea Bacterial cell culture and qPCR were conducted to monitor the colonization of P. fluorescens ALEB7B inside A. lancea 30 days after inoculation. The number of P. fluorescens ALEB7B inside A. lancea was 10616.7 ± 2092.2 CFU g1, FW (Fig. S1A). The concentration of P. fluorescens ALEB7B in planta was represented as the number of gyrB gene copies per nanogram of total DNA extracted from
J.-Y. Zhou et al. / Plant Physiology and Biochemistry 101 (2016) 132e140
A. lancea inoculated with endophytic bacterium, and it was 61.0 ± 10.1 copies ng1 total DNA (Fig. S1B). These results showed that the bacterial amount maintained at a high level in planta 30 days after inoculation, indicating that P. fluorescens ALEB7B established a stable symbiotic relationship with A. lancea. 3.2. Volatiles released by P. fluorescens ALEB7B promoting growth and volatile oil accumulation in A. lancea Volatiles released by P. fluorescens ALEB7B significantly promoted the plant growth, as the dry weight of volatile-exposed plantlets (0.23 ± 0.02 g) was 1.8-fold higher than the control (0.13 ± 0.01 g) (Fig. S2A). However, the infection of P. fluorescens ALEB7B had no effect on the plant growth, as the dry weight of bacterium-infected plantlets was 0.13 ± 0.01 g. The volatile oil contents in A. lancea plantlets infected by P. fluorescens ALEB7B and exposed to bacterial volatiles were 1.9-fold and 1.8-fold higher than the control, respectively (Fig. S2B). The leaf net photosynthetic rate of bacterium-infected plantlet (3.8 ± 0.1 mmol m2 s1) was 1.6-fold higher than the control (2.4 ± 0.4 mmol m2 s1) (Fig. S2C), but the leaf net photosynthetic rate of volatile-exposed plantlets (3.0 ± 0.4 mmol m2 s1) was just slightly higher. Therefore, the plant growth and volatile oil accumulation promoted by volatiles released by P. fluorescens ALEB7B did not depend on the photosynthate accumulations. The photosynthate accumulations increased by the infection of P. fluorescens ALEB7B might be preferentially used by A. lancea to synthesize the volatile oils rather than increase the biomass. 3.3. Weaker and later defense responses induced by bacterial volatiles than bacterial infection Impacts of P. fluorescens ALEB7B and its volatiles on defense responses in A. lancea plantlets were indicated by activity changes of defense-related enzymes, including superoxide dismutase, catalase, phenylalanine ammonia lyase, and polyphenol oxidase. Superoxide dismutase activity in bacterium-infected and volatile-exposed plantlets both peaked 2 days after treatments, but that in bacterium-infected plantlets was 1.5-fold higher than that in volatile-exposed plantlets (Fig. 2A). Then superoxide dismutase activity in plantlets of both treatments decreased quickly. Catalase activity in bacterium-infected plantlets quickly increased after 2 days and remained at a high level during the whole experimental period (approximately 1.3-fold higher than the control) (Fig. 2B). And catalase activity in volatile-exposed plantlets peaked after 8 days (1.2-fold higher than the control) and then decreased quickly. Phenylalanine ammonia lyase activity in bacterium-infected plantlets peaked after 4 days (1.3-fold higher than the control) and then decreased to the control level after 12 days (Fig. 2C). And phenylalanine ammonia lyase activity in volatile-exposed plantlets peaked after 8 days (2.5-fold higher than the control) and then decreased quickly. Polyphenol oxidase activity in bacteriuminfected plantlets peaked after 2 days (approximately 2.0-fold higher than the control) and then decreased to the control level after 12 days (Fig. 2D). And polyphenol oxidase activity in volatileexposed plantlets peaked after 8 days (1.4-fold higher than the control) and then decreased to the control level after 12 days. It was obvious that most defense-related enzyme activities increased by volatiles released by P. fluorescens ALEB7B were much lower and later than those increased by the bacterial infection. 3.4. Identification of volatiles released by P. fluorescens ALEB7B Gas chromatography-mass spectrometer (GC-MS) analysis showed that there were 11 main substances in volatiles released by
135
P. fluorescens ALEB7B grown on MS rooting agar, while there were no volatiles released by non-inoculated MS rooting agar (Fig. 3A). Eight volatiles were identified, including ammonia, formamide, N,N-dimethyl-formamide, benzaldehyde, propanamide, 1,2,3trimethyl-cyclohexane, acetic acid, 3-(6,6-dimethyl-2methylenecyclohex-3-enylidene)-1-methylbutyl ester, and 3,4dimethyl-2(1H)-quinolinone (Table 1). Formamide (Fig. 3B), N,Ndimethyl-formamide (Fig. 3C), and benzaldehyde (Fig. 3D) are main volatile substances (6.1%, 10.8%, and 25.3% of the total area of all peaks formed by volatiles released by Ps. fluorescens ALEB7B, respectively). 3.5. Nitrogenous volatiles released by P. fluorescens ALEB7B promoting plant growth and benzaldehyde promoting volatile oil accumulation in A. lancea Because formamide, N,N-dimethyl-formamide, and benzaldehyde were the main volatiles released by P. fluorescens ALEB7B and have stronger volatility, impacts of these three volatiles at same concentrations detected in the non-contact co-culture system on the growth and volatile oil accumulation in A. lancea were detected. Both formamide and N,N-dimethyl-formamide significantly increased the plant dry weight (1.4-fold and 1.3-fold higher than the control, respectively), but benzaldehyde had no effect on the plant growth (Fig. 4A). Conversely, benzaldehyde significantly increased the volatile oil accumulation in A. lancea, but formamide and N,N-dimethyl-formamide had no effects (Fig. 4B). However, all these three volatiles had no effects on the leaf net photosynthetic rate of A. lancea plantlets (Fig. 4C). These results indicated that nitrogenous volatiles might be responsible for the plant growth promotion induced by volatiles released by P. fluorescens ALEB7B, while benzaldehyde might be responsible for the volatile oil accumulation in A. lancea induced by bacterial volatiles. 3.6. Benzaldehyde inducing defense responses in A. lancea Superoxide dismutase activity in A. lancea plantlets peaked (1.8fold higher than the control) 2 days after the treatment of benzaldehyde and then decreased to the control level after 8 days (Fig. 5A). Catalase activity in A. lancea peaked after 2 days (1.1-fold higher than the control) and then decreased to the control level after 8 days (Fig. 5B). Phenylalanine ammonia lyase activity in A. lancea peaked after 2 days (1.6-fold higher than the control) and then decreased quickly (Fig. 5C). Polyphenol oxide activity in A. lancea peaked after 2 days (2.0-fold higher than the control) and then decreased gradually (Fig. 5D). However, both the treatments of formamide and N,N-dimethyl-formamide had no effects on defense-related enzyme activities in planta. Therefore, benzaldehyde might promote the volatile oil accumulation in A. lancea by activating plant defense responses. 3.7. Detection of bacterial volatiles in the A. lancea e P. fluorescens symbiont GC analysis of volatiles released by tissue pieces of A. lancea plantlets infected by P. fluorescens ALEB7B was conducted to confirm whether the endophytic bacterial volatiles could be detected in the A. lancea e P. fluorescens symbiont. Compared with the gas chromatogram of authentic standard (Fig. S3A), benzaldehyde was found being released by tissue pieces of infected A. lancea plantlets (Fig. S3B). Benzaldehyde could not be detected in the tissue pieces of control plantlets (Fig. S3C) or plantlets inoculated with E. coli (Fig. S3D), indicating that the benzaldehyde detected in A. lancea plantlets infected by P. fluorescens ALEB7B was not produced by plantlets themselves because of microbe-induced defense
136
J.-Y. Zhou et al. / Plant Physiology and Biochemistry 101 (2016) 132e140
Fig. 2. Activities of superoxide dismutase (A), catalase (B), phenylalanine ammonia lyase (C), and polyphenol oxidase (D) in A. lancea plantlets infected by P. fluorescens ALEB7B (Bacterium) and exposed to bacterial volatiles (Volatiles). Plantlets treated with sterile double-distilled water were set as control (Control). Results are means of three biological replicates. Error bars indicate standard deviations. Different lowercase letters indicate significant differences at P < 0.05.
Fig. 3. The total ion chromatorgraphy of volatiles released by P. fluorescens ALEB7B grown on MS rooting agar (Pseudomonas fluorescens ALEB7B) and non-inoculated MS rooting agar (Control) (A) and mass spectrograms of formamide and substance 3 (B), N,N-dimethyl-formamide and substance 4 (C), and benzaldehyde and substance 5 (D). Peaks 1e11 represent 11 volatiles released by P. fluorescens ALEB7B, corresponding to those listed in Table 1.
responses. Therefore, the endophytic bacterial volatiles might function in planta as well. However, no nitrogenous volatiles released by P. fluorescens ALEB7B were detected in volatiles released by tissue pieces of infected A. lancea plantlets. There might be two possible explanations. On the one hand, these nitrogenous substances or their precursors released by P. fluorescens ALEB7B
might be consumed by the host plant. On the other hand, P. fluorescens ALEB7B might not produce these nitrogenous substances when it lives inside plant tissues.
J.-Y. Zhou et al. / Plant Physiology and Biochemistry 101 (2016) 132e140
137
Table 1 Volatiles released by P. fluorescens ALEB7B grown on MS rooting agar. Peak order
Retention time (min)
Chemical name
Molecular formula
Molecular weight
Chemical structural formula
1 2
9.412 10.378
Unidentified Ammonia
Unknown NH3
Unknown 17.03
Unknown
3
10.958
Formamide
CH3NO
45.04
6.1
4
11.481
N,N-dimethyl-Formamide
C3H7NO
73.05
10.8
5
12.734
Benzaldehyde
C7H6O
106.04
25.3
6
13.146
Propanamide
C3H7NO
73.05
12.5
7
13.583
1,2,3-trimethyl-Cyclohexane
C9H18
126.14
3.1
8 9 10
14.946 15.131 16.019
Unidentified Unidentified Acetic acid, 3-(6,6-dimethyl-2-methylenecyclohex-3-enylidene)-1methylbutyl ester
Unknown Unknown C16H24O2
Unknown Unknown 248.18
11
16.816
3,4-dimethyl-2(1H)-Quinolinone
C10H12O4
196.07
Unknown Unknown
Relative content (%) 7.8 6.2
4.9 14.6 3.5
5.1
Fig. 4. The dry weight (A), volatile oil content (B), and leaf net photosynthetic rate (C) of A. lancea plantlets exposed to formamide, N,N-dimethyl-formamide, and benzaldehyde, respectively. Plantlets exposed to sterile double-distilled water were set as control. Results are means of three biological replicates. Error bars indicate standard deviations. Different lowercase letters indicate significant differences at P < 0.05.
4. Discussion By establishing a non-contact co-culture system of plant and endophytic bacterium (Fig. 1), we have shown that volatiles released by the endophytic bacterium P. fluorescens ALEB7B promoted the growth (Fig. S2A) and volatile oil accumulation (Fig. S2B) in non-infected A. lancea plantlets. The promotions induced by endophytic bacterial volatiles are more efficient than the promotions of other reported endophytes (Zhang et al., 2009a; Ren and Dai, 2012; Wang et al., 2015). The volatiles released by P. fluorescens ALEB7B reached a high concentration around A. lancea (Fig. 3). Because P. fluorescens is a type of common rhizospheric bacterium (Algar et al., 2014; Bonilla et al., 2014), P. fluorescens ALEB7B may
exist in the rhizosphere of A. lancea and have a beneficial impact on non-infected plants by releasing volatiles, as the endophytic bacterium cannot efficiently infect all plants in practice. The phenomenon that an endophytic bacterium promotes plant growth and secondary metabolite accumulation by releasing volatiles not only broadens the known activities of endophytic bacterium in the phytosphere (Yang et al., 2013), but also provides a theoretical basis for the application of P. fluorescens ALEB7B in the cultivation of A. lancea. Although the leaf net photosynthetic rate of A. lancea plantlets was significantly enhanced by bacterial infection (Fig. S2C), there was no corresponding change in plant biomass (Fig. S2A). Plants need more photosynthates after perceiving stress and the accumulated photosynthates are redistributed to plant
138
J.-Y. Zhou et al. / Plant Physiology and Biochemistry 101 (2016) 132e140
Fig. 5. Activities of superoxide dismutase (A), catalase (B), phenylalanine ammonia lyase (C), and polyphenol oxidase (D) in A. lancea plantlets exposed to formamide, N,N-dimethylformamide, and benzaldehyde, respectively. Plantlets exposed to sterile double-distilled water were set as control. Results are means of three biological replicates. Error bars indicate standard deviations. Different lowercase letters indicate significant differences at P < 0.05.
defenses (Vatsa-Portugal et al., 2015). Therefore, the photosynthate accumulation induced by infection with P. fluorescens ALEB7B is preferentially used by A. lancea to synthesize volatile oils that have antimicrobial effects (Fig. S2B) (Wang et al., 2009). This is in accordance with the significantly faster and stronger defense responses that were induced by endophytic bacterial infection compared with bacterial volatiles (Fig. 2). The volatiles released by P. fluorescens ALEB7B grown on the MS agar were collected using HS-SPME and were identified using GCeMS. These volatiles mainly included ammonia, benzaldehyde, formamide, N,N-dimethyl-formamide, and propanamide (Fig. 3 and Table 1). Apart from ammonia and benzaldehyde, this is the first time that the other volatiles have been reported as being produced by bacteria (Kai et al., 2009; Lemfack et al., 2014; Schulz and Dickschat, 2007; Stotzky and Schenck, 1976). Moreover, this study firstly discovers that a bacterium (P. fluorescens ALEB7B) can release various kinds of nitrogenous volatiles, although ammonia or N,N-dimethyl-hexadecanamine released by bacteria has been reported before (Bernier et al., 2011; Nijland and Burgess, 2010; zquez-Becerra et al., 2011). Bernier et al. (2011) have reported Vela that Pseudomonas aeruginosa produces ammonia via L-aspartate catabolism. Simmonds and Robinson (1998) have discovered that Pseudomonas putida 12633 synthesizes benzaldehyde via the mandelate pathway using benzoyl formate as the substrate. The synthetic precursors and pathways of other volatiles in P. fluorescens ALEB7B are not yet clear and require further studies. It is noteworthy that the profile of volatiles released by P. fluorescens ALEB7B grown on MS agar is different from the volatile profile seen when P. fluorescens ALEB7B is grown on the LB agar (Zhou et al., 2014), indicating that bacterial volatile production
is strongly dependent on environmental conditions (Blom et al., 2011). Therefore, P. fluorescens ALEB7B may not release some plant growth-promoting volatiles when it lives inside plant tissues, which may be another explanation to the phenomenon that the infection of P. fluorescens ALEB7B has little effect on the plant biomass. Furthermore, some bacteria can also release volatiles, which have growth-inhibiting effects on plants (Kai et al., 2016). For example, volatiles released by Stenotrophomonas, Serratia, and Bacillus species inhibit the growth of Arabidopsis thaliana (Vespermann et al., 2007). Kai et al. (2010) further confirm that dimethyl disulfide, ammonia, and 2-phenylethanol released by Serratia odorifera 4Rx13 additively inhibit the growth of A. thaliana. Therefore, P. fluorescens ALEB7B may release some volatiles which have negative effects on plant growth and counteract the effects of plant growth-promoting volatiles when it lives inside plant tissues. P. fluorescens ALEB7B can release various kinds of nitrogenous volatiles (Fig. 3 and Table 1). Formamide and N,N-dimethylformamide have been shown to significantly increase A. lancea biomass (Fig. 4A). As the volatiles released by P. fluorescens ALEB7B have little effect on the leaf net photosynthetic rate of A. lancea (Fig. S2C), we propose that the endophytic bacterial nitrogenous volatiles promote plant growth via three mechanisms. Firstly, nitrogenous volatiles released by P. fluorescens ALEB7B may play roles as plant growth regulators, having similar functions as polyamines. Similarly, the N,N-dimethyl-hexadecanamine released by Arthrobacter agilis UMCV2 significantly promote the growth of zquez-Becerra et al., 2011). Secondly, the Medicago sativa (Vela endophytic bacterial nitrogenous volatiles provide an abundant source of nitrogen nutrition for the host plant. The endophytic bacterial nitrogenous volatiles cannot be detected in the A. lancea e
J.-Y. Zhou et al. / Plant Physiology and Biochemistry 101 (2016) 132e140
P. fluorescens symbiont, indicating these nitrogenous volatiles or their precursors may be consumed by the host plant, leading to their concentrations below the limit of detection. Similarly, dimethyl disulfide released by the rhizospheric bacterium Bacillus sp. B55 provides sulfur nutrition for Nicotiana attenuata and promotes the plant growth (Meldau et al., 2013). Finally, some bacterial volatiles, such as ammonia, can increase the dissolution of nutrients and promote plant growth by changing the acidity of the medium (Nijland and Burgess, 2010; Zhang et al., 2009b). However, we have not detected whether the CO2 can be released by P. fluorescens ALEB7B using special collection and detection technologies in this study. The bacterial metabolism definitely releases abundant CO2, which has plant growth-promoting ability (Kai and Piechulla, 2009). Therefore, we speculate that CO2 may contribute to the increased plant biomass induced by the volatiles released by P. fluorescens ALEB7B. Volatiles play essential roles in communications among different organisms and have extensive ecological significances (Tumlinson, 2014). Volatiles released by plants under herbivore attack can activate defense responses in non-attacked neighbors (Baldwin et al., 2006). In this study, we firstly demonstrate that volatiles released by plants infected by endophytic bacterium can activate defense responses in non-infected plant. A higher concentration of benzaldehyde was detected in the A. lancea e P. fluorescens symbiont (Fig. S3). Meanwhile benzaldehyde can induce defense responses in non-infected plants (Fig. 5) and also promote volatile oil accumulation (Fig. 4B). These results indicate that the impact of endophytes on host plants are not limited to commonly known physical contact and the ecological functions of endophytes in the phytosphere are much more extensive than previously known. In summary, this study reports that the endophytic bacterium P. fluorescens ALEB7B can promote A. lancea growth by releasing nitrogenous volatiles. This endophytic bacterium can also induce defense responses and promote volatile oil accumulation in A. lancea by releasing benzaldehyde. This study extends the ecological significance of endophytes in the phytosphere and deepens the current understanding of interactions between plants and endophytes, which are no longer limited to physical contact between plants and endophytes. Contribution Jia-Yu Zhou and Chuan-Chao Dai conceived and designed the experiments. Jia-Yu Zhou conducted the experiments, analyzed the data, and wrote the manuscript. Xia Li and Chuan-Chao Dai supervised the research and edited the paper. Jiao-Yan Zheng contributed research facilities, reagents, and materials. All authors read and approved the final manuscript. Acknowledgments This work is financially supported by National Natural Science Foundation of China (grant number 31070443), a project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions, Promoting Project for Industrialization of Jiangsu Higher Education Institutions (grant number JHB2012-16), Integration of Production and Research Projects of Nanjing Science and Technology Commission (grant number 201306019), and Graduate Education Innovation Project of Jiangsu Province (KYLX15_0734). Appendix A. Supplementary data Supplementary data related to this article can be found at http://
139
dx.doi.org/10.1016/j.plaphy.2016.01.026. References ~ ero, F.J., Garcia-Villaraco, A., García-Seco, D., Lucas, J.A., Algar, E., Gutierrez-Man Ramos-Solano, B., 2014. The role of isoflavone metabolism in plant protection depends on the rhizobacterial MAMP that triggers systemic resistance against Xanthomonas axonopodis pv. glycines in Glycine max (L.) Merr. cv. Osumi. Plant Physiol. Biochem. 82, 9e16. http://dx.doi.org/10.1016/j.plaphy.2014.05.001. Baldwin, I.T., Halitschke, R., Paschold, A., Von Dahl, C.C., Preston, C.A., 2006. Volatile signaling in plant-plant interactions: “talking trees” in the genomics era. Science 311, 812e815. http://dx.doi.org/10.1126/science.1118446. , P.W., 2009. Soil bacteria elevate essential oil Banchio, E., Xie, X., Zhang, H., Pare accumulation and emissions in sweet basil. J. Agr. Food Chem. 57, 653e657. http://dx.doi.org/10.1021/jf8020305. toffe , S., Delepierre, M., Ghigo, J.-M., 2011. Biogenic ammonia modBernier, S.P., Le ifies antibiotic resistance at a distance in physically separated bacteria. Mol. Microbiol. 81, 705e716. http://dx.doi.org/10.1111/j.1365-2958.2011.07724.x. Blom, D., Fabbri, C., Connor, E.C., Schiestl, F.P., Klauser, D.R., Boller, T., Eberl, L., Weisskopf, L., 2011. Production of plant growth modulating volatiles is widespread among rhizosphere bacteria and strongly depends on culture conditions. Environ. Microbiol. 13, 3047e3058. http://dx.doi.org/10.1111/j.14622920.2011.02582.x. ~ oz Ledesmac, F.J., Ramos Solano, B., Bonilla, A., Sarriaa, A.L.F., Algar, E., Mun ~ ero, F.J., 2014. Microbe associated molecular Fernandes, J.B., Gutierrez Man patterns from rhizosphere bacteria trigger germination and Papaver somniferum metabolism under greenhouse conditions. Plant Physiol. Biochem. 74, 133e140. http://dx.doi.org/10.1016/j.plaphy.2013.11.012. Dandurishvili, N., Toklikishvili, N., Ovadis, M., Eliashvili, P., Giorgobiani, N., Keshelava, R., Tediashvili, M., Vainstein, A., Khmel, I., Szegedi, E., Chernin, L., 2011. Broad-range antagonistic rhizobacteria Pseudomonas fluorescens and Serratia plymuthica suppress Agrobacterium crown gall tumours on tomato plants. J. Appl. Microbiol. 110, 341e352. http://dx.doi.org/10.1111/j.13652672.2010.04891.x. Kai, M., Crespo, E., Cristescu, S.M., Harren, F.J.M., Francke, W., Piechulla, B., 2010. Serratia odorifera: analysis of volatile emission and biological impact of volatil compounds on Arabidopsis thaliana. Appl. Microbiol. Biotechnol. 88, 965e976. http://dx.doi.org/10.1007/s00253-010-2810-1. Kai, M., Haustein, M., Molina, F., Petri, A., Scholz, B., Piechulla, B., 2009. Bacterial volatiles and their action potential. Appl. Microbiol. Biotechnol. 81, 1001e1012. http://dx.doi.org/10.1007/s00253-008-1760-3. Kai, M., Piechulla, B., 2009. Plant growth promotion due to rhizobacterial volatiles e an effect of CO2? FEBS Lett. 583, 3473e3477. http://dx.doi.org/10.1016/ j.febslet.2009.09.053. Kai, M., Effmert, U., Piechulla, B., 2016. Bacterial-plant-interactions: approaches to unravel the biological function of bacterial volatiles in the rhizosphere. Front. Microbiol. http://dx.doi.org/10.3389/fmicb.2016.00108. Kumar, V., Mohan, T., Murugan, K., 2008. Purification and kinetic characterization of polyphenol oxidase from Barbados cherry (Malpighia glabra L.). Food Chem. 110, 328e333. http://dx.doi.org/10.1016/j.foodchem.2008.02.006. Lemfack, M.C., Nickel, J., Dunkel, M., Preissner, R., Piechulla, B., 2014. mVOC: a database of microbial volatiles. Nucleic Acids Res. 42, D744eD748. http:// dx.doi.org/10.1093/nar/gkt1250. Li, X., Wang, C., 2013. Physiological and metabolic enzymes activity changes in transgenic rice plants with increased phosphoenolpyruvate carboxylase activity during the flowering stage. Acta Physiol. Plant. 35, 1503e1512. http://dx.doi.org/ 10.1007/s11738-012-1191-8. Meldau, D.G., Meldau, S., Hoang, L.H., Underberg, S., Wünsche, H., Baldwin, l.T., 2013. Dimethyl disulfide produced by the naturally associated bacterium Bacillus sp B55 promotes Nicotiana attenuata growth by enhancing sulfur nutrition. Plant Cell 25, 2731e2747. www.plantcell.org/cgi/doi/10.1105/tpc.113. 114744. Nijland, R., Burgess, J.G., 2010. Bacterial olfaction. Biotechnol. J. 5, 974e977. http:// dx.doi.org/10.1002/biot.201000174. Ouyang, Z., Zhang, L., Zhao, M., Wang, P., Wei, Y., Fang, J., 2012. Identification and quantification of sesquiterpenes and polyacetylenes in Atractylodes lancea from various geographical origins using GC-MS analysis. Rev. Bras. Farmacogn. 22, 957e963. http://dx.doi.org/10.1590/S0102-695X2012005000051. Ren, C.G., Dai, C.C., 2012. Jasmonic acid is involved in the signaling pathway for fungal endophyte-induced volatile oil accumulation of Atractylodes lancea plantlets. BMC Plant Biol. 12, 128. http://dx.doi.org/10.1186/1471-2229-12-128. , P.W., Kloepper, J.W., Ryu, C.M., Farag, M.A., Hu, C.H., Reddy, M.S., Wei, H.X., Pare 2003. Bacterial volatiles promote growth in Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 100, 4927e4932. http://dx.doi.org/10.1073/pnas.0730845100. Santoro, M.V., Zygadlo, J., Giordano, W., Banchio, E., 2011. Volatile organic compounds from rhizobacteria increase biosynthesis of essential oils and growth parameters in peppermint (Mentha piperita). Plant Physiol. Biochem. 49, 1177e1182. http://dx.doi.org/10.1016/j.plaphy.2011.07.016. Simmonds, J., Robinson, G.K., 1998. Formation of benzaldehyde by Pseudomonas putida ATCC 12633. Appl. Microbiol. Biotech. 50, 353e358. http://dx.doi.org/ 10.1007/s002530051303. Schulz, S., Dickschat, J.S., 2007. Bacterial volatiles: the smell of small organisms. Nat. Prod. Rep. 24, 814e842. http://dx.doi.org/10.1039/B507392H. Stotzky, G., Schenck, S., 1976. Volatile organic compounds and microorganisms. Crit.
140
J.-Y. Zhou et al. / Plant Physiology and Biochemistry 101 (2016) 132e140
Rev. Microbiol. 4, 333e382. http://dx.doi.org/10.3109/10408417609102303. Tumlinson, J.H., 2014. The importance of volatile organic compounds in ecosystem functioning. J. Chem. Ecol. 40, 212e213. http://dx.doi.org/10.1007/s10886-0140399-z. ment, C., Barka, E.A., VaillantVatsa-Portugal, P., Walker, A., Jacquens, L., Cle Gaveau, N., 2015. Inflorescences vs leaves: a distinct modulation of carbon metabolism process during Botrytis infection. Physiol. Plant. 154, 162e177. http://dx.doi.org/10.1111/ppl.12287. pez-Bucio, J., AltamiranoVel azquez-Becerra, C., Macías-Rodríguez, L.I., Lo ndez, J., Flores-Cortez, I., Valencia-Cantero, E., 2011. A volatile organic Herna compound analysis from Arthrobacter agilis identifies dimethylhexadecylamine, an amino-containing lipid modulating bacterial growth and Medicago sativa morphogenesis in vitro. Plant Soil 339, 329e340. http://dx.doi.org/10.1007/ s11104-010-0583-z. Vespermann, A., Kai, M., Piechulla, B., 2007. Rhizobacterial volatiles affect the growth of fungi and Arabidopsis thaliana. Appl. Environ. Microb. 73, 5639e5641. http://dx.doi.org/10.1128/AEM.01078-07. Wang, H.X., Liu, C.M., Liu, Q., Gao, K., 2008. Three types of sesquiterpenes from rhizomes of Atractylodes lancea. Phytochemistry 69, 2088e2094. http:// dx.doi.org/10.1016/j.phytochem.2008.04.008. Wang, X.M., Yang, B., Ren, C.G., Wang, H.W., Wang, J.Y., Dai, C.C., 2015. Involvement of abscisic acid and salicylic acid in signal cascade regulating bacterial endophyte-induced volatile oil biosynthesis in plantlets of Atractylodes lancea. Physiol. Plant. 153, 30e42. http://dx.doi.org/10.1111/ppl.12236. Wang, X.M., Yang, B., Wang, H.W., Yang, T., Ren, C.G., Zheng, H.L., Dai, C.C., 2013. Consequences of antagonistic interactions between endophytic fungus and bacterium on plant growth and defense responses in Atractylodes lancea. J. Basic Microb. 55, 659e670. http://dx.doi.org/10.1002/jobm.201300601. Wang, Y., Dai, C.C., Cao, J.L., Xu, D.S., 2012. Comparison of the effects of fungal endophyte Gilmaniella sp. and its elicitor on Atractylodes lancea plantlets. World J. Microb. Biotech. 28, 575e584. http://dx.doi.org/10.1007/s11274-011-0850-z. Wang, Y., Dai, C.C., Chen, Y., 2009. Antimicrobial activity of volatile oil from Atractylodes lancea against three species of endophytic fungi and seven species of
exogenous fungi. Chin. J. Appl. Ecol. 20, 2778e2784, 1001-9332 (2009) 11-277807. in Chinese. Wang, Y., Dai, C.C., Zhao, Y.W., Peng, Y., 2011. Fungal endophyte-induced volatile oil accumulation in Atractylodes lancea plantlets is mediated by nitric oxide, salicylic acid and hydrogen peroxide. Process Biochem. 46, 730e735. http:// dx.doi.org/10.1016/j.procbio.2010.11.020. Yang, T., Chen, Y., Wang, X.X., Dai, C.C., 2013. Plant symbionts: keys to the phytosphere. Symbiosis 59, 1e14. http://dx.doi.org/10.1007/s13199-012-0190-2. Yang, T., Ma, S., Dai, C.C., 2015. Drought degree constrains the beneficial effects of a fungal endophyte on Atractylodes lancea. J. Appl. Microbiol. 117, 1435e1449. http://dx.doi.org/10.1111/jam.12615. Yuan, Y., Liu, Y.J., Huang, L.Q., Cui, G.H., Fu, G.F., 2009. Soil acidity elevates some phytohormone and b-eudesmol contents in roots of Atractylodes lancea. Russ. J. Plant Physlþ 56, 133e137. http://dx.doi.org/10.1134/S1021443709010191. Zhang, B., Dai, C.C., Fang, F., Chen, J.X., 2009a. Effects of three species endophytic fungi on Atractylodes lancea growth and its essential oil composition. Chin. J. Ecol. 28, 704e709. http://dx.doi.org/10.13292/j.1000-4890.2009.0117 (in Chinese). Zhang, H., Sun, Y., Xie, X., Kim, M.S., Dowd, S.E., W, P.P., 2009b. A soil bacterium regulates plants acquisition of iron via deficiency-inducible mechanisms. Plant J. 58, 568e577. http://dx.doi.org/10.1111/j.1365-313X.2009.03803.x. Zhou, J.Y., Jia, Y., Wang, H.W., Dai, C.C., 2013. Diversity and plant growth-promoting potential of culturable endophytic bacteria isolated from the leaves of Atractylodes lancea. Acta Ecol. Sin. 33, 1106e1117. DOI: 10. 5846/stxb201208031103. (in Chinese). Zhou, J.Y., Zhao, X.Y., Dai, C.C., 2014. Antagonistic mechanisms of endophytic Pseudomonas fluorescens against Athelia rolfsii. J. Appl. Microbiol. 117, 1144e1158. http://dx.doi.org/10.1111/jam.12586. Zhou, J.Y., Yuan, J., Li, X., Ning, Y.F., Dai, C.C., 2016. Endophytic bacterium-triggered reactive oxygen species directly increase oxygenous sesquiterpenoid content and diversity in Atractylodes lancea. Appl. Environ. Microb. http://dx.doi.org/ 10.1128/AEM.03434-15.
Contents lists available at ScienceDirect
Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy
Research article
Volatiles released by endophytic Pseudomonas fluorescens promoting the growth and volatile oil accumulation in Atractylodes lancea Jia-Yu Zhou a, Xia Li b, Jiao-Yan Zheng a, Chuan-Chao Dai a, * a Jiangsu Key Laboratory for Microbes and Functional Genomics, Jiangsu Engineering and Technology Research Center for Industrialization of Microbial Resources, College of Life Sciences, Nanjing Normal University, Nanjing, Jiangsu Province, 210023, China b Jiangsu High Quality Rice Research and Development Center, Nanjing Branch of China National Center Rice Improvement, Institute of Food Crops, Jiangsu Academy of Agricultural Sciences, Nanjing, Jiangsu Province, 210014, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 24 November 2015 Received in revised form 29 January 2016 Accepted 31 January 2016 Available online 2 February 2016
Atractylodes lancea is a well-known, but endangered, Chinese medicinal plant whose volatile oils are its main active components. As the volatile oil content in cultivated A. lancea is much lower than that in the wild herb, the application of microbes or related elicitors to promote growth and volatile oil accumulation in the cultivated herb is an important area of research. This study demonstrates that the endophytic bacterium Pseudomonas fluorescens ALEB7B isolated from the geo-authentic A. lancea can release several nitrogenous volatiles, such as formamide and N,N-dimethyl-formamide, which significantly promote the growth of non-infected A. lancea. Moreover, the main bacterial volatile benzaldehyde significantly promotes volatile oil accumulation in non-infected A. lancea via activating plant defense responses. Notably, the bacterial nitrogenous volatiles cannot be detected in the A. lancea e Pseudomonas fluorescens symbiont while the benzaldehyde can be detected, indicating the nitrogenous volatiles or their precursors may have been consumed by the host plant. This study firstly demonstrates that the interaction between plant and endophytic bacterium is not limited to the commonly known physical contact, extending the ecological functions of endophyte in the phytosphere and deepening the understandings about the symbiotic interaction. © 2016 Elsevier Masson SAS. All rights reserved.
Keywords: Atractylodes lancea Bacterial volatiles Endophytic bacterium Non-contact co-culture Plant growth promotion Pseudomonas fluorescens Volatile oil accumulation
1. Introduction Atractylodes lancea is a traditional Chinese medicinal plant and is a main ingredient of many popular Chinese medicines, which are used to treat rheumatic diseases, digestive disorders, night blindness, and influenza (Wang et al., 2008). Volatile oils are the active components in A. lancea, and consist mainly of hinesol, b-eudesmol, atractylone, and atractylodin (Ren and Dai, 2012). The quality of A. lancea is closely linked to its producing area and A. lancea grown in the Maoshan area of the Jiangsu Province is the geo-authentic herb (Ouyang et al., 2012). In recent years, geo-authentic A. lancea has become endangered due to habitat destruction and over-
Abbreviation: ANOVA, a one-way analysis of variance; CFU, colony forming units; FW, fresh weight; GC, gas chromatography; GC-MS, gas chromatographymass spectrometer; LB, Luria-Bertani; MS, Murashige-Skoog; NAA, naphthaleneacetic acid; NIST, National Institute of Standards and Technology; SD, standard deviations. * Corresponding author. E-mail address: [email protected] (C.-C. Dai). http://dx.doi.org/10.1016/j.plaphy.2016.01.026 0981-9428/© 2016 Elsevier Masson SAS. All rights reserved.
exploitation (Yuan et al., 2009). Although cultivation can ensure the yield of medicinal materials, the volatile oil content in cultivated A. lancea is much lower than that in the wild herb. We have tried to promote growth and volatile oil accumulation in cultivated A. lancea by applying microbes or related elicitors (Wang et al., 2012). Our previous study demonstrates that the endophytic fungus Acremonium strictum AL16 can enhance the drought tolerance of A. lancea (Yang et al., 2015). The endophytic fungus Gilmaniella sp. AL12 and endophytic bacterium Acinetobacter sp. ALEB16 can promote volatile oil accumulation in A. lancea plantlets (Wang et al., 2011, 2015). However, the efficiencies of these endophytes in promoting volatile oil accumulation in A. lancea do not meet the requirements for cultivation. We have isolated endophytic bacteria from the geo-authentic A. lancea and screened out an endophytic bacterium Pseudomonas fluorescens ALEB7B, which has plant growth-promoting ability and can also promote the volatile oil accumulation more efficiently than other reported endophytes (Zhou et al., 2013). This endophytic bacterium can establish a stable symbiotic relationship with A. lancea and help the host plant to fight against Southern Blight (Zhou et al., 2014).
J.-Y. Zhou et al. / Plant Physiology and Biochemistry 101 (2016) 132e140
133
Previous studies demonstrate that proteins and polysaccharides secreted by P. fluorescens ALEB7B can promote volatile oil accumulation in A. lancea, but the bacterial proteins and polysaccharides are not as effective as endophytic bacterial infection (unpublished data). Therefore, we propose that there are other components of P. fluorescens ALEB7B that have beneficial effects on volatile oil accumulation apart from these bacterial extracellular macromolecules. Several studies have shown that volatiles released by rhizospheric bacteria can promote plant growth and secondary metabolite accumulation (Ryu et al., 2003; Banchio et al., 2009; Santoro et al., 2011). When grown on Luria-Bertani (LB) agar, P. fluorescens ALEB7B releases abundant volatiles (Zhou et al., 2014). Therefore, we propose that volatiles released by P. fluorescens ALEB7B can affect growth and volatile oil accumulation in A. lancea. As growth on LB agar, which is rich in nutrients, is different from the in planta environment, Murashige-Skoog (MS) agar is used in this study to culture the endophytic bacterium, in order to better mimic the growth conditions in planta (Blom et al., 2011). Volatiles released by P. fluorescens ALEB7B grown on MS agar were collected, identified, and tested for their impacts on A. lancea. This study provides a theoretical basis for the application of P. fluorescens ALEB7B in the cultivation of A. lancea and sheds further light on the symbiotic interaction between these two organisms.
In the treatment of endophytic bacterial inoculation (Bacterium), A. lancea aseptic tissue culture plantlets were sprayed with 200 mL of bacterial suspension, which flowed from the leaf surfaces to the roots. In the treatment of endophytic bacterial volatiles (Volatiles), a non-contact co-culture system was established (Fig. 1). 200 ml of bacterial suspension was cultured on 2 ml of MS rooting agar in a small Petri dish (Blom et al., 2011), which was placed beside A. lancea aseptic tissue culture plantlet. The plant tissue culture containers were sealed with parafilm. Other plantlets treated with 200 mL of sterile double-distilled water were set as control (Control). All treated and control plantlets were randomized in the growth chamber.
2. Methods
Inoculated with 200 mL of bacterial suspension and cultured for 30 days, the A. lancea aseptic tissue culture plantlets were sampled and surface sterilized (Zhou et al., 2013). The amount of P. fluorescens ALEB7B inside A. lancea was estimated using bacterial cell culture and quantitative PCR (qPCR) according to Zhou et al. (2016). The number of colony forming units (CFU) per gram of
2.1. A. lancea plantlets and growth conditions A. lancea aseptic tissue culture plantlets were established as previously described (Wang et al., 2012, 2015). Buds were collected from cultivated A. lancea and washed under running water, after which all procedures were conducted aseptically. Buds were surface sterilized by immersing in 75% (V/V) ethanol for 30 s, soaking in 1% (W/V) mercury chloride for 10 min, and thoroughly rinsing 5 times in sterile double-distilled water. Several buds were randomly selected, homogenized, and inoculated on potato dextrose agar to confirm the absence of endophytes (Zhou et al., 2014). Intact, surface sterilized buds were then transferred to 100 mL of MS agar supplemented with 0.3 mg L1 naphthaleneacetic acid (NAA) and 2.0 mg L1 6-benzyladenine in sealed 500-mL plant tissue culture containers. When enough buds had germinated, they were separated and transplanted into 100 mL of MS rooting agar supplemented with 0.1 mg L1 NAA in sealed 500-mL plant tissue culture containers to develop into plantlets. All aseptic tissue culture plantlets were kept in a growth chamber with a photoperiod of 12 h, a light density of 3400 lm m2, and a temperature cycle of 25/18 C day/night. Plantlets used in this study were 4 weeks old.
2.3. Chemicals and treatments Formamide, N,N-dimethyl-formamide, and benzaldehyde were purchased from SigmaeAldrich (St. Louis, MO) and sterilized by filtering through 0.22-mm sterile filters. The final concentrations of formamide, N,N-dimethyl-formamide, and benzaldehyde in the plant tissue culture containers were 0.006, 0.010, and 0.025 ml ml1 air, respectively, which accorded with their concentrations detected in the non-contact co-culture system. 2.4. Enumeration of P. fluorescens ALEB7B inside A. lancea
2.2. Endophytic bacterium and treatments P. fluorescens ALEB7B was isolated from the geo-authentic A. lancea grown in the Maoshan area of the Jiangsu Province (Zhou et al., 2013) and preserved at the China Center for Type Culture Collection (CCTCC AB 2013331). The molecular identification of P. fluorescens ALEB7B was confirmed and its colonization inside A. lancea was observed by scanning electron microscope in our previous study (Zhou et al., 2014). Moreover, the colonization of P. fluorescens ALEB7B inside A. lancea was further verified by the reisolation of this strain and the existence of a specific gene of P. fluorescens in planta (Zhou et al., 2016). Bacterium was grown in LB broth at 30 C with agitation (220 rpm) for 24 h and bacterial cells were collected and re-suspended in sterile double-distilled water, with the concentration adjusted to 106 cells mL1.
Fig. 1. The sketch (A) and picture (B) of non-contact co-culture system of A. lancea and P. fluorescens ALEB7B. 200 ml of bacterial suspension was cultured on 2 ml of MS rooting agar in a small Petri dish, which was placed beside A. lancea aseptic tissue culture plantlet. The plant tissue culture containers were sealed with parafilm. Other plantlets treated with 200 mL of sterile double-distilled water were set as control.
134
J.-Y. Zhou et al. / Plant Physiology and Biochemistry 101 (2016) 132e140
plant fresh weight (FW) was calculated as the number of P. fluorescens ALEB7B in planta. The 16S rRNA sequence of the reisolated strain had the highest similarity (100%) with the 16S rRNA sequence of the original strain (KF460526), confirming the reisolation of P. fluorescens ALEB7B from A. lancea. The number of gyrB gene copies per nanogram of total DNA extracted from A. lancea inoculated with P. fluorescens ALEB7B was calculated as the concentration of P. fluorescens ALEB7B in planta. Primers were gyrBqPCR-F (TTGGCGACAGCGAAACCACC) and gyrB-qPCR-R (GCCACCCTCGTACTTGAACAGC). 2.5. Plant growth and photosynthetic parameter measurements Harvested plantlets were dried at 36 C to constant weights and weighed (Wang et al., 2015). Net photosynthetic rate was monitored using a Li-Cor 6400 Portable Photosynthesis System (Lincoln, Nebraska, USA) according to Li and Wang (2013). Compressed air containing 350 mmol mol1 CO2 was used as a gas source, and the photosynthetic photon flux density was 200 mmol m2 s1. Measurements were conducted from 9:00 a.m. to 10:00 a.m.
2.6. Volatile oil extraction and gas chromatography analysis Volatile oils were extracted from A. lancea according to Wang et al. (2015). One gram of dried plantlets were ground and extracted in 4 mL of cyclohexane for 10 h. After sonication and centrifugation, total volatile oils were dried over anhydrous sodium sulfate and filtered through 0.22-mm sterile filters before gas chromatography (GC) analysis. GC analysis used an Agilent 7890A GC equipped with a fame ionization detector (Agilent Technologies, Santa Clara, CA, USA) as previously described (Wang et al., 2015). An Agilent DB-1HT capillary chromatographic column (30 m, 0.32-mm inside diameter, 0.1-mm film) was used with the following temperature program: initial temperature of 100 C for 4 min, increased to 140 C at 10 C min1 for 10 min, increased to 220 C at 10 C min1 for 10 min, and increased to 260 C at 10 C min1 for 2 min. The injector and detector temperatures were 240 C and 350 C, respectively. High-purity nitrogen was used as the carrier gas with a flow rate of 0.8 ml min1. The injection volume was 1 ml, and the spilt ratio was 5:1. Qualitative analyses of hinesol, b-eudesmol, atractylone, and atractylodin were performed according to retention times of authentic standards (Ren and Dai, 2012). Quantitative analyses were determined in comparison to standard curves that were constructed according to concentrations and peak areas of the standards in the gas chromatograms. 2.7. Plant defense response analysis Impacts of P. fluorescens ALEB7B and its volatiles on defense responses in A. lancea plantlets were indicated by changes of defense-related enzyme activities (Wang et al., 2013). For each assay, the leaf samples were ground in liquid nitrogen and homogenized in corresponding buffers. After centrifugation at 14,000 g and 4 C for 10 min, the supernatants were set as crude enzyme solutions. Superoxide dismutase and catalase activities were measured using the superoxide dismutase and catalase assay kits, respectively (Nanjing Jiancheng Bio-engineering Institute, China) (Wang et al., 2013). Polyphenol oxidase activity was measured according to Kumar et al. (2008) and phenylalanine ammonia lyase activity was measured according to Zhang et al. (2009a).
2.8. Bacterial volatile collection and identification The volatiles released by P. fluorescens ALEB7B were collected zquez-Becerra et al. (2011). 200 ml and identified according to Vela of bacterial suspension was inoculated on 2 ml of MS rooting agar in a sealed headspace bottle and cultured in the growth chamber for 8 days, because most plant defense-related enzyme activities increased by bacterial volatiles peaked at this time point. The bacterial volatiles were collected using a solid-phase microextraction fiber (65 mm polydimethylsiloxane/divinylbenzene, Supelco, Bellefonte, PA, USA) by exposing the fiber to the headspace of bacterial culture at 30 C for 30 min. Then the fiber was thermally desorbed in the injector of an Agilent 6890 series GC connected to a 5975 insert mass selective detector (scanned range m/z: 50e500) fitted up with a DB-5ms capillary chromatographic column (60 m, 0.25-mm inside diameter, 0. 25-mm film) for 2 min. The temperature program was set as follows: initial temperature of 40 C for 5 min, and increased to 300 C at 10 C min1. The injector temperature was 280 C. High-purity helium was used as the carrier gas with a flow rate of 1 ml min1. The splitless injection was used and the purge time was 0.6 min. Because no volatiles were detected from non-inoculated MS rooting agar, the electron impact mass spectral data (70 eV) of each peak in the total ion chromatorgraphy of volatiles released by P. fluorescens ALEB7B was obtained and compared in the National Institute of Standards and Technology (NIST) database to identify the corresponding compound. To detect whether endophytic bacterial volatiles existing in the A. lancea e P. fluorescens symbiont, volatiles released by tissue pieces of A. lancea plantlets infected by P. fluorescens ALEB7B were detected as described by Dandurishvili et al. (2011). The profile of volatiles released by tissue pieces of infected plantlets was compared with the profile of standard substance to confirm whether endophytic bacterial volatiles were released in planta. The profile of volatiles released by tissue pieces of non-infected plantlets was detected as the control. And the profile of volatiles released by tissue pieces of plantlets inoculated with Escherichia coli was detected to confirm that the bacterial volatiles detected in tissue pieces of plantlets infected by P. fluorescens ALEB7B were not produced by plants themselves because of microbe-induced defense responses. 2.9. Statistical analysis All experiments were performed in triplicate with three biological replicates in each repeat. As similar results were shown in all repeats, only one typical example is shown for each experiment. The means and standard deviations (SD) were calculated using SPSS Statistics 17.0 software (SPSS Inc., Chicago, USA), and the final experimental data is represented as the mean ± SD. When an analysis only consisted of a control and an experimental group, an independent t-test was performed using SPSS Statistics 17.0 software, and when three or more groups are compared, a one-way analysis of variance (ANOVA) was performed followed by Tukey's multiple-comparison test (P < 0.05). 3. Results 3.1. Colonization of P. fluorescens ALEB7B inside A. lancea Bacterial cell culture and qPCR were conducted to monitor the colonization of P. fluorescens ALEB7B inside A. lancea 30 days after inoculation. The number of P. fluorescens ALEB7B inside A. lancea was 10616.7 ± 2092.2 CFU g1, FW (Fig. S1A). The concentration of P. fluorescens ALEB7B in planta was represented as the number of gyrB gene copies per nanogram of total DNA extracted from
J.-Y. Zhou et al. / Plant Physiology and Biochemistry 101 (2016) 132e140
A. lancea inoculated with endophytic bacterium, and it was 61.0 ± 10.1 copies ng1 total DNA (Fig. S1B). These results showed that the bacterial amount maintained at a high level in planta 30 days after inoculation, indicating that P. fluorescens ALEB7B established a stable symbiotic relationship with A. lancea. 3.2. Volatiles released by P. fluorescens ALEB7B promoting growth and volatile oil accumulation in A. lancea Volatiles released by P. fluorescens ALEB7B significantly promoted the plant growth, as the dry weight of volatile-exposed plantlets (0.23 ± 0.02 g) was 1.8-fold higher than the control (0.13 ± 0.01 g) (Fig. S2A). However, the infection of P. fluorescens ALEB7B had no effect on the plant growth, as the dry weight of bacterium-infected plantlets was 0.13 ± 0.01 g. The volatile oil contents in A. lancea plantlets infected by P. fluorescens ALEB7B and exposed to bacterial volatiles were 1.9-fold and 1.8-fold higher than the control, respectively (Fig. S2B). The leaf net photosynthetic rate of bacterium-infected plantlet (3.8 ± 0.1 mmol m2 s1) was 1.6-fold higher than the control (2.4 ± 0.4 mmol m2 s1) (Fig. S2C), but the leaf net photosynthetic rate of volatile-exposed plantlets (3.0 ± 0.4 mmol m2 s1) was just slightly higher. Therefore, the plant growth and volatile oil accumulation promoted by volatiles released by P. fluorescens ALEB7B did not depend on the photosynthate accumulations. The photosynthate accumulations increased by the infection of P. fluorescens ALEB7B might be preferentially used by A. lancea to synthesize the volatile oils rather than increase the biomass. 3.3. Weaker and later defense responses induced by bacterial volatiles than bacterial infection Impacts of P. fluorescens ALEB7B and its volatiles on defense responses in A. lancea plantlets were indicated by activity changes of defense-related enzymes, including superoxide dismutase, catalase, phenylalanine ammonia lyase, and polyphenol oxidase. Superoxide dismutase activity in bacterium-infected and volatile-exposed plantlets both peaked 2 days after treatments, but that in bacterium-infected plantlets was 1.5-fold higher than that in volatile-exposed plantlets (Fig. 2A). Then superoxide dismutase activity in plantlets of both treatments decreased quickly. Catalase activity in bacterium-infected plantlets quickly increased after 2 days and remained at a high level during the whole experimental period (approximately 1.3-fold higher than the control) (Fig. 2B). And catalase activity in volatile-exposed plantlets peaked after 8 days (1.2-fold higher than the control) and then decreased quickly. Phenylalanine ammonia lyase activity in bacterium-infected plantlets peaked after 4 days (1.3-fold higher than the control) and then decreased to the control level after 12 days (Fig. 2C). And phenylalanine ammonia lyase activity in volatile-exposed plantlets peaked after 8 days (2.5-fold higher than the control) and then decreased quickly. Polyphenol oxidase activity in bacteriuminfected plantlets peaked after 2 days (approximately 2.0-fold higher than the control) and then decreased to the control level after 12 days (Fig. 2D). And polyphenol oxidase activity in volatileexposed plantlets peaked after 8 days (1.4-fold higher than the control) and then decreased to the control level after 12 days. It was obvious that most defense-related enzyme activities increased by volatiles released by P. fluorescens ALEB7B were much lower and later than those increased by the bacterial infection. 3.4. Identification of volatiles released by P. fluorescens ALEB7B Gas chromatography-mass spectrometer (GC-MS) analysis showed that there were 11 main substances in volatiles released by
135
P. fluorescens ALEB7B grown on MS rooting agar, while there were no volatiles released by non-inoculated MS rooting agar (Fig. 3A). Eight volatiles were identified, including ammonia, formamide, N,N-dimethyl-formamide, benzaldehyde, propanamide, 1,2,3trimethyl-cyclohexane, acetic acid, 3-(6,6-dimethyl-2methylenecyclohex-3-enylidene)-1-methylbutyl ester, and 3,4dimethyl-2(1H)-quinolinone (Table 1). Formamide (Fig. 3B), N,Ndimethyl-formamide (Fig. 3C), and benzaldehyde (Fig. 3D) are main volatile substances (6.1%, 10.8%, and 25.3% of the total area of all peaks formed by volatiles released by Ps. fluorescens ALEB7B, respectively). 3.5. Nitrogenous volatiles released by P. fluorescens ALEB7B promoting plant growth and benzaldehyde promoting volatile oil accumulation in A. lancea Because formamide, N,N-dimethyl-formamide, and benzaldehyde were the main volatiles released by P. fluorescens ALEB7B and have stronger volatility, impacts of these three volatiles at same concentrations detected in the non-contact co-culture system on the growth and volatile oil accumulation in A. lancea were detected. Both formamide and N,N-dimethyl-formamide significantly increased the plant dry weight (1.4-fold and 1.3-fold higher than the control, respectively), but benzaldehyde had no effect on the plant growth (Fig. 4A). Conversely, benzaldehyde significantly increased the volatile oil accumulation in A. lancea, but formamide and N,N-dimethyl-formamide had no effects (Fig. 4B). However, all these three volatiles had no effects on the leaf net photosynthetic rate of A. lancea plantlets (Fig. 4C). These results indicated that nitrogenous volatiles might be responsible for the plant growth promotion induced by volatiles released by P. fluorescens ALEB7B, while benzaldehyde might be responsible for the volatile oil accumulation in A. lancea induced by bacterial volatiles. 3.6. Benzaldehyde inducing defense responses in A. lancea Superoxide dismutase activity in A. lancea plantlets peaked (1.8fold higher than the control) 2 days after the treatment of benzaldehyde and then decreased to the control level after 8 days (Fig. 5A). Catalase activity in A. lancea peaked after 2 days (1.1-fold higher than the control) and then decreased to the control level after 8 days (Fig. 5B). Phenylalanine ammonia lyase activity in A. lancea peaked after 2 days (1.6-fold higher than the control) and then decreased quickly (Fig. 5C). Polyphenol oxide activity in A. lancea peaked after 2 days (2.0-fold higher than the control) and then decreased gradually (Fig. 5D). However, both the treatments of formamide and N,N-dimethyl-formamide had no effects on defense-related enzyme activities in planta. Therefore, benzaldehyde might promote the volatile oil accumulation in A. lancea by activating plant defense responses. 3.7. Detection of bacterial volatiles in the A. lancea e P. fluorescens symbiont GC analysis of volatiles released by tissue pieces of A. lancea plantlets infected by P. fluorescens ALEB7B was conducted to confirm whether the endophytic bacterial volatiles could be detected in the A. lancea e P. fluorescens symbiont. Compared with the gas chromatogram of authentic standard (Fig. S3A), benzaldehyde was found being released by tissue pieces of infected A. lancea plantlets (Fig. S3B). Benzaldehyde could not be detected in the tissue pieces of control plantlets (Fig. S3C) or plantlets inoculated with E. coli (Fig. S3D), indicating that the benzaldehyde detected in A. lancea plantlets infected by P. fluorescens ALEB7B was not produced by plantlets themselves because of microbe-induced defense
136
J.-Y. Zhou et al. / Plant Physiology and Biochemistry 101 (2016) 132e140
Fig. 2. Activities of superoxide dismutase (A), catalase (B), phenylalanine ammonia lyase (C), and polyphenol oxidase (D) in A. lancea plantlets infected by P. fluorescens ALEB7B (Bacterium) and exposed to bacterial volatiles (Volatiles). Plantlets treated with sterile double-distilled water were set as control (Control). Results are means of three biological replicates. Error bars indicate standard deviations. Different lowercase letters indicate significant differences at P < 0.05.
Fig. 3. The total ion chromatorgraphy of volatiles released by P. fluorescens ALEB7B grown on MS rooting agar (Pseudomonas fluorescens ALEB7B) and non-inoculated MS rooting agar (Control) (A) and mass spectrograms of formamide and substance 3 (B), N,N-dimethyl-formamide and substance 4 (C), and benzaldehyde and substance 5 (D). Peaks 1e11 represent 11 volatiles released by P. fluorescens ALEB7B, corresponding to those listed in Table 1.
responses. Therefore, the endophytic bacterial volatiles might function in planta as well. However, no nitrogenous volatiles released by P. fluorescens ALEB7B were detected in volatiles released by tissue pieces of infected A. lancea plantlets. There might be two possible explanations. On the one hand, these nitrogenous substances or their precursors released by P. fluorescens ALEB7B
might be consumed by the host plant. On the other hand, P. fluorescens ALEB7B might not produce these nitrogenous substances when it lives inside plant tissues.
J.-Y. Zhou et al. / Plant Physiology and Biochemistry 101 (2016) 132e140
137
Table 1 Volatiles released by P. fluorescens ALEB7B grown on MS rooting agar. Peak order
Retention time (min)
Chemical name
Molecular formula
Molecular weight
Chemical structural formula
1 2
9.412 10.378
Unidentified Ammonia
Unknown NH3
Unknown 17.03
Unknown
3
10.958
Formamide
CH3NO
45.04
6.1
4
11.481
N,N-dimethyl-Formamide
C3H7NO
73.05
10.8
5
12.734
Benzaldehyde
C7H6O
106.04
25.3
6
13.146
Propanamide
C3H7NO
73.05
12.5
7
13.583
1,2,3-trimethyl-Cyclohexane
C9H18
126.14
3.1
8 9 10
14.946 15.131 16.019
Unidentified Unidentified Acetic acid, 3-(6,6-dimethyl-2-methylenecyclohex-3-enylidene)-1methylbutyl ester
Unknown Unknown C16H24O2
Unknown Unknown 248.18
11
16.816
3,4-dimethyl-2(1H)-Quinolinone
C10H12O4
196.07
Unknown Unknown
Relative content (%) 7.8 6.2
4.9 14.6 3.5
5.1
Fig. 4. The dry weight (A), volatile oil content (B), and leaf net photosynthetic rate (C) of A. lancea plantlets exposed to formamide, N,N-dimethyl-formamide, and benzaldehyde, respectively. Plantlets exposed to sterile double-distilled water were set as control. Results are means of three biological replicates. Error bars indicate standard deviations. Different lowercase letters indicate significant differences at P < 0.05.
4. Discussion By establishing a non-contact co-culture system of plant and endophytic bacterium (Fig. 1), we have shown that volatiles released by the endophytic bacterium P. fluorescens ALEB7B promoted the growth (Fig. S2A) and volatile oil accumulation (Fig. S2B) in non-infected A. lancea plantlets. The promotions induced by endophytic bacterial volatiles are more efficient than the promotions of other reported endophytes (Zhang et al., 2009a; Ren and Dai, 2012; Wang et al., 2015). The volatiles released by P. fluorescens ALEB7B reached a high concentration around A. lancea (Fig. 3). Because P. fluorescens is a type of common rhizospheric bacterium (Algar et al., 2014; Bonilla et al., 2014), P. fluorescens ALEB7B may
exist in the rhizosphere of A. lancea and have a beneficial impact on non-infected plants by releasing volatiles, as the endophytic bacterium cannot efficiently infect all plants in practice. The phenomenon that an endophytic bacterium promotes plant growth and secondary metabolite accumulation by releasing volatiles not only broadens the known activities of endophytic bacterium in the phytosphere (Yang et al., 2013), but also provides a theoretical basis for the application of P. fluorescens ALEB7B in the cultivation of A. lancea. Although the leaf net photosynthetic rate of A. lancea plantlets was significantly enhanced by bacterial infection (Fig. S2C), there was no corresponding change in plant biomass (Fig. S2A). Plants need more photosynthates after perceiving stress and the accumulated photosynthates are redistributed to plant
138
J.-Y. Zhou et al. / Plant Physiology and Biochemistry 101 (2016) 132e140
Fig. 5. Activities of superoxide dismutase (A), catalase (B), phenylalanine ammonia lyase (C), and polyphenol oxidase (D) in A. lancea plantlets exposed to formamide, N,N-dimethylformamide, and benzaldehyde, respectively. Plantlets exposed to sterile double-distilled water were set as control. Results are means of three biological replicates. Error bars indicate standard deviations. Different lowercase letters indicate significant differences at P < 0.05.
defenses (Vatsa-Portugal et al., 2015). Therefore, the photosynthate accumulation induced by infection with P. fluorescens ALEB7B is preferentially used by A. lancea to synthesize volatile oils that have antimicrobial effects (Fig. S2B) (Wang et al., 2009). This is in accordance with the significantly faster and stronger defense responses that were induced by endophytic bacterial infection compared with bacterial volatiles (Fig. 2). The volatiles released by P. fluorescens ALEB7B grown on the MS agar were collected using HS-SPME and were identified using GCeMS. These volatiles mainly included ammonia, benzaldehyde, formamide, N,N-dimethyl-formamide, and propanamide (Fig. 3 and Table 1). Apart from ammonia and benzaldehyde, this is the first time that the other volatiles have been reported as being produced by bacteria (Kai et al., 2009; Lemfack et al., 2014; Schulz and Dickschat, 2007; Stotzky and Schenck, 1976). Moreover, this study firstly discovers that a bacterium (P. fluorescens ALEB7B) can release various kinds of nitrogenous volatiles, although ammonia or N,N-dimethyl-hexadecanamine released by bacteria has been reported before (Bernier et al., 2011; Nijland and Burgess, 2010; zquez-Becerra et al., 2011). Bernier et al. (2011) have reported Vela that Pseudomonas aeruginosa produces ammonia via L-aspartate catabolism. Simmonds and Robinson (1998) have discovered that Pseudomonas putida 12633 synthesizes benzaldehyde via the mandelate pathway using benzoyl formate as the substrate. The synthetic precursors and pathways of other volatiles in P. fluorescens ALEB7B are not yet clear and require further studies. It is noteworthy that the profile of volatiles released by P. fluorescens ALEB7B grown on MS agar is different from the volatile profile seen when P. fluorescens ALEB7B is grown on the LB agar (Zhou et al., 2014), indicating that bacterial volatile production
is strongly dependent on environmental conditions (Blom et al., 2011). Therefore, P. fluorescens ALEB7B may not release some plant growth-promoting volatiles when it lives inside plant tissues, which may be another explanation to the phenomenon that the infection of P. fluorescens ALEB7B has little effect on the plant biomass. Furthermore, some bacteria can also release volatiles, which have growth-inhibiting effects on plants (Kai et al., 2016). For example, volatiles released by Stenotrophomonas, Serratia, and Bacillus species inhibit the growth of Arabidopsis thaliana (Vespermann et al., 2007). Kai et al. (2010) further confirm that dimethyl disulfide, ammonia, and 2-phenylethanol released by Serratia odorifera 4Rx13 additively inhibit the growth of A. thaliana. Therefore, P. fluorescens ALEB7B may release some volatiles which have negative effects on plant growth and counteract the effects of plant growth-promoting volatiles when it lives inside plant tissues. P. fluorescens ALEB7B can release various kinds of nitrogenous volatiles (Fig. 3 and Table 1). Formamide and N,N-dimethylformamide have been shown to significantly increase A. lancea biomass (Fig. 4A). As the volatiles released by P. fluorescens ALEB7B have little effect on the leaf net photosynthetic rate of A. lancea (Fig. S2C), we propose that the endophytic bacterial nitrogenous volatiles promote plant growth via three mechanisms. Firstly, nitrogenous volatiles released by P. fluorescens ALEB7B may play roles as plant growth regulators, having similar functions as polyamines. Similarly, the N,N-dimethyl-hexadecanamine released by Arthrobacter agilis UMCV2 significantly promote the growth of zquez-Becerra et al., 2011). Secondly, the Medicago sativa (Vela endophytic bacterial nitrogenous volatiles provide an abundant source of nitrogen nutrition for the host plant. The endophytic bacterial nitrogenous volatiles cannot be detected in the A. lancea e
J.-Y. Zhou et al. / Plant Physiology and Biochemistry 101 (2016) 132e140
P. fluorescens symbiont, indicating these nitrogenous volatiles or their precursors may be consumed by the host plant, leading to their concentrations below the limit of detection. Similarly, dimethyl disulfide released by the rhizospheric bacterium Bacillus sp. B55 provides sulfur nutrition for Nicotiana attenuata and promotes the plant growth (Meldau et al., 2013). Finally, some bacterial volatiles, such as ammonia, can increase the dissolution of nutrients and promote plant growth by changing the acidity of the medium (Nijland and Burgess, 2010; Zhang et al., 2009b). However, we have not detected whether the CO2 can be released by P. fluorescens ALEB7B using special collection and detection technologies in this study. The bacterial metabolism definitely releases abundant CO2, which has plant growth-promoting ability (Kai and Piechulla, 2009). Therefore, we speculate that CO2 may contribute to the increased plant biomass induced by the volatiles released by P. fluorescens ALEB7B. Volatiles play essential roles in communications among different organisms and have extensive ecological significances (Tumlinson, 2014). Volatiles released by plants under herbivore attack can activate defense responses in non-attacked neighbors (Baldwin et al., 2006). In this study, we firstly demonstrate that volatiles released by plants infected by endophytic bacterium can activate defense responses in non-infected plant. A higher concentration of benzaldehyde was detected in the A. lancea e P. fluorescens symbiont (Fig. S3). Meanwhile benzaldehyde can induce defense responses in non-infected plants (Fig. 5) and also promote volatile oil accumulation (Fig. 4B). These results indicate that the impact of endophytes on host plants are not limited to commonly known physical contact and the ecological functions of endophytes in the phytosphere are much more extensive than previously known. In summary, this study reports that the endophytic bacterium P. fluorescens ALEB7B can promote A. lancea growth by releasing nitrogenous volatiles. This endophytic bacterium can also induce defense responses and promote volatile oil accumulation in A. lancea by releasing benzaldehyde. This study extends the ecological significance of endophytes in the phytosphere and deepens the current understanding of interactions between plants and endophytes, which are no longer limited to physical contact between plants and endophytes. Contribution Jia-Yu Zhou and Chuan-Chao Dai conceived and designed the experiments. Jia-Yu Zhou conducted the experiments, analyzed the data, and wrote the manuscript. Xia Li and Chuan-Chao Dai supervised the research and edited the paper. Jiao-Yan Zheng contributed research facilities, reagents, and materials. All authors read and approved the final manuscript. Acknowledgments This work is financially supported by National Natural Science Foundation of China (grant number 31070443), a project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions, Promoting Project for Industrialization of Jiangsu Higher Education Institutions (grant number JHB2012-16), Integration of Production and Research Projects of Nanjing Science and Technology Commission (grant number 201306019), and Graduate Education Innovation Project of Jiangsu Province (KYLX15_0734). Appendix A. Supplementary data Supplementary data related to this article can be found at http://
139
dx.doi.org/10.1016/j.plaphy.2016.01.026. References ~ ero, F.J., Garcia-Villaraco, A., García-Seco, D., Lucas, J.A., Algar, E., Gutierrez-Man Ramos-Solano, B., 2014. The role of isoflavone metabolism in plant protection depends on the rhizobacterial MAMP that triggers systemic resistance against Xanthomonas axonopodis pv. glycines in Glycine max (L.) Merr. cv. Osumi. Plant Physiol. Biochem. 82, 9e16. http://dx.doi.org/10.1016/j.plaphy.2014.05.001. Baldwin, I.T., Halitschke, R., Paschold, A., Von Dahl, C.C., Preston, C.A., 2006. Volatile signaling in plant-plant interactions: “talking trees” in the genomics era. Science 311, 812e815. http://dx.doi.org/10.1126/science.1118446. , P.W., 2009. Soil bacteria elevate essential oil Banchio, E., Xie, X., Zhang, H., Pare accumulation and emissions in sweet basil. J. Agr. Food Chem. 57, 653e657. http://dx.doi.org/10.1021/jf8020305. toffe , S., Delepierre, M., Ghigo, J.-M., 2011. Biogenic ammonia modBernier, S.P., Le ifies antibiotic resistance at a distance in physically separated bacteria. Mol. Microbiol. 81, 705e716. http://dx.doi.org/10.1111/j.1365-2958.2011.07724.x. Blom, D., Fabbri, C., Connor, E.C., Schiestl, F.P., Klauser, D.R., Boller, T., Eberl, L., Weisskopf, L., 2011. Production of plant growth modulating volatiles is widespread among rhizosphere bacteria and strongly depends on culture conditions. Environ. Microbiol. 13, 3047e3058. http://dx.doi.org/10.1111/j.14622920.2011.02582.x. ~ oz Ledesmac, F.J., Ramos Solano, B., Bonilla, A., Sarriaa, A.L.F., Algar, E., Mun ~ ero, F.J., 2014. Microbe associated molecular Fernandes, J.B., Gutierrez Man patterns from rhizosphere bacteria trigger germination and Papaver somniferum metabolism under greenhouse conditions. Plant Physiol. Biochem. 74, 133e140. http://dx.doi.org/10.1016/j.plaphy.2013.11.012. Dandurishvili, N., Toklikishvili, N., Ovadis, M., Eliashvili, P., Giorgobiani, N., Keshelava, R., Tediashvili, M., Vainstein, A., Khmel, I., Szegedi, E., Chernin, L., 2011. Broad-range antagonistic rhizobacteria Pseudomonas fluorescens and Serratia plymuthica suppress Agrobacterium crown gall tumours on tomato plants. J. Appl. Microbiol. 110, 341e352. http://dx.doi.org/10.1111/j.13652672.2010.04891.x. Kai, M., Crespo, E., Cristescu, S.M., Harren, F.J.M., Francke, W., Piechulla, B., 2010. Serratia odorifera: analysis of volatile emission and biological impact of volatil compounds on Arabidopsis thaliana. Appl. Microbiol. Biotechnol. 88, 965e976. http://dx.doi.org/10.1007/s00253-010-2810-1. Kai, M., Haustein, M., Molina, F., Petri, A., Scholz, B., Piechulla, B., 2009. Bacterial volatiles and their action potential. Appl. Microbiol. Biotechnol. 81, 1001e1012. http://dx.doi.org/10.1007/s00253-008-1760-3. Kai, M., Piechulla, B., 2009. Plant growth promotion due to rhizobacterial volatiles e an effect of CO2? FEBS Lett. 583, 3473e3477. http://dx.doi.org/10.1016/ j.febslet.2009.09.053. Kai, M., Effmert, U., Piechulla, B., 2016. Bacterial-plant-interactions: approaches to unravel the biological function of bacterial volatiles in the rhizosphere. Front. Microbiol. http://dx.doi.org/10.3389/fmicb.2016.00108. Kumar, V., Mohan, T., Murugan, K., 2008. Purification and kinetic characterization of polyphenol oxidase from Barbados cherry (Malpighia glabra L.). Food Chem. 110, 328e333. http://dx.doi.org/10.1016/j.foodchem.2008.02.006. Lemfack, M.C., Nickel, J., Dunkel, M., Preissner, R., Piechulla, B., 2014. mVOC: a database of microbial volatiles. Nucleic Acids Res. 42, D744eD748. http:// dx.doi.org/10.1093/nar/gkt1250. Li, X., Wang, C., 2013. Physiological and metabolic enzymes activity changes in transgenic rice plants with increased phosphoenolpyruvate carboxylase activity during the flowering stage. Acta Physiol. Plant. 35, 1503e1512. http://dx.doi.org/ 10.1007/s11738-012-1191-8. Meldau, D.G., Meldau, S., Hoang, L.H., Underberg, S., Wünsche, H., Baldwin, l.T., 2013. Dimethyl disulfide produced by the naturally associated bacterium Bacillus sp B55 promotes Nicotiana attenuata growth by enhancing sulfur nutrition. Plant Cell 25, 2731e2747. www.plantcell.org/cgi/doi/10.1105/tpc.113. 114744. Nijland, R., Burgess, J.G., 2010. Bacterial olfaction. Biotechnol. J. 5, 974e977. http:// dx.doi.org/10.1002/biot.201000174. Ouyang, Z., Zhang, L., Zhao, M., Wang, P., Wei, Y., Fang, J., 2012. Identification and quantification of sesquiterpenes and polyacetylenes in Atractylodes lancea from various geographical origins using GC-MS analysis. Rev. Bras. Farmacogn. 22, 957e963. http://dx.doi.org/10.1590/S0102-695X2012005000051. Ren, C.G., Dai, C.C., 2012. Jasmonic acid is involved in the signaling pathway for fungal endophyte-induced volatile oil accumulation of Atractylodes lancea plantlets. BMC Plant Biol. 12, 128. http://dx.doi.org/10.1186/1471-2229-12-128. , P.W., Kloepper, J.W., Ryu, C.M., Farag, M.A., Hu, C.H., Reddy, M.S., Wei, H.X., Pare 2003. Bacterial volatiles promote growth in Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 100, 4927e4932. http://dx.doi.org/10.1073/pnas.0730845100. Santoro, M.V., Zygadlo, J., Giordano, W., Banchio, E., 2011. Volatile organic compounds from rhizobacteria increase biosynthesis of essential oils and growth parameters in peppermint (Mentha piperita). Plant Physiol. Biochem. 49, 1177e1182. http://dx.doi.org/10.1016/j.plaphy.2011.07.016. Simmonds, J., Robinson, G.K., 1998. Formation of benzaldehyde by Pseudomonas putida ATCC 12633. Appl. Microbiol. Biotech. 50, 353e358. http://dx.doi.org/ 10.1007/s002530051303. Schulz, S., Dickschat, J.S., 2007. Bacterial volatiles: the smell of small organisms. Nat. Prod. Rep. 24, 814e842. http://dx.doi.org/10.1039/B507392H. Stotzky, G., Schenck, S., 1976. Volatile organic compounds and microorganisms. Crit.
140
J.-Y. Zhou et al. / Plant Physiology and Biochemistry 101 (2016) 132e140
Rev. Microbiol. 4, 333e382. http://dx.doi.org/10.3109/10408417609102303. Tumlinson, J.H., 2014. The importance of volatile organic compounds in ecosystem functioning. J. Chem. Ecol. 40, 212e213. http://dx.doi.org/10.1007/s10886-0140399-z. ment, C., Barka, E.A., VaillantVatsa-Portugal, P., Walker, A., Jacquens, L., Cle Gaveau, N., 2015. Inflorescences vs leaves: a distinct modulation of carbon metabolism process during Botrytis infection. Physiol. Plant. 154, 162e177. http://dx.doi.org/10.1111/ppl.12287. pez-Bucio, J., AltamiranoVel azquez-Becerra, C., Macías-Rodríguez, L.I., Lo ndez, J., Flores-Cortez, I., Valencia-Cantero, E., 2011. A volatile organic Herna compound analysis from Arthrobacter agilis identifies dimethylhexadecylamine, an amino-containing lipid modulating bacterial growth and Medicago sativa morphogenesis in vitro. Plant Soil 339, 329e340. http://dx.doi.org/10.1007/ s11104-010-0583-z. Vespermann, A., Kai, M., Piechulla, B., 2007. Rhizobacterial volatiles affect the growth of fungi and Arabidopsis thaliana. Appl. Environ. Microb. 73, 5639e5641. http://dx.doi.org/10.1128/AEM.01078-07. Wang, H.X., Liu, C.M., Liu, Q., Gao, K., 2008. Three types of sesquiterpenes from rhizomes of Atractylodes lancea. Phytochemistry 69, 2088e2094. http:// dx.doi.org/10.1016/j.phytochem.2008.04.008. Wang, X.M., Yang, B., Ren, C.G., Wang, H.W., Wang, J.Y., Dai, C.C., 2015. Involvement of abscisic acid and salicylic acid in signal cascade regulating bacterial endophyte-induced volatile oil biosynthesis in plantlets of Atractylodes lancea. Physiol. Plant. 153, 30e42. http://dx.doi.org/10.1111/ppl.12236. Wang, X.M., Yang, B., Wang, H.W., Yang, T., Ren, C.G., Zheng, H.L., Dai, C.C., 2013. Consequences of antagonistic interactions between endophytic fungus and bacterium on plant growth and defense responses in Atractylodes lancea. J. Basic Microb. 55, 659e670. http://dx.doi.org/10.1002/jobm.201300601. Wang, Y., Dai, C.C., Cao, J.L., Xu, D.S., 2012. Comparison of the effects of fungal endophyte Gilmaniella sp. and its elicitor on Atractylodes lancea plantlets. World J. Microb. Biotech. 28, 575e584. http://dx.doi.org/10.1007/s11274-011-0850-z. Wang, Y., Dai, C.C., Chen, Y., 2009. Antimicrobial activity of volatile oil from Atractylodes lancea against three species of endophytic fungi and seven species of
exogenous fungi. Chin. J. Appl. Ecol. 20, 2778e2784, 1001-9332 (2009) 11-277807. in Chinese. Wang, Y., Dai, C.C., Zhao, Y.W., Peng, Y., 2011. Fungal endophyte-induced volatile oil accumulation in Atractylodes lancea plantlets is mediated by nitric oxide, salicylic acid and hydrogen peroxide. Process Biochem. 46, 730e735. http:// dx.doi.org/10.1016/j.procbio.2010.11.020. Yang, T., Chen, Y., Wang, X.X., Dai, C.C., 2013. Plant symbionts: keys to the phytosphere. Symbiosis 59, 1e14. http://dx.doi.org/10.1007/s13199-012-0190-2. Yang, T., Ma, S., Dai, C.C., 2015. Drought degree constrains the beneficial effects of a fungal endophyte on Atractylodes lancea. J. Appl. Microbiol. 117, 1435e1449. http://dx.doi.org/10.1111/jam.12615. Yuan, Y., Liu, Y.J., Huang, L.Q., Cui, G.H., Fu, G.F., 2009. Soil acidity elevates some phytohormone and b-eudesmol contents in roots of Atractylodes lancea. Russ. J. Plant Physlþ 56, 133e137. http://dx.doi.org/10.1134/S1021443709010191. Zhang, B., Dai, C.C., Fang, F., Chen, J.X., 2009a. Effects of three species endophytic fungi on Atractylodes lancea growth and its essential oil composition. Chin. J. Ecol. 28, 704e709. http://dx.doi.org/10.13292/j.1000-4890.2009.0117 (in Chinese). Zhang, H., Sun, Y., Xie, X., Kim, M.S., Dowd, S.E., W, P.P., 2009b. A soil bacterium regulates plants acquisition of iron via deficiency-inducible mechanisms. Plant J. 58, 568e577. http://dx.doi.org/10.1111/j.1365-313X.2009.03803.x. Zhou, J.Y., Jia, Y., Wang, H.W., Dai, C.C., 2013. Diversity and plant growth-promoting potential of culturable endophytic bacteria isolated from the leaves of Atractylodes lancea. Acta Ecol. Sin. 33, 1106e1117. DOI: 10. 5846/stxb201208031103. (in Chinese). Zhou, J.Y., Zhao, X.Y., Dai, C.C., 2014. Antagonistic mechanisms of endophytic Pseudomonas fluorescens against Athelia rolfsii. J. Appl. Microbiol. 117, 1144e1158. http://dx.doi.org/10.1111/jam.12586. Zhou, J.Y., Yuan, J., Li, X., Ning, Y.F., Dai, C.C., 2016. Endophytic bacterium-triggered reactive oxygen species directly increase oxygenous sesquiterpenoid content and diversity in Atractylodes lancea. Appl. Environ. Microb. http://dx.doi.org/ 10.1128/AEM.03434-15.
