International Journal of Neuroscience, 2015; Early Online: 1–11 Copyright © 2015 Amgen Inc. ISSN: 0020-7454 print / 1543-5245 online DOI: 10.3109/00207454.2015.1004172

ORIGINAL ARTICLE

Voltage-gated sodium channel function and expression in injured and uninjured rat dorsal root ganglia neurons Ruoyuan Yin,1,2 Dong Liu,1 Mark Chhoa,3 Chi-Ming Li,3 Yi Luo,1 Maosheng Zhang,1 Sonya G. Lehto,1 David C. Immke,1 and Bryan D. Moyer1, ∗ Department of Neuroscience, Amgen Inc., Thousand Oaks, CA, USA; 2 Department of Neuroscience, Amgen Inc., South San Francisco, CA, USA; 3 Department of Protein Technologies, Amgen Inc., Thousand Oaks, CA, USA

Int J Neurosci Downloaded from informahealthcare.com by University of Victoria on 04/08/15 For personal use only.

1

The nine members of the voltage-gated sodium channel (Nav) family mediate inward sodium currents that depolarize neurons and lead to action potential firing. Increased Nav expression and function in sensory ganglia may drive ectopic action potentials and result in neuropathic pain. Using patch-clamp electrophysiology and molecular biology techniques, experiments were performed to elucidate the contribution of Nav channels to sodium currents in rat dorsal root ganglion (DRG) neurons following the L5/L6 spinal nerve ligation (SNL) model of neuropathic pain. The abundance of DRG neurons with fast, tetrodotoxin sensitive (TTX-S) currents was seven-fold higher whereas the abundance of DRG neurons with slow, tetrodotoxin resistant (TTX-R) currents was nearly thirty-fold lower when comparing ipsilateral (injured) to contralateral (uninjured) neurons. TTX-S currents were elevated in larger neurons while TTX-R currents were reduced in both small and large neurons. Among Nav transcripts encoding TTX-R channels, Scn10a (Nav1.8) and Scn11a (Nav1.9) expression was twenty- to thirty-fold lower, while among Nav transcripts encoding TTX-S channels, Scn3a (Nav1.3) expression was four-fold higher in injured compared to uninjured DRG by qRT-PCR analysis. In summary, the SNL model of neuropathic pain induced a phenotypic switch in Nav expression from TTX-R to TTX-S channels in injured DRG neurons. Transcriptional reprogramming of Nav genes may drive ectopic action potential firing and contribute to neuropathic pain. KEYWORDS: electrophysiology, tetrodotoxin, neuropathic pain, Nav, transcription

Introduction Neuropathic pain, defined as pain arising from a direct consequence of a lesion or disease affecting the somatosensory system, affects over 1% of the population [1,2]. Current treatments in clinical practice only provide 30%–40% of patients with less than 50% pain reduction [3,4]. Thus, identification of new and efficacious therapeutics against validated targets for neuropathic pain represents a major unmet medical need. Sensory nerve damage initiates complex changes in the peripheral and central nervous systems that transduce and transmit nociceptive information [5,6]. Following nerve injury, transcriptional reprogramming of dorsal root ganglia (DRG) neurons in the peripheral nervous system is proposed to drive neuropathic pain, Received 1 October 2014; revised 5 December 2014; accepted 1 January 2015. Correspondence: Bryan D. Moyer, Department of Neuroscience, Amgen Inc., One Amgen Center Drive, Thousand Oaks, CA 91320, USA. Tel: 1–805–313– 5495, Fax: 1–805–499–9835. E-mail: [email protected]

in part, through ectopic action potential firing [5]. Strikingly, DRG transcriptional reprogramming affects up to 25% of the genome in a L5 nerve transection model as evaluated by RNA-sequencing technology [7]. Identifying key transcripts whose protein products initiate and sustain neuropathic pain is a challenge for target identification and validation. Proteins encoded by transcripts that are not detectable or expressed at low levels in DRG neurons but upregulated following nerve injury can constitute attractive targets since modulation of target function in DRG would be restricted to injured neurons signaling pain, provided targets are druggable and not widely expressed elsewhere in the body. Members of the voltage-gated sodium channel (Nav) family carry inward sodium currents that depolarize neurons and initiate action potentials. Mammalian genomes contain nine Nav genes encoding sodium channels with distinct sensitivity to tetrodotoxin (TTX) and kinetics of activation/inactivation [8]. Six Navs are sensitive to nanomolar concentrations of TTX and activate/inactivate rapidly (Nav1.1, Nav1.2, Nav1.3, 1

Int J Neurosci Downloaded from informahealthcare.com by University of Victoria on 04/08/15 For personal use only.

2

R. Yin et al.

Nav1.4, Nav1.6 and Nav1.7), whereas three Navs are resistant to nanomolar concentrations of TTX or activate/inactive slowly (Nav1.5, Nav1.8 and Nav1.9). Nav proteins are recognized targets for neuropathic pain since non-selective Nav antagonists display clinical efficacy; however, lack of selectivity of existing drugs leads to dose-limiting side effects including somnolence, dizziness and nausea that limit their therapeutic index [9,10]. Human neuropathic pain resulting from nerve damage during surgical procedures, including amputation, lumpectomy and mastectomy, thoracotomy and inguinal hernia repair, affects 10%–50% of patients [11]. Ligation of the sciatic nerve is actually recommended during leg amputations, although similar ligations produce neuropathic pain in rodent models [12]. Accordingly, experiments were performed to evaluate the expression and function of Nav channels in DRG neurons following the L5/L6 spinal nerve ligation (SNL) model of neuropathic pain.

Methods Ethics statement This study was carried out in strict accordance with the recommendations in the National Institutes of Health’s Guide for the Care and Use of Laboratory Animals. All procedures followed a protocol approved by an Institutional Animal Care and Use Committee at Amgen (protocol numbers 2009–00047 and 2008–00043), and efforts were made to ameliorate suffering.

Spinal nerve ligation (SNL) and tactile sensitivity measurement L5/L6 SNL surgery was performed in 11–12 week old, male Sprague Dawley rats (120–140 g, Harlan Laboratories, Indianapolis, IN) as previously described [13]. Following isoflurane anesthesia (3% for induction and 2% for maintenance), the left L5 and L6 spinal nerves were each tightly ligated with 6–0 silk thread. Seven to 10 days post-surgery, tactile sensitivity was measured with von Frey filaments using the up-down method to calculate the 50% paw withdrawal threshold [14]. Any rat showing a withdrawal threshold of more than 3.16 g was excluded from the study.

DRG neuron isolation Rats displaying tactile sensitivity were euthanized with sodium pentobarbital (Nembutal, 80 mg/kg, i.p., Western Med Supply, Arcadia, CA) followed by decapitation. Ipsilateral and contralateral L5 and L6 DRG were

sequentially digested at 37◦ C with papain (20 U/ml, Worthington Biochemical Corporation, Lakewood, NJ) and L-cysteine (25 uM) in Ca2+ and Mg2+ -free Hanks’ (pH 7.4) for 20–30 min and then with collagenase type 2 (0.9% w/v, Worthington Biochemical Corporation) for 20–30 min. Digestions were quenched with a 1:1 mixture of DMEM and Ham’s F-12 Nutrient Mixture (Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum (Invitrogen), and cells were triturated with a fire-polished Pasteur pipette prior to plating on PolyD-Lysine-coated glass coverslips (Cole-Parmer, Vernon Hills, IL). Cells were maintained in a humidified incubator at 28◦ C with 5% CO2 in the absence of growth factors and used 1–5 h after plating.

Manual patch-clamp electrophysiology Ipsilateral (injured), contralateral (uninjured) and na¨ıve (control from non-SNL animals) DRG neurons were voltage clamped using the whole-cell patch clamp configuration at room temperature (21◦ C – 24◦ C) using an Axopatch 200 B or MultiClamp 700 B amplifier and DIGIDATA 1322A with pCLAMP software (Molecular Devices, Sunnyvale, CA). Pipettes, pulled from borosilicate glass capillaries (World Precision Instruments, Sarasota, FL), had resistances between 1.0 and 3.0 MΩ. Voltage errors were minimized using >80% series resistance compensation. A P/4 protocol was used for leak subtraction. Currents were digitized at 50 kHz and filtered (4-pole Bessel) at 10 kHz. Cells were lifted off the culture dish and positioned directly in front of a micropipette connected to a solution exchange manifold for compound perfusion. A full current-voltage profile was recorded from each cell by holding at −80 mV and stepping to +20 mV in 10 mV increments for 40 ms with a 1 s interval between steps. Following this, some cells were held as above and depolarized to −10 mV for 40 ms every 10 s in the presence and absence of tetrodotoxin (TTX, Sigma). These protocols did not differentiate between slowly inactivating (Nav1.8-like) and persistent (Nav1.9-like) TTX-R currents. Pipette solution contained (in mM): 10 NaCl, 62.5 CsCl, 70 CsF, 1 MgCl2 , 5 BAPTA-tetraK salt, 10 HEPES, 1 Mg-ATP, 0.5 Na2 GTP at pH 7.2 adjusted with CsOH. Bath solution contained (in mM): 30 NaCl, 82 cholineCl, 28 TEACl, 1 MgCl2 , 0.7 CaCl2 , 0.2 CdCl2 , 10 HEPES and 20 D-Glucose at pH 7.4 adjusted with NMDG. Junction potentials were 4–5 mV and not corrected. Data were analyzed with Clampfit and Origin Pro8 (OriginLab Corp, Northampton, MA).

qRT-PCR Total RNA was purified from ipsilateral and contralateral L5 and L6 DRG using the RNeasy Micro International Journal of Neuroscience

Int J Neurosci Downloaded from informahealthcare.com by University of Victoria on 04/08/15 For personal use only.

Nav phenotypic switch in injured DRG neurons Table 1.

TaqMan assays used to evaluate gene expression.

Gene

Protein

TaqMan assay

Actb Scn1a Scn2a1 Scn3a Scn3a Scn4a Scn5a Scn8a Scn9a Scn10a Scn11a Gal

β-actin Nav1.1 Nav1.2 Nav1.3 Nav1.3 Nav1.4 Nav1.5 Nav1.6 Nav1.7 Nav1.8 Nav1.9 Galanin

4352340E RN00578439 RN00561862 RN00565438 In house RN00565973 RN00689914 RN00570506 RN00591020 RN00568393 RN01445867 In house

m1 m1 m1 m1 m1 m1 m1 m1 m1

Amplicon size (bp)

Exons

91 64 79 91 119 64 57 65 86 69 58 97

4–5 18–19 11–12 1–2 23–24 11–12 17–18 10–11 9–10 14–15 5–6 2–3

Sequences of primers and probes designed in house are listed in Methods.

kit (Qiagen, Valencia, CA) and digested with DNase I (Invitrogen). Semi-quantitative qRT-PCR was performed using the 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA) using TaqMan One-Step RT-PCR Master Mix (Applied Biosystems), 10 ng of RNA and TaqMan assays (Table 1). In addition to these inventoried assays, we also used the following assays for Scn3a (5 primer: CTTCACGATAGGGTGGAACA; 3 primer: GGATGACTCGGAACAGGGTA; hybridization probe: TGACTTTGTGGTGGTGATTCTCTCG) and Gal (5 primer: GGGCAGCGTTATCCTGCTA; 3 primer: GGTCCAGCCTCTCTTCTCCT; hybridization probe: CCACTCTGGGGCTCGGGATG). Forty cycles were performed with a 15 s denaturation step at 95◦ C followed by a 60 s extension step at 60◦ C. Relative expression (2(40−Ct) ) was determined from analysis of triplicate samples and normalized to the housekeeping gene Actb (β-actin). Amplicons from control PCR reactions were cloned and sequenced from DRG, skeletal muscle or brain to validate that observed products produced the expected gene sequences. Rat skeletal muscle and brain polyA+ RNA were obtained from Clontech (Mountain View, CA).

Statistics Electrophysiology and qRT-PCR results are presented as means ± SEM and statistical significance was determined using two-tailed, unpaired Student’s t tests with GraphPad Prism 5 software (La Jolla, CA) with p < 0.05 denoting statistical significance. DRG neuron classification data were analyzed using SAS 9.1.3 software (Cary, NC) using a chi-square test to evaluate independence and the Cochran–Mantel–Haenszel test to evaluate general association.  C

2015 Amgen Inc.

3

Results Whole-cell patch clamp recordings from rat DRG neurons revealed distinct Nav current profiles. Nav currents were distinguished by TTX inhibition as well as gating kinetics. Fast Nav currents were sensitive to TTX (TTX-S; over 90% of current was inhibited by 500 nM TTX) and activated/inactivated within 5 ms in response to depolarizing pulses yielding maximal inward current (Figure 1A and B). Mixed Nav currents were partially sensitive and partially resistant to TTX (TTX-S and TTX-R; between 10% and 90% of current was inhibited by TTX) and activated/inactivated within 5–30 ms (Figure 1C and D). Slow Nav currents were resistant to TTX (TTX-R; less than 10% of current was inhibited by TTX) and activated/inactivated with time courses longer than 30 ms (Figure 1E and F). Nav current gating kinetics were profiled from ipsilateral (injured) and contralateral (uninjured) L5/L6 DRG neurons 7 to 10 days following SNL, a nerve injury model for neuropathic pain [13]. Recordings were obtained from DRG neurons from rats with tactile sensitivity (ipsilateral von Frey filament threshold 2.1 ± 0.2 g, n = 12; contralateral von Frey filament threshold is around 15 g). Neurons were not selected based on cell size or other visual parameters; in this manner, a random sampling of injured DRG neurons was obtained. From 82 ipsilateral neurons, 69 (84%) contained fast Nav currents, 12 (15%) contained mixed Nav currents and 1 (1%) contained slow Nav currents (Figure 2A). From 109 contralateral neurons, 13 (12%) contained fast Nav currents, 64 (59%) contained mixed Nav currents and 32 (29%) contained slow Nav currents (Figure 2B). For comparison, from 71 na¨ıve neurons obtained from animals that did not undergo SNL surgery, 11 (15%) contained fast Nav currents, 34 (48%) contained mixed Nav currents and 26 (37%) contained slow Nav currents (Figure 2C). Fast Nav currents were seven-fold more abundant and slow Nav currents were nearly thirtyfold less abundant in injured compared to uninjured neurons. In addition, mixed Nav currents were fourfold less abundant in injured neurons. The number of neurons with fast, mixed and slow Nav currents was dependent on and associated with (p < 0.0001) DRG group when comparing contralateral versus ipsilateral or na¨ıve versus ipsilateral neurons. However, the number of neurons with fast, mixed and slow Nav currents was neither dependent on nor associated with (p > 0.05) DRG group when comparing contralateral versus na¨ıve neurons. Cell capacitances of 34.5 ± 2.9 pF (fast), 34.9 ± 1.1 pF (mixed) and 35.3 ± 1.9 pF (slow) for contralateral neurons and 35.7 ± 1.1 pF (fast), 36.9 ± 3.8 pF (mixed) and 33.1 pF (slow) for ipsilateral neurons were not significantly different.

Int J Neurosci Downloaded from informahealthcare.com by University of Victoria on 04/08/15 For personal use only.

4

R. Yin et al.

Figure 1. Classification of Nav currents in DRG neurons. Representative examples of DRG neurons with fast (A), mixed (C), and slow (E) Nav currents. Neurons were held at −80 mV and stepped to +20 mV in 10 mV increments. Representative examples of DRG neurons with tetrodotoxinsensitive (TTX-S; B), tetrodotoxin-sensitive and tetrodotoxin-resistant (TTX-S and TTX-R; D), and tetrodotoxin-resistant (TTX-R; F) Nav currents. Solid lines indicate Nav currents before TTX and dashed lines indicate Nav currents following 500 nM TTX. Neurons were held at −80 mV and stepped to −10 mV.

TTX-S and TTX-R currents were profiled in 23 ipsilateral and 23 contralateral L5/L6 DRG neurons following SNL. Cell capacitance was not different (34.6 ± 2.7 pF in ipsilateral neurons; 31.2 ± 2.6 pF in contralateral neurons; p > 0.05), indicating that a random sampling of DRG neurons was obtained (Figure 3A) and that nerve injury did not induce DRG neuron cell body swelling, consistent with published data [15]. Similarly, total Nav current was not different between groups (4.9 ± 0.8 nA in ipsilateral neurons; 5.6 ± 0.6 nA in contralateral neurons; p > 0.05), indicating that aggregate Nav current amplitudes were not affected (Figure 3B). Consistent with the abundance of neurons

expressing fast Nav currents and the paucity of neurons expressing slow Nav currents detailed above, TTX-S current density was nearly two-fold higher (132.6 ± 18.5 pA/pF in ipsilateral neurons; 75.0 ± 17.7 pA/pF in contralateral neurons; p < 0.05) and TTXR current density was over ten-fold lower (12.2 ± 5.1 pA/pF in ipsilateral neurons; 125.5 ± 20.2 pA/pF in contralateral neurons; p < 0.0001) (Figure 3C and D) in injured compared to uninjured neurons. Correspondingly, the percentage of total Nav current that was sensitive to TTX was over two-fold greater (90.9 ± 2.8% in ipsilateral neurons; 38.0 ± 6.8% in contralateral neurons; p < 0.0001) and the percentage of total Nav International Journal of Neuroscience

Nav phenotypic switch in injured DRG neurons

5

Int J Neurosci Downloaded from informahealthcare.com by University of Victoria on 04/08/15 For personal use only.

(Figure 3G), whereas TTX-R currents were lower in neurons irrespective of capacitance, indicating that neurons of different sizes were affected (Figure 3H). Nav transcript expression was evaluated in 12 ipsilateral and 12 contralateral DRG 7 to 10 days following L5/L6 SNL using qRT-PCR. Tactile sensitivity and transcriptional reprogramming are maximal at this time [16,17]. Gene expression levels were normalized to Actb (β-actin), a housekeeping gene that did not change in injured neurons (Figure 4A). Gal (galanin), a positive control gene that is upregulated in neuropathic pain models [18–20], expression was thirty five-fold higher in ipsilateral DRG, demonstrating successful transcriptional reprogramming following SNL (Figure 4B). Among transcripts encoding TTX-S Nav proteins, Scn1a expression was six-fold lower (Nav1.1; Figure 4C), Scn8a expression was four-fold lower (Nav1.6; Figure 4I) and Scn9a expression was three-fold lower (Nav1.7, Figure 4J) in injured DRG. Scn2a1 (Nav1.2, Figure 4D) and Scn4a (Nav1.4; Figure 4G) were expressed at low levels near assay detection limits. Scn3a (Nav1.3) was the only Nav transcript with higher expression in injured DRG. Using two independent primer sets covering 5 and 3 transcript coding regions (Table 1), Scn3a was expressed four-fold higher in injured DRG (Figure 4E and F). Among transcripts encoding TTX-R Nav proteins, Scn10a (Nav1.8; Figure 4K) expression was twenty-fold lower and Scn11a (Nav1.9; Figure 4L) expression was thirty-fold lower in injured DRG. Scn5a (Nav1.5; Figure 4H) expression approached assay detection limits. The ratio of expression between ipsilateral and contralateral DRG, denoted as fold change, for Nav transcripts above assay detection limits, highlights reduced expression of Scn10a and Scn11a with augmented expression of Scn3a (Figure 5).

Discussion

Figure 2. Frequency of DRG neurons expressing fast, mixed,

and slow Nav currents. The frequency of neurons with different Nav currents in ipsilateral (A), contralateral (B), and na¨ıve (C) DRG neurons following SNL is illustrated. The abundance of neurons expressing fast Nav currents was higher and the abundance of neurons expressing mixed and slow Nav currents was lower in injured neurons. Recordings were obtained from 82 ipsilateral, 109 contralateral neurons, and 71 na¨ıve neurons.

current that was resistant to TTX was nearly seven-fold lower (9.1 ± 2.8% in ipsilateral neurons; 62.0 ± 6.9% in contralateral neurons; p < 0.0001) (Figure 3E and F) in injured compared to uninjured neurons. TTXS currents were higher in neurons with higher capacitance, indicating that larger neurons were most affected  C

2015 Amgen Inc.

Modulation of Nav expression and function may drive ectopic action potential firing and contribute to the development and maintenance of neuropathic pain. Mechanistically, loss of retrograde growth factor trophic support could contribute to the switch in Nav function following nerve injury. Nav gene expression changes induced by removal of nerve growth factor (NGF) mimic those induced by SNL reported here. Rat DRG neurons increased Scn3a and decreased Scn10a expression in the absence of NGF; conversely exogenous NGF reduced Scn3a and increased Scn10a expression [21]. In addition, exogenous NGF administered in vivo increased Nav1.7 and Nav1.8 protein expression in DRG [22]. Substances released locally following nerve injury activate a plethora of intracellular signaling cascades that modulate DRG excitability [23–25]. Protein

R. Yin et al.

Int J Neurosci Downloaded from informahealthcare.com by University of Victoria on 04/08/15 For personal use only.

6

Figure 3. Electrophysiology of DRG neurons following SNL. Capacitance (A), total Nav cur-

rent (B), TTX-S current density (C), TTX-R current density (D), % TTX-S current (E), % TTX-R current (F), TTX-S current as a function of capacitance (G), and TTX-R current as a function of capacitance (H) were measured in 23 ipsilateral and 23 contralateral neurons. Capacitance and total Nav current were not affected. TTX-S currents were higher whereas TTX-R currents were lower in injured neurons. n.s.: not significant.

International Journal of Neuroscience

Int J Neurosci Downloaded from informahealthcare.com by University of Victoria on 04/08/15 For personal use only.

Nav phenotypic switch in injured DRG neurons

Figure 4. Gene expression in DRG following SNL. Expression of Actb (β-actin) was not affected by nerve injury (A). Relative expression of Gal (galanin) (B), Scn1a (C), Scn2a1 (D), Scn3a (TaqMan assay to 5 coding region, (E) in house assay to 3 coding region, (F), Scn4a (G), Scn5a (H), Scn8a (I), Scn9a (J), Scn10a (K), and Scn11a (L) compared to β-actin in ipsilateral and contralateral DRG from 12 rats by qRT-PCR. n.s.: not significant.

 C

2015 Amgen Inc.

7

Int J Neurosci Downloaded from informahealthcare.com by University of Victoria on 04/08/15 For personal use only.

8

R. Yin et al.

Figure 5. Fold change in Nav gene expression in DRG fol-

lowing SNL. Ratio of gene expression in ipsilateral compared to contralateral DRG from 12 rats by qRT-PCR. All changes were statistically significant using a Wilcoxon Signed Rank Test (two-tailed p-value = 0.0005). Scn3a was the only Nav transcript expressed at higher levels in injured DRG. A fold change of 1, indicated by the dashed line, denotes no change in expression. Scn3a (A) - 5 primer set; Scn3a (B) - 3 primer set.

kinase C (PKC) isoforms are activated by bradykinin, prostaglandin E2 and cytokines including TNF-α released following injury [26]. PKC inhibits Nav1.8 and activates Nav1.3 [27,28], which could lead to a higher abundance of TTX-S neurons and lower abundance of TTX-R neurons as observed here. Transcriptional modulation of Nav gene expression following nerve injury has been previously investigated. Scn3a transcripts, expressed at low levels in adult DRG, have been reported to be up-regulated two to sevenfold following axotomy and ligation-based nerve injury models [29–31], consistent with the four-fold higher expression of Scn3a transcripts following SNL reported here. Although we did not measure the level of Nav1.3 protein, due to the inability to identify specific Nav1.3 antibodies that do not cross-react with other Nav family members, Nav1.3 immunoreactivity was reported to increase in rat DRG following nerve injury [32, 33]. Scn10a and Scn11a transcripts were down-regulated up to ten-fold following nerve injury models [30, 31], consistent with the twenty to thirty-fold down-regulation following SNL reported here. Higher expression of Nav1.3 in DRG may support ectopic firing and contribute to hyperexcitability. The biophysical properties of Nav1.3, including rapid recovery from inactivation, and slow development of closed-state inactivation, could sustain highfrequency action potential firing following nerve injury [34]. TTX-S currents reprimed four-fold faster in rat DRG neurons following sciatic nerve axotomy [32,

35], indicating up-regulation of a TTX-S channel with electrophysiological properties resembling Nav1.3. We were unable to identify a reagent that specifically inhibited rat Nav1.3 but not other TTX-S channels in DRG neurons; thus, the association between higher Nav1.3 transcript abundance and higher TTX-S neuron abundance remains correlative and not causal. Higher TTX-S currents may not be due, entirely, to Nav1.3 function. Transcripts coding for other TTX-S channels, including Scn9a (Nav1.7), likely comprise functionally significant populations. Decreased expression of other TTX-S transcripts despite larger TTX-S currents warrants further investigation. In addition to mRNA abundance, mRNA stability, translational efficiency, protein half-life, post-translational modifications by protein kinases such as PKC, which can activate Nav1.3, and accessory proteins can dictate the functional contribution of individual Nav proteins to macroscopic TTX-S currents [28, 36, 37]. Collectively, these factors may explain why similar total Nav currents were observed in ipsilateral and contralateral neurons despite significant down-regulation of many Nav transcripts. We observed, for the first time, an increase in the magnitude of TTX-S currents in larger neurons following nerve injury. This novel finding contrasts previous studies that focused only on small diameter DRG neurons where increases in TTX-S current size were not reported [30–32, 35, 38]. Unlike TTX-S currents, TTX-R currents (comprising slowly inactivating Nav1.8 and persistent Nav1.9 currents) decreased following nerve injury [30, 31, 35, 38]. In uninjured DRG neurons, TTX-S Nav currents contribute to the initial depolarization of action potentials whereas TTX-R Nav currents, stemming from Nav1.8 function, carry the majority of inward current during spiking [39,40]. Following nerve injury, higher TTX-S currents may offset lower TTX-R currents and drive membrane potentials above requisite thresholds to initiate action potentials. Unlike L5 DRG neurons, TTX-R currents and Nav1.8 expression increased in uninjured L4 DRG neurons [41] and Nav1.8 immunoreactivity increased in sciatic nerve in rat SNL studies [42]. These changes alone or in combination with altered expression and function of other proteins, such as potassium channels important in setting or repolarizing the membrane potential, could contribute to ectopic firing [17]. The SNL model is reported to induce ectopic firing in afferent fibers from both large diameter and small diameter DRG neurons [43]. Single cell RT-PCR and in situ hybridization studies demonstrated that Nav transcripts are expressed differentially in large diameter neurons (Nav1.1, Nav1.6 and Nav1.7) and small diameter neurons (Nav1.7, Nav1.8, Nav1.9) [44–46]. Using histological methods, Nav1.3 was expressed in roughly 6% of DRG neurons prior to nerve injury compared to 37% International Journal of Neuroscience

Int J Neurosci Downloaded from informahealthcare.com by University of Victoria on 04/08/15 For personal use only.

Nav phenotypic switch in injured DRG neurons

of small diameter and 50% of large diameter neurons after SNL, indicating preferential up regulation in larger neurons [33, 44]. Taken together with the higher functional expression of TTX-S currents in larger neurons reported here, we propose that TTX-S currents, stemming in part from Nav1.3 channels, contribute to ectopic firing in injured, large diameter DRG neurons. Additional studies using knockdown approaches could further evaluate the necessity of Nav1.3 channels for these endpoints [47]. Cell ablation experiments in rodents revealed that thermal hyperalgesia, a proposed correlate of spontaneous or burning pain in humans, is mediated by small to medium diameter DRG neurons expressing the thermosensitive channel TRPV1, whereas tactile sensitivity is mediated by larger diameter DRG neurons expressing the neuropeptide NPY but not TRPV1 [48–51]. In humans, desensitization of afferent fibers with capsaicin, an agonist of TRPV1, increased warmth threshold and decreased neuropathic pain, whereas inhibition of larger diameter fibers using compression nerve block modulated tactile sensitivity [52,53]. Thus, smaller diameter DRG neurons encompass neuron populations that function as thermoceptors and nociceptors, whereas larger diameter DRG neurons encompass neuron populations that function as touch sensors. Increased firing of larger diameter DRG neurons may promote tactile sensitivity, while increased firing of smaller diameter DRG neurons may promote thermal hyperalgesia or spontaneous burning pain. Transcriptional modulation of neurotransmitter expression in larger diameter neurons that synapse onto dorsal horn spinal cord projection neurons may explain, in part, how touch could be perceived as pain [43]. Identification of the specific cell type(s) expressing Nav1.3 in injured DRG neurons is an important next step in elucidating the functional contribution of Nav1.3-positive neurons to pain. The role of Nav1.3 in the development and maintenance of neuropathic pain in humans is uncertain. In humans, Nav1.3 is not currently genetically linked to any disease causing gain or loss of pain. Nav1.3 immunoreactivity was more abundant in painful neuroma tissue [54], and Nav1.3 mRNA was more abundant in gingival tissue from trigeminal neuralgia patients compared to healthy controls [55]. In rats, administration of intrathecal Nav1.3 antisense oligodeoxynucleotides attenuated mechanical allodynia and thermal hyperalgesia after T9 spinal cord contusion injury [56], but did not affect mechanical or cold allodynia in spared nerve injury [57]. In genetically engineered Nav1.3 knockout mice, where the Nav1.3 gene was inactivated in all neurons or selectively in Nav1.8 expressing neurons, no deficiency in pain behavior was observed following SNL [58]. Compensatory changes in the expression of other Nav family members may account, in part, for the  C

2015 Amgen Inc.

9

absence of an observed phenotype. In Nav1.8 knockout mice, for example, increased Nav1.7 mRNA and TTX-S currents were reported [59]. In the absence of a defined human genetic link to pain, interrogation of the relevance of Nav1.3 to human pain awaits development and testing of Nav1.3 specific antagonists in clinical trials.

Conclusions In the rat SNL model, DRG neurons were found to undergo a phenotypic switch from housing slowly inactivating and TTX-resistant channels to rapidly inactivating and TTX-sensitive channels, with higher expression of Scn3a (Nav1.3) and lower expression of Scn10a (Nav1.8) as well as Scn11a (Nav1.9) compared to uninjured neurons. These data highlight Nav1.3 as a target expressed in injured DRG neurons and implicate transcriptional reprogramming of Nav genes in neuropathic pain.

Acknowledgements The authors thank Michael Eschenberg for assistance with statistical analyses as well as Narender Gavva, Todd Juan, Joe Ligutti, Jeff McDermott, Stefan McDonough, James Treanor, Shanti Amagasu, Zaven Kaprielian, and Ken Wild for critical review of the manuscript.

Declaration of Interest All authors were full time employees of Amgen during the entire process of conceiving the project, generating data, and writing the manuscript. Amgen purchased equipment and supplies used in this research study. The authors alone are responsible for the content and writing of the article.

References 1. Treede RD, Jensen TS, Campbell JN, et al. Neuropathic pain: redefinition and a grading system for clinical and research purposes. Neurology 2008;70(18):1630–5. 2. Chen H, Lamer TJ, Rho RH, et al. Contemporary management of neuropathic pain for the primary care physician. Mayo Clin Proc 2004;79(12):1533–45. 3. Backonja MM, Irving G, Argoff C. Rational multidrug therapy in the treatment of neuropathic pain. Curr Pain Headache Rep 2006;10(1):34–8. 4. Finnerup NB, Otto M, McQuay HJ, et al. Algorithm for neuropathic pain treatment: an evidence based proposal. Pain 2005;118(3):289–305. 5. Berger JV, Knaepen L, Janssen SP, et al. Cellular and molecular insights into neuropathy-induced pain hypersensitivity for mechanism-based treatment approaches. Brain Res Rev 2011;67(1–2):282–310.

Int J Neurosci Downloaded from informahealthcare.com by University of Victoria on 04/08/15 For personal use only.

10

R. Yin et al.

6. Latremoliere A, Woolf CJ. Central sensitization: a generator of pain hypersensitivity by central neural plasticity. J Pain 2009;10(9):895–926. 7. Perkins JR, Antunes-Martins A, Calvo M, et al. A comparison of RNA-seq and exon arrays for whole genome transcription profiling of the L5 spinal nerve transection model of neuropathic pain in the rat. Molecular Pain 2014;10:7. doi:10.1186/17448069-10-7. 8. Ogata N, Ohishi Y. Molecular diversity of structure and function of the voltage-gated Na+ channels. Jpn J Pharmacol 2002;88(4):365–77. 9. Cohen CJ. Targeting voltage-gated sodium channels for treating neuropathic and inflammatory pain. Curr Pharm Biotechnol 2011;12(10):1715–9. 10. Bhattacharya A, Wickenden AD, Chaplan SR. Sodium channel blockers for the treatment of neuropathic pain. Neurotherapeutics 2009;6(4):663–78. 11. Kehlet H, Jensen TS, Woolf CJ. Persistent postsurgical pain: risk factors and prevention. Lancet 2006;367(9522): 1618–25. 12. Rasmussen S, Kehlet H. Management of nerves during leg amputation–a neglected area in our understanding of the pathogenesis of phantom limb pain. Acta Anaesthesiol Scand 2007;51(8):1115–6. 13. Kim SH, Chung JM. An experimental model for peripheral neuropathy produced by segmental spinal nerve ligation in the rat. Pain 1992;50(3):355–63. 14. Chaplan SR, Bach FW, Pogrel JW, et al. Quantitative assessment of tactile allodynia in the rat paw. J Neurosci Methods 1994;53(1):55–63. 15. Nitzan-Luques A, Devor M, Tal M. Genotype-selective phenotypic switch in primary afferent neurons contributes to neuropathic pain. Pain 2011;152(10):2413–26. 16. Bennett GJ, Chung JM, Honore M, Seltzer Z. Models of neuropathic pain in the rat. Curr Protoc Neurosci 2003; Chapter 9: Unit 9.14. pages 9.14.1–9.14.16. 17. Costigan M, Belfer I, Griffin RS, et al. Multiple chronic pain states are associated with a common amino acid-changing allele in KCNS1. Brain 2010;133(9):2519–27. 18. Maratou K, Wallace VC, Hasnie FS, et al. Comparison of dorsal root ganglion gene expression in rat models of traumatic and HIV-associated neuropathic pain. Eur J Pain 2009; 13(4):387–98. 19. Vega-Avelaira D, Geranton SM, Fitzgerald M. Differential regulation of immune responses and macrophage/neuron interactions in the dorsal root ganglion in young and adult rats following nerve injury. Molecular Pain 2014;10;5:70. doi: 10.1186/1744-8069-5-70. 20. Hammer P, Banck MS, Amberg R, et al. mRNA-seq with agnostic splice site discovery for nervous system transcriptomics tested in chronic pain. Genome Res 2010;20(6):847–60. 21. Black JA, Langworthy K, Hinson AW, et al. NGF has opposing effects on Na+ channel III and SNS gene expression in spinal sensory neurons. Neuroreport 1997;8(9–10):2331–5. 22. Gould HJ, 3rd, Gould TN, England JD, et al. A possible role for nerve growth factor in the augmentation of sodium channels in models of chronic pain. Brain Res 2000;854(1–2):19–29. 23. Nicol GD, Vasko MR. Unraveling the story of NGF-mediated sensitization of nociceptive sensory neurons: ON or OFF the Trks? Mol Interv 2007;7(1):26–41. 24. Huang EJ, Reichardt LF. Trk receptors: roles in neuronal signal transduction. Annu Rev Biochem 2003;72:609–42. 25. Chen X, Pang RP, Shen KF, et al. TNF-alpha enhances the currents of voltage gated sodium channels in uninjured dorsal root ganglion neurons following motor nerve injury. Exp Neurol 2011 ;227(2):279–86.

26. Velazquez KT, Mohammad H, Sweitzer SM. Protein kinase C in pain: involvement of multiple isoforms. Pharmacol Res 2007;55(6):578–89. 27. Vijayaragavan K, Boutjdir M, Chahine M. Modulation of Nav1.7 and Nav1.8 peripheral nerve sodium channels by protein kinase A and protein kinase C. J Neurophysiol 2004;91(4):1556–69. 28. Mo G, Grant R, O’Donnell D, et al. Neuropathic Nav1.3mediated sensitization to P2X activation is regulated by protein kinase C. Molecular Pain 2011;7:14. doi: 10.1186/1744-80697-14. 29. Waxman SG, Kocsis JD, Black JA. Type III sodium channel mRNA is expressed in embryonic but not adult spinal sensory neurons, and is reexpressed following axotomy. J Neurophysiol 1994;72(1):466–70. 30. Dib-Hajj SD, Fjell J, Cummins TR, et al. Plasticity of sodium channel expression in DRG neurons in the chronic constriction injury model of neuropathic pain. Pain 1999;83(3):591–600. 31. Berta T, Poirot O, Pertin M, et al. Transcriptional and functional profiles of voltage-gated Na(+) channels in injured and non-injured DRG neurons in the SNI model of neuropathic pain. Mol Cell Neurosci 2008;37(2):196–208. 32. Black JA, Cummins TR, Plumpton C, et al. Upregulation of a silent sodium channel after peripheral, but not central, nerve injury in DRG neurons. J Neurophysiol 1999;82(5):2776–85. 33. Kim CH, Oh Y, Chung JM, Chung K. The changes in expression of three subtypes of TTX sensitive sodium channels in sensory neurons after spinal nerve ligation. Brain Res Mol Brain Res 2001;95(1–2):153–61. 34. Cummins TR, Aglieco F, Renganathan M, et al. Nav1.3 sodium channels: rapid repriming and slow closed-state inactivation display quantitative differences after expression in a mammalian cell line and in spinal sensory neurons. J Neurosci 2001; 21(16):5952–61. 35. Cummins TR, Waxman SG. Downregulation of tetrodotoxinresistant sodium currents and upregulation of a rapidly repriming tetrodotoxin-sensitive sodium current in small spinal sensory neurons after nerve injury. J Neurosci 1997;17(10): 3503–14. 36. John VH, Main MJ, Powell AJ, et al. Heterologous expression and functional analysis of rat Nav1.8 (SNS) voltage-gated sodium channels in the dorsal root ganglion neuroblastoma cell line ND7–23. Neuropharmacology 2004;46(3):425–38. 37. Swanwick RS, Pristera A, Okuse K. The trafficking of Na(V)1.8. Neurosci Lett 2010;486(2):78–83. 38. Sleeper AA, Cummins TR, Dib-Hajj SD, et al. Changes in expression of two tetrodotoxin-resistant sodium channels and their currents in dorsal root ganglion neurons after sciatic nerve injury but not rhizotomy. J Neurosci 2000;20(19):7279–89. 39. Renganathan M, Cummins TR, Waxman SG. Contribution of Na(v)1.8 sodium channels to action potential electrogenesis in DRG neurons. J Neurophysiol 2001;86(2):629–40. 40. Blair NT, Bean BP. Roles of tetrodotoxin (TTX)-sensitive Na+ current, TTX-resistant Na+ current, and Ca2+ current in the action potentials of nociceptive sensory neurons. J Neurosci 2002;22(23):10277–90. 41. Zhang XF, Zhu CZ, Thimmapaya R, et al. Differential action potentials and firing patterns in injured and uninjured small dorsal root ganglion neurons after nerve injury. Brain Res 2004;1009(1–2):147–58. 42. Gold MS, Weinreich D, Kim CS, et al. Redistribution of Na(V)1.8 in uninjured axons enables neuropathic pain. J Neurosci 2003;23(1):158–66. 43. Devor M. Ectopic discharge in Abeta afferents as a source of neuropathic pain. Exp Brain Res 2009;196(1):115–28.

International Journal of Neuroscience

Int J Neurosci Downloaded from informahealthcare.com by University of Victoria on 04/08/15 For personal use only.

Nav phenotypic switch in injured DRG neurons 44. Fukuoka T, Kobayashi K, Yamanaka H, et al. Comparative study of the distribution of the alpha-subunits of voltagegated sodium channels in normal and axotomized rat dorsal root ganglion neurons. J Comp Neurol 2008;510(2): 188–206. 45. Fukuoka T, Noguchi K. Comparative study of voltage-gated sodium channel alpha-subunits in non-overlapping four neuronal populations in the rat dorsal root ganglion. Neurosci Res 2011;70(2):164–71. 46. Ho C, O’Leary ME. Single-cell analysis of sodium channel expression in dorsal root ganglion neurons. Mol Cell Neurosci 2011;46(1):159–66. 47. Samad OA, Tan AM, Cheng X, et al. Virus-mediated shRNA knockdown of Na(v)1.3 in rat dorsal root ganglion attenuates nerve injury-induced neuropathic pain. Mol Ther 2013;21 (1):49–56. 48. King T, Qu C, Okun A, et al. Contribution of afferent pathways to nerve injury-induced spontaneous pain and evoked hypersensitivity. Pain 2011;152(9):1997–2005. 49. Ossipov MH, Bian D, Malan TP, Jr., et al. Lack of involvement of capsaicin-sensitive primary afferents in nerve-ligation injury induced tactile allodynia in rats. Pain 1999;79(2–3): 127–33. 50. Shir Y, Seltzer Z. A-fibers mediate mechanical hyperesthesia and allodynia and C-fibers mediate thermal hyperalgesia in a new model of causalgiform pain disorders in rats. Neurosci Lett 1990;115(1):62–7. 51. Braz JM, Basbaum AI. Triggering genetically-expressed transneuronal tracers by peripheral axotomy reveals convergent

 C

2015 Amgen Inc.

52.

53.

54.

55.

56.

57.

58.

59.

11

and segregated sensory neuron-spinal cord connectivity. Neuroscience 2009;163(4):1220–32. Landerholm AH, Hansson PT. Mechanisms of dynamic mechanical allodynia and dysesthesia in patients with peripheral and central neuropathic pain. Eur J Pain 2011;15(5):498–503. Noto C, Pappagallo M, Szallasi A. NGX-4010, a highconcentration capsaicin dermal patch for lasting relief of peripheral neuropathic pain. Curr Opin Investig Drugs 2009;10(7): 702–10. Black JA, Nikolajsen L, Kroner K, et al. Multiple sodium channel isoforms and mitogen-activated protein kinases are present in painful human neuromas. Ann Neurol 2008;64(6):644–53. Siqueira SR, Alves B, Malpartida HM, et al. Abnormal expression of voltage-gated sodium channels Nav1.7, Nav1.3 and Nav1.8 in trigeminal neuralgia. Neuroscience 2009;164 (2):573–7. Hains BC, Klein JP, Saab CY, et al. Upregulation of sodium channel Nav1.3 and functional involvement in neuronal hyperexcitability associated with central neuropathic pain after spinal cord injury. J Neurosci 2003;23(26):8881–92. Lindia JA, Kohler MG, Martin WJ, Abbadie C. Relationship between sodium channel NaV1.3 expression and neuropathic pain behavior in rats. Pain 2005;117(1–2):145–53. Nassar MA, Baker MD, Levato A, et al. Nerve injury induces robust allodynia and ectopic discharges in Nav1.3 null mutant mice. Molecular Pain 2006;2:33. doi:10.1186/1744-8069-2-33. Akopian AN, Souslova V, England S, et al. The tetrodotoxinresistant sodium channel SNS has a specialized function in pain pathways. Nat Neurosci 1999;2(6):541–8.