The FASEB Journal • Research Communication

Wilms’ tumor 1 (Wt1) regulates pleural mesothelial cell plasticity and transition into myofibroblasts in idiopathic pulmonary fibrosis Suman Karki,*,1 Ranu Surolia,*,1 Thomas David Hock,* Purusotham Guroji,* Jason S. Zolak,† Ryan Duggal,* Tong Ye,† Victor J. Thannickal,* and Veena B. Antony*,2 *Department of Medicine, Division of Pulmonary and Critical Care, and †Department of Neurobiology, University of Alabama at Birmingham, Birmingham, Alabama, USA Pleural mesothelial cells (PMCs), which are derived from the mesoderm, exhibit an extraordinary capacity to undergo phenotypic changes during development and disease. PMC transformation and trafficking has a newly defined role in idiopathic pulmonary fibrosis (IPF); however, the contribution of Wilms’ tumor 1 (Wt1)-positive PMCs to the generation of pathognomonic myofibroblasts remains unclear. PMCs were obtained from IPF lung explants and healthy donor lungs that were not used for transplantation. Short hairpin Wt1-knockdown PMCs (sh Wt1) were generated with Wt1 shRNA, and morphologic and functional assays were performed in vitro. Loss of Wt1 abrogated the PMC phenotype and showed evidence of mesothelial-to-mesenchymal transition (MMT), with a reduced expression of E-cadherin and an increase in the profibrotic markers ␣-smooth muscle actin (␣-SMA) and fibronectin, along with increased migration and contractility, compared with that of the control. Migration of PMCs in response to active transforming growth factor (TGF)-␤1 was assessed by live-cell imaging with 2-photon microscopy and 3D imaging, of Wt1-EGFP transgenic mice. Lineage-tracing experiments to map the fate of Wt1ⴙ PMCs in mouse lung in response to TGF-␤1 were also performed by using a Cre-loxP system. Our results, for the first time, demonstrate that Wt1 is necessary for the morphologic integrity of pleural membrane and that loss of Wt1 contributes to IPF via MMT of PMCs into a myofibroblast phenotype.—Karki, S., Surolia, R., Hock, T. D., Guroji, P., Zolak, J. S., Duggal, R., Ye, T., Thannickal, V., J., Antony, V. B. Wilms’ tumor 1 (Wt1) regulates pleural mesothelial cell plasticity and transition into myofibroblasts in idiopathic pulmonary fibrosis. FASEB J. 28, 1122–1131 (2014). www.fasebj.org ABSTRACT

Key Words: mesothelial-to-mesenchymal transition 䡠 smooth muscle actin 䡠 matrix remodeling Abbreviations: 3D, 3-dimensional; ␤-gal, ␤-galactosidase; DAPI, 4=-6-diamidino-2-phenylindole; ECM, extracellular matrix; EMT, epithelial-to-mesenchymal transition; EV, empty vector; IPF, idiopathic pulmonary fibrosis; MMT, mesothelialto-mesenchymal transition; PMC, pleural mesothelial cell; shRNA, short hairpin RNA; TAM, tamoxifen; TGF-␤1, transforming growth factor ␤1; Wt1, Wilms’ tumor 1 1122

Idiopathic pulmonary fibrosis (IPF) is a rapidly progressive fibrotic disease of unknown etiology with a median survival of 3–5 yr (1). Fibrotic remodeling in IPF, in its earliest clinical and radiographic presentations, is localized to the distal subpleural regions and progresses proximally into the lung parenchyma. Fibrogenesis is thought to be mediated by mesenchymal cell proliferation and the transdifferentiation of progenitor cells into myofibroblasts, which are key effector cells in the excessive production of collagenous extracellular matrix (ECM; ref. 2– 4). High-resolution computed tomography (5) and 3-dimensional (3D) morphometric analysis (6) of the IPF lung suggest an interconnected reticulum extending from the pleura into the underlying parenchyma. The pleural mesothelium is a highly plastic monolayer of mesoderm-derived pleural mesothelial cells (PMCs) that line the visceral and parietal pleural surfaces. The embryonic mesoderm plays a critical role in lung-branching morphogenesis, vasculogenesis, and alveologenesis, the latter involving septation by alveolar fibroblasts (7). PMCs have the capacity to differentiate into adipocytes, endothelial cells, and osteoblasts, suggesting remarkable and unexpected plasticity (4). The origins of the pathologic myofibroblasts in IPF remain unidentified. In addition to proliferation and differentiation of resident lung fibroblasts and transition of circulating progenitors into myofibroblasts, studies suggest a role for epithelial-to-mesenchymal transition (EMT) as an alternate mechanism for the generation of myofibroblasts in lung parenchyma (8 – 10), although other studies appear to contradict this possibility in injury-provoked lung fibrosis (11). We have recently demonstrated the differentiation of PMCs into myofibroblasts in response to transforming growth factor (TGF)-␤1 in a process known as mesothelial-to mesenchymal-transition (MMT) (12, 13). The pleural mesothelium may function as a “sensor” for airway– 1

These authors contributed equally to this work. Correspondence: Department of Medicine, University of Alabama at Birmingham, AL 35294, USA; E-mail: vantony@ uab.edu doi: 10.1096/fj.13-236828 This article includes supplemental data. Please visit http:// www.fasebj.org to obtain this information. 2

0892-6638/14/0028-1122 © FASEB

alveolar injury by mobilizing reparative cells in a process that replicates features of embryonic development (14 –18). Recent in vivo studies have defined the role of MMT in liver, kidney, and lung fibroses (19). These and similar observations support an active role for MMT in contributing to lung fibrogenesis. Wilms’ tumor 1 (Wt1)– expressing cells, including PMCs, have the capacity to switch between a mesenchymal and epithelial state (20). An emerging theme in the analysis of Wt1 function during normal development and adult tissue homeostasis is the balance between the epithelial and mesenchymal states of cells (21). Thus, the role of Wt1 in MMT during lung fibrogenesis and its role in the transdifferentiation of PMCs to myofibroblasts should be studied. In the present study, we examined the role of Wt1 in the maintenance of morphologic homeostasis of the pleural mesothelial monolayer and, for the first time, report that loss of Wt1 initiated MMT of lung PMCs, leading to their migration into the lung parenchyma and thus contributing to lung fibrosis. We also found that Wt1 in human PMCs was necessary for maintenance of the PMC phenotype and that loss of Wt1 promoted MMT, transforming the PMCs into an invasive myofibroblast-like phenotype with enhanced migration and increased contractility.

MATERIALS AND METHODS Isolation of control and IPF PMCs from lung explants Lung tissue samples were obtained from the University of Alabama Birmingham (UAB) Tissue Procurement and Cell Culture Core. PMCs obtained from lung explants (n⫽6) of patients with IPF who were undergoing lung transplantation at the UAB Hospital were described as IPF PMCs. Control PMCs were obtained from donor lungs (n⫽3) that were not used as transplants. The PMCs were isolated and cultured according to published methods (12, 22). All human experimental protocols were approved by the UAB Institutional Review Board. Generation of Wt1-knockdown cells Human mesothelial cells (ATCC CRL-9444) were obtained from American Type Culture Collection (ATCC; Manassas, VA, USA) and were transfected with a Wt1 short hairpin RNA (shRNA) plasmid, targeted against human Wt1, and a scrambled control plasmid and empty vector (EV; Origene, Rockville, MD, USA) using Lipofectamine 2000 (Life Technologies, Rockville, MD, USA), to generate Wt1-knockdown (sh Wt1), scrambled negative control (sh control), and shEV cells. The sequences of the Wt1shRNA plasmids were GGAGACATACAGGTGTGAAACCATTCCAG, TGACCTGGAATCAGATGAACTTAGGAGGC, GCAGGAAGCACACTGGTGAGAAACCATAC, and ATACACACGCACGGTGTCTTCAGAGGCAT. According to the manufacturer’s recommendation, 70–80% confluent control PMCs were transfected with shRNA plasmids in the presence of Lipofectamine 2000. After 72 h, the transected cells were selected by supplementing the medium with 2 ␮g/ml of puromycin (A11138-03; Life Technologies). The initial efficiency of transfection was ⬃30%. Since the plasmids vectors also expressed RFP, positive cells were sorted by FACS to obtain strongly RFP⫹ cells, and those were used for further functional assays. The 3D culture of the FACS-sorted sh control and

sh Wt1 cells was performed as described elsewhere (23). Briefly, 5000 cells were seeded in 8-well glass chamber slides (Lab-Tek 154941; Nunc, Roskilde, Denmark) in medium 199 containing 2% growth factor-reduced Matrigel (BD 354230; BD Biosciences, San Diego, CA, USA), and morphology of the cells was imaged using an immunofluorescence microscope (Axiovert 100M; Zeiss, Thornwood, NY, USA). Mice Wt1tm1EGFP/Cre)wtp/J (Jax 010911), Wt1Tm2(Cre/ERT2)Wtp/J (Jax 010912), and B6.129S4-Gt(ROSA)26Sortm1Sor/J (Jax 003309) were obtained from The Jackson Laboratory (Bar Harbor, ME, USA). Wt1Tm2(Cre/ERT2)Wtp/J and B6.129S4-Gt(ROSA)26Sortm1Sor/J were crossed to obtain floxed mice (indicated as ERT2xROSA). Tamoxifen (TAM; H7904; Sigma-Aldrich, St. Louis, MO, USA) dissolved in ethanol was emulsified in sunflower oil (W530285; Sigma-Aldrich) at 20 mg/ml, and 4 mg was administered to 4- to 6-wk-old ERT2xROSA mice for 3 d for activation of Cre (24). The mice were euthanized, and lung sections were prepared (25) and stained for ␤-galactosidase (␤-gal) and ␣-SMA, as described herein. All the animal experimental protocols were approved by the Institutional Animal Care and Usage Committee (IACUC) of UAB. Protein isolation and Western blot analysis Total cell lysates were prepared as described elsewhere (22). Proteins were resolved in denaturing sodium dodecyl sulfate (SDS) 4 –15% polyacrylamide gels (Bio-Rad, Hercules, CA, USA) and were electrically transferred onto polyvinylidene difluoride membrane (Immobilon-P; Millipore, Bedford, MA, USA) in transfer buffer containing 25 mM Tris, 192 mM glycine, and 20% methanol (v/v). Nonspecific binding to the membrane was blocked at room temperature for 1 h with 5% nonfat milk (0.9% NaCl, 10 mM Tris base, and 0.1% Tween 20). The following primary antibodies were used: anti-Wt1 (1:1000; SC-192), anti-␣-SMA (1:2000, SC-130616), and antiE-cadherin (1:500; SC-7870) (Santa Cruz Biotechnology, Santa Cruz, CA, USA); anti-Smad2/3 (1:1000; 3102) and anti-phospho-Smad2 (1:1000; 3101) (Cell Signaling, Danvers, MA, USA); and anti-fibronectin IST4 (1:1000; 011M4759; Sigma-Aldrich), incubated for overnight at 4°C. After they were washed, the membranes were incubated with the secondary antibody (horseradish peroxidase– conjugated anti-mouse or anti-rabbit IgG antibody; Sigma-Aldrich) at a dilution of 1:5000 for 1 h at room temperature. The target proteins were detected by enhanced chemiluminescence (ECL; Pierce, Rockford, IL, USA). Prestained protein marker (161– 0375; Bio-Rad) was included for molecular mass determination. RNA isolation and qRT-PCR Total RNA was isolated with a commercial kit (RNeasy Mini Kit; Qiagen, Valencia, CA, USA) from control lung PMCs. cDNA was prepared with SuperScript III First-Strand Synthesis System (18080-051; Life Technologies), according to the manufacturer’s recommendations. qRT-PCR was performed with Power Syber Green PCR Master Mix (4367659; Life TechnologiesApplied Biosystems, Foster City, CA, USA) on a StepOnePlus Real Time PCR system (Life Technologies-Applied Biosystems) for Wt1 and ␣-SMA and compared with the expression of ␤-actin. The sequences for human Wt1 and ␣-SMA and ␤-actin were Wt1 forward, 5=-CAGGTCATGCATTCAAGCTG-3=, reverse 5=-AGGCTTTGCTGCTGAGGA; ␣-SMA forward, 5=-GACCGAATGCAGAAGGAGAT, reverse 5=-CCACCGATCCAGACAGAGTA-3=; and ␤-actin, forward 5=-TGCTATCCATGTGCTAT3=, reverse 5=-AGTCCATCACGATGCCAGT-3=.

LOSS OF WT1 IN PMCS LEADS TO MMT AND CONTRIBUTES TO FIBROSIS

1123

Collagen gel contraction assay Gel contraction assays were performed as described previously (22). Briefly, rat tail type I collagen (BD 354236; BD Biosciences) at a concentration of 1.5 mg/ml was used for the gel-contraction assay. After neutralization with 1 N NaOH, the appropriate volume of cell suspension in serum-free medium was gently mixed into the collagen solution. The gel (500 ␮l) was seeded at 2 ⫻ 106 cells/ml of control, sh control, sh Wt1, and IPF PMCs, in 24-well plates. Collagen solution was placed into culture wells and allowed to polymerize at 37°C and 5% CO2 for 1 h. Medium (500 ␮l) was added, and the gels were released from the sides of the wells. After an additional 16 h of culture, 500 ␮l serum-free medium with or without TGF-␤1 (R&D Systems, Minneapolis, MN, USA) was added. After 48 h of incubation, the gel area was determined by image processing of the gel photographs with Photoshop CS4 (Adobe Systems, San Jose, CA, USA), and contraction was delineated by ImageJ software (U.S. National Institutes of Health, Bethesda, MD, USA). Cell migration assay A haptotaxis assay was performed as described elsewhere (22). Briefly, the lower sides of the Costar Transwell migration chambers (Corning Life Sciences, Corning, NY, USA) were coated with TGF-␤1 or were left untreated and incubated overnight at 37°C in humidified air in the presence of 5% CO2. The filters were removed, washed with PBS, air dried, and placed into 48-well plates. The bottom portion of the chamber was filled with Medium 199 (Life TechnologiesInvitrogen, San Diego, CA) with 1% fetal bovine serum. Control, sh control, sh Wt1, and IPF PMCs (1⫻105 cells), with or without TGF-␤1, were seeded into the top chamber and incubated for 6 h at 37°C. At the end of incubation, the medium from the top well was discarded. The top sides of the filters were scraped to remove the adherent cells. The cells on the bottom side of the filters were then fixed in formalin and stained with 20% Giemsa (48900; Fluka, Buchs, Switzerland). Migration was quantified by counting the number of cells on the distal surface of the filter under an optical microscope. The results are expressed as the haptotactic index: the number of cells visualized per 20 high-power (⫻40) fields. Immunostaining Immunohistochemistry of IPF lung explant tissue was performed (22) for Wt1 and calretinin (Santa Cruz Biotechnology). We analyzed the expression of mesenchymal markers in differentiated myofibroblast-like PMCs by immunofluorescence (12) and stained the tissue with anti-E-cadherin (Santa Cruz Biotechnology), anti-␣-SMA (Santa Cruz Biotechnology), and fibronectin IST9 (Sigma-Aldrich), at 1:150 dilution, and then with the respective secondary antibody Alexa Fluor 488 goat anti-rabbit IgG (H⫹L) (Molecular Probes, Eugene, OR, USA). Nuclei were stained with 4=,6-diamidino-2-phenylindole (DAPI) (Vectashield; Vector Laboratories, Burlingame, CA, USA) and observed under an immunofluorescence microscope. For tracking the TGF-␤1-induced migration of PMCs, cryosections of ERT2xROSA mouse lung were also stained for ␤-gal (Abcam, Cambridge, MA, USA) and ␣-SMA (Santa Cruz Biotechnology). Imaging of lung sections Active TGF-␤1 (75 ng) was administered to Wt1tm1EGFP/Cre)wtp/ J mice and PBS to the control mice via the intranasal route (26). After 4 h, the mice were euthanized. The agarose-filled 1124

Vol. 28

March 2014

sections for live imaging were then prepared (27). Briefly, the lungs were filled with 1 ml of 2% agarose (at 37°C), with a 24-gauge catheter and placed in RPMI medium, without phenol red, at room temperature. The agarose-filled lung lobes were cut into 300 ␮m sections on a vibratome (VT100s; Leica, Bannockburn, IL, USA). The live tissue sections were then set up on a perfusion system and imaged under a 2-photon excitation fluorescence laser scanning microscope (Prairie Technologies, Middleton, WI, USA), which is equipped with an ultrafast, mode-locked, Ti:sapphire laser (Chameleon; Coherent Inc., Santa Clara, CA, USA) for 2-photon excited fluorescence imaging, at the Neuroimaging Core at UAB. A high-sensitivity photomultiplier tube (PMT, H7422P; Hamamatsu Photonics, Hamamatsu City, Japan) was used for fluorescence recording. During the recording, the ultrafast laser was tuned to 920 nm for the excitation of EGFP fluorescence. A typical imaging frame (512⫻512 pixels) period used in the experiments was ⬃6.8 s, which corresponded to a 25.2 ␮s pixel dwell time (i.e., laser exposure time of each pixel). Three-dimensional images were acquired by collecting a Z stack of sections, which were analyzed and interpreted by using IMARIS software (Bitplane, Zurich, Switzerland). Statistical analysis Data analyses were performed with SigmaStat 3.5 (Systat Software, San Jose, CA, USA). Results are expressed as means ⫾ se. All values were derived from ⱖ3 independent experiments. Student’s t test was used for the comparison of control and TGF-␤1 treatment groups. Differences were considered significant at values of P ⬍ 0.05.

RESULTS Human PMCs express Wt1 We compared the expression of Wt1 in control PMCs with that in PMCs and myofibroblasts from lung explants of patients with IPF. Western blot analysis of the representative samples showed negligible expression of Wt1 in the IPF PMCs, compared to that in control lung tissue. The fibroblasts, however, did not show expression of Wt1 (Fig. 1A). Analysis of relative Wt1 mRNA expression in these samples showed a pattern similar to that of Western blot analysis. The IPF PMCs showed a 2.6-fold decrease in mRNA levels (Fig. 1B). Immunohistochemistry of IPF lung explants for Wt1 not only demonstrated expression in the pleura but also in the parenchyma of the lung tissue sections (Fig. 1C). A similar staining pattern was also observed for calretinin, a characteristic marker of PMCs (Fig. 1D). TGF-␤1 down-regulates Wt1 expression in PMCs Next, we addressed whether TGF-␤1 affects Wt1 expression in human PMCs. PMCs were treated with TGF-␤1 for different times up to 48 h and analyzed by Western blot. We found that TGF-␤1 down-regulated the expression of Wt1 in a time-dependent manner over a period of 48 h, with an initial increase in expression at 4 h. Of note, the level of ␣-SMA was up-regulated with the concomitant down-regulation of Wt1 (Fig. 2A, B). Analysis of Wt1 at the transcriptional level of the PMCs

The FASEB Journal 䡠 www.fasebj.org

KARKI ET AL.

Figure 1. Differential expression of Wt1 in non-IPF and IPF PMCs. A) Western blot analysis of basal expression of Wt1 in PMCs from non-IPF lung (control PMC 1, 2), PMCs from patients with IPF (IPF PMC 1, 2), and human lung myofibroblasts (myofibroblast 1, 2). All primary cells for protein lysate were used at passage 4. B) RT-PCR analysis of basal level expression of Wt1 in primary PMCs from control and IPF lung demonstrated a significantly higher basal level of expression in normal PMCs (P⬍0.001) than did myofibroblasts. Results are representative of 3 independent experiments. C, D) Immunohistochemistry of consecutive sections of IPF lung explant for Wt1 (C) and calretinin (D). Wt1- and calretinin⫹ PMCs were present in the parenchyma of the explanted lungs from patients with IPF. Calretinin is a characteristic marker for PMCs.

treated with TGF-␤1 for 24 h also revealed an up to 4-fold reduction in Wt1 mRNA expression (Fig. 2C), whereas ␣-SMA was induced up to 2.5-fold in a timedependent manner (Fig. 2D). Loss of Wt1 induces MMT in PMCs Our data in Fig. 2 suggest that loss of Wt1 induces expression of mesenchymal markers in PMCs. We next transfected control PMCs with Wt1 shRNA and control shRNA plasmid to generate Wt1-knockdown (sh Wt1) and control (sh control) PMCs, respectively. Immunofluorescence staining for mesothelial and mesenchymal markers was performed in sh Wt1 and sh control PMCs.

Expression of E-cadherin was down-regulated, and fibronectin and ␣-SMA were up-regulated in the sh Wt1 PMCs (Fig. 3A). The loss of Wt1 suggests transdifferentiation of the PMCs via MMT into a myofibroblast-like mesenchymal phenotype. Western blot analyses were also performed to confirm mesenchymal transition of PMCs. Sh control and sh Wt1 PMCs were cultured for 24 h and probed for the mesothelial marker E-cadherin and the mesenchymal markers fibronectin and ␣-SMA. We noted down-regulation of the epithelial markers in the sh Wt1 PMCs, accompanied by up-regulation of the mesenchymal markers. The decrease in expression of E-cadherin coincided with the significant up-regulation of ␣-SMA

Figure 2. TGF-␤1 reduced the expression of Wt1 and the concordant expression of ␣-SMA in PMCs. A, B) Control human PMCs were cultured without (A) or with (B) TGF-␤1 (5 ng/ml) over a period of 48 h. Treatment resulted in decreased expression of Wt1 along with increased expression of ␣-SMA, compared with that of the controls. C, D) Levels of Wt1 (C) and ␣-SMA (D) mRNA expression was evaluated by quantitative RT-PCR in cultured PMCs treated with TGF-␤1 for 48 h. Relative amounts of Wt1 and ␣-SMA were normalized to ␤-actin and expressed relative to those on d 0. Values are means ⫾ se of ⱖ3 independent experiments.

LOSS OF WT1 IN PMCS LEADS TO MMT AND CONTRIBUTES TO FIBROSIS

1125

Figure 3. Loss of Wt1 induced MMT in PMCs. A) Immunofluorescence staining for Wt1, E-cadherin, fibronectin, and ␣-SMA (green) in PMCs transfected with Wt1 shRNA (sh Wt1) and scrambled shRNA (sh control). Original view, ⫻100. B) Western blot analysis of whole protein cell lysates of sh control and sh Wt1 PMCs. Loss of Wt1 resulted in decreased expression of E-cadherin, whereas the mesenchymal markers ␣-SMA and fibronectin were increased. Blot was reprobed for ␤-actin to ensure equal loading of protein in each lane. Results are representative data of 3 separate experiments. C, D) Loss of Wt1-induced Smad2 signaling in sh Wt1 PMCs compared to control. Whole cell lysates from sh control and sh Wt1 PMCs, cultured without (C) and with (D) TGF-␤1 (5 ng/ml) over a period of 90 min, were analyzed for total and phosphorylated forms of Smad2/3. Expression of pSmad2 was up-regulated at 10 min in sh Wt1 PMCs compared with that in the control (sh control PMC). ␤-Actin was used as a loading control. Results are representative of 3 separate experiments.

and fibronectin in sh Wt1 PMCs compared with that in sh control PMCs (Fig. 3B). Up-regulated fibronectin expression in sh Wt1 PMCs was also evident for the transition of PMCs into a myofibroblast-like phenotype (Fig. 3A, B). Loss of Wt1 induces Smad2 signaling in PMCs Receptor Smad proteins (Smad2/3) are known to be involved in EMT and fibrosis. We evaluated the levels of Smad2/3 in sh control and sh Wt1 PMCs, in the absence and presence of TGF␤-1 (Fig. 3C, D). The expression of Smad2/3 was higher in sh Wt1 as compared to sh control PMCs, even without stimulation of TGF-␤1 (Fig. 3C). When stimulated with 5 ng/ml of TGF-␤1, expression of both Smad2/3 and pSmad2 were higher in sh Wt1 compared to sh control PMCs. TGF␤-1 induced phosphorylation of Smad2 within 10 min, and the level of Smad2 phosphorylation reached its maximum between 30 and 60 min after treatment and remained elevated for the duration of the experiment without affecting total Smad2 levels (Fig. 3D). Of note, the level of pSmad2 induction in sh Wt1 PMCs was comparable to that in IPF PMCs (data not shown). 1126

Vol. 28

March 2014

Wt1 is necessary for maintenance of PMC morphology The observation that loss of Wt1 induced MMT in PMCs, differentiating them into a myofibroblast-like phenotype, suggests that loss of Wt1 induces alterations in PMC morphology. In tissue culture plates, control cells grew with a mesothelial morphology, tending to cluster together in a cobblestone pattern. Cells stably transfected with the Wt1 shRNA plasmid appeared as individual, separated cells and had a spindle-like morphology (Fig. 4A). We also evaluated the morphology of sh control and sh Wt1 PMCs in 3D Matrigel (BD Biosciences), as described in Materials and Methods. Strikingly, the morphology of the sh Wt1 cells was significantly altered as compared to that of the sh control (Fig. 4B) and the control (data not shown) PMCs. Three-dimensional Matrigel provides the appropriate structural and functional context that is fundamental for examining the biological activities of cells. Sh control and control PMCs exhibited a spherical architecture typical of mesothelial cells; however, the sh Wt1 PMCs were larger, with extended processes. The distinct morphologic differences were observed by 5–7 d.

The FASEB Journal 䡠 www.fasebj.org

KARKI ET AL.

Figure 4. Wt1 was indispensable for the morphology of the PMCs. A) Phase-contrast microscopy revealed elongated, myofibroblast-like cells after loss of Wt1, compared to the cuboid, cobblestone appearance of the control PMCs. B) Wt1 ameliorated the morphological changes in PMC 3D gel cultures (original views, ⫻20).

The cells expressing Wt1 (sh control) formed tight, spherical clusters, whereas the sh Wt1 PMCs grew in a disorganized manner, and the colonies had spindle-like cells from which invadopodia-like arms appeared as appendages. Thus, the structure of the PMCs was profoundly affected by Wt1 expression, and Wt1 was indispensable for morphologic homeostasis of the PMCs.

whereas the control PMCs did not show contraction of the gel matrices (Fig. 5A). It was interesting that Wt1 PMCs induced contraction of the matrices amounting to a 50% reduction in the original size, compared to that induced by the control PMCs. Stimulation with TGF-␤1 significantly (P⬍0.05) increased matrix contraction compared to that induced by the controls (64% reduction in original size) (Fig. 5B). Our results indicate a crucial role for Wt1 in conferring a contractile property to transformed PMCs.

Loss of Wt1 induced collagen gel contractility Loss of Wt1 induces migration of transformed PMCs We evaluated whether the Wt1-dependent transition of PMCs to myofibroblasts affects their capacity to cause 3D collagen gels to contract. We assessed the ability of the Wt1-knockdown PMCs to elicit ECM contraction using rat tail collagen type I matrix in the presence and absence of TGF-␤1. Control, sh Wt1, and sh control PMCs were harvested with trypsin and cast into collagen matrices that were floated in serum-free Medium 199, with or without TGF-␤1 (5 ng/ml). We also used IPF PMCs for comparison. Even without TGF-␤1 stimulation, the Wt1-knockdown PMCs showed gel contraction comparable (P⬍0.05) to IPF PMCs,

Haptotactic migration of PMCs was evaluated, with and without TGF-␤1. The PMCs showed significantly increased haptotactic activity with TGF-␤1 compared with that obtained with the BSA control (data not shown). Migration of the control, sh Wt1, and sh control PMCs was evaluated for 24 h, with or without activation by recombinant TGF-␤1 (R&D Systems), and compared with that of the IPF PMCs. In the absence of TGF-␤1, sh Wt1 PMCs showed significantly increased haptotactic migration, as compared to that of the control and sh

Figure 5. Loss of Wt1 induced gel contractility and migration in PMCs. A, B) The loss of Wt1 modulated PMC contractility. Control, sh control, sh Wt1, and IPF PMCs were cultured in collagen gels in serum-free medium without (A) or with (B) TGF-␤1 (5 ng/ml), and allowed to contract for 48 h. The gel area was subsequently measured as an indicator of PMC contractility. The sh Wt1 PMCs showed increased gel contraction, which was comparable to that of IPF PMCs. C) Role of Wt1 in modulating pleural mesothelial haptotaxis. Haptotaxis assays were performed in Transwell migration chambers. Control, sh control, sh Wt1, and IPF PMCs (1⫻105 of each type), without or with TGF-␤1 (5 ng/ml), were seeded into the top chamber and incubated for 6 h at 37°C in 5% CO2. Number of cells that migrated is expressed as the haptotactic index: the number of cells visualized per 20 high-power (⫻40) fields. sh Wt1 PMCs and IPF PMCs showed the highest haptotactic index in the presence and absence of TGF-␤1, as compared to control PMCs and sh control PMCs. Data are representative of 3 separate experiments. LOSS OF WT1 IN PMCS LEADS TO MMT AND CONTRIBUTES TO FIBROSIS

1127

control PMCs. A significant (P⬎0.005) increase in the migration of knockdown PMCs was noted (Fig. 5C). We next assessed the migration of PMCs in the activation with TGF-␤1 at a dose of 5 ng/ml. The knockdown PMCs showed an unexpected, significantly higher migration (P⬎0.005) as compared to the control and sh control PMCs. However, the difference between migration of sh Wt1 and sh IPF PMCs was not significant. These results suggest that with the loss of Wt1, the PMCs attained plasticity and showed migratory behavior, even without activation by TGF-␤1. Together, these results support our hypothesis that PMCs undergo the process of MMT secondary to the loss of Wt1. TGF-␤1-activated PMCs migrate into the lung parenchyma in vivo We used Wt1tm1(EGFP/Cre)Wtp/J mice to perform live cell imaging of lung sections, as described in Materials and Methods. In lungs from the control mice, EGFP expression was restricted to the pleural mesothelium throughout a period of 16 h. In mice administered TGF-␤1, we observed EGFP⫹ cells inside the lung parenchyma, in addition to those on the pleural surface (Fig. 6B). Lineage tracing of Wt1ⴙ PMCs We used the Cre-loxP system to trace the fate of Wt1⫹ PMCs in the lung, as described in Material and Methods. Wt1CreERT2 knock-in mice express the fusion protein of Cre and ERT2 at the Wt1 gene locus (24). After irreversibly labeling Wt1⫹ cells with ␤-gal by activation of Cre by TAM, we administered active TGF-␤1 intratracheally and euthanized the mice after 4 h. The

cryosections of lung stained for ␤-gal showed ␤-gal⫹ cells in the lung parenchyma. The presence of ␤-gal⫹ cells in the submesothelial parenchyma of the lung sections suggests that PMCs migrate into the lung parenchyma in response to TGF-␤1 treatment. The cells stained positive for ␣-SMA, as well. We also confirmed that TGF-␤1 administration did not induce ␤-gal expression in ERT2xROSA mice without TAM administration (data not shown). Collectively, these data indicated that during TGF-␤1 stimulation, Wt1⫹ PMCs migrate into the parenchyma from the pleural surface (Fig. 6C, D).

DISCUSSION In the present study, Wt1 played a critical role in mesothelial cell plasticity and in the transition of PMCs to a myofibroblast-like phenotype and migration into the lung parenchyma during IPF. Wt1 was highly expressed in PMCs isolated from normal human lung explants, whereas its expression in PMCs from IPF lungs was reduced, and it was not expressed in myofibroblasts from the IPF lungs. Of interest, immunostaining of IPF lung explants showed Wt1 positivity in the pleura, and a few cells in the submesothelial parenchyma also showed positivity. Que et al. (28) reported the absence of expression of Wt1 in the mesenchyme of normal lung tissue. It is known that migration of PMCs is a requisite component of MMT transition, wherein PMCs differentiate into a intermediate myofibroblast phenotype, and this transitional phenotype expresses both PMC and myofibroblast characteristics; hence, the

Figure 6. Wt1⫹ PMCs migrated into lung parenchyma in response to TGF-␤1-induced injury. A, B) PMCs of Wt1tm1EGFP/Cre)wtp/ J mice responded to intratracheal TGF-␤1 instillation. A) Schematic representation of live imaging of sections of Wt1tm1EGFP/Cre)wtp/J lungs. B) Live imaging of lung sections of control (saline)- and TGF-␤1-treated mice. Lung sections were imaged by 2-photon excitation fluorescence laser scanning microscope (Prairie Technologies), and 3D images were acquired by using IMARIS software to collect a Z stack of sections. In control (saline-treated) lungs, GFP⫹ PMCs lined the pleura. In mice receiving TGF-␤1 instillation, GFP⫹ PMCs migrated into the lung parenchyma. Migration of GFP⫹ PMCs over a period of 16 h after TGF-␤1 instillation was imaged. C, D) Immunofluorescence staining of ␤-gal (red) and ␣-SMA (green) from control- and TGF-␤1-treated mice followed by TAM administration. C) Schematic representation of conditional labeling of Wt1-expressing cells of Wt1CreERT2 and Rosa26lacZflox mice. D) ␤-Gal⫹ Wt1-expressing cells were found in lung parenchyma of mice administered TGF-␤1 (bottom panels) while the expression of ␤-gal was seen only in the pleura of the control mice (top panels). Original view, ⫻20. 1128

Vol. 28

March 2014

The FASEB Journal 䡠 www.fasebj.org

KARKI ET AL.

positive immunoreactivity for Wt1 is present within the interstitium, because these myofibroblasts are the continuum from the loss of Wt1 and expression of ␣-SMA. Furthermore, our in vitro results with TGF-␤1 treatment of PMCs demonstrated a concomitant increase in the expression of the mesenchymal marker ␣-SMA, with a reduction in Wt1 expression. A recent study demonstrated reduced expression of Wt1 in cultured podocytes compared with controls, demonstrating a loss of Wt1 expression after 8 h and onward (29), after exposure to TGF-␤1. Wt1 regulates maintenance of the mesothelial cell phenotype during the development of certain mesodermal tissues (28, 30); however, its role in adult diseases of the lung parenchyma, such as IPF, has not been examined. We used the RNAi approach to confirm the functional importance of Wt1 and its role in the mediation of PMC MMT. The resulting knockdown cells exhibited enhanced expression of the mesenchymal markers ␣-SMA and fibronectin IST9, along with the down-regulation of E-cadherin. Que et al. (28) showed that, during development, the mesothelium of the lung loses Wt1 and contributes to SMA-expressing mesenchymal cells within the organ. Similar results have been found in other organs. During cardiac development, Wt1⫹ epicardial cells undergo transition into a mesenchymal phenotype and differentiate into smooth muscle cells and endothelial cells (24). The established body of literature suggests that the R-Smads are key mediators in TGF-␤1-induced fibrosis and EMT. Smad3 is involved in TGF-␤1-induced pleural scarring and subpleural fibrosis (31). Double knockout of the Smad2 and Smad3 genes in mouse hepatocytes indicates that Smad3 is essential for differentiation (32). In contrast, increased matrix metalloproteinase-2 and ␣-SMA are dependent on both Smad2 and Smad3 signaling (33). TGF-␤1 down-regulates intercellular junctional proteins in a Smad-dependent manner by inducing the expression of the Slug family of transcription factors (34), resulting in the inhibition of Ecadherin and inducing EMT (35). In a recent study, Takeichi et al. (36) reported that Slug expression increases after the knockdown of Wt1 and that expression of Slug promotes epicardial EMT. Smad3 activates Slug transcription (37), which in turn activates dissociation of cell– cell contacts. In our study, the expression of Smad2/3 was significantly higher in sh Wt1 PMCs, even without TGF-␤1 stimulation (Fig. 3C), and the loss of Wt1 activated pSmad2 expression vigorously in the presence of TGF-␤1 (Fig. 3D). It is well established that TGF-␤1 down-regulates intercellular junctional proteins in a Smad-dependent manner by inducing the expression of the Slug family of transcription factors (34), resulting in the inhibition of E-cadherin and inducing EMT (35). This explains the data in Fig. 3A, B, where we show that the loss of Wt1 resulted in the loss of E-cadherin and the induction of MMT. Sato et al. (38) demonstrated that induction of ␣-SMA in cultured tubular epithelial cells obtained from Smad3-knockout mice is dependent on Smad3. Smad2 also plays a role in the induction of ␣-SMA in human proximal tubular epithelial cells (PTECs; ref. 33). Taken together, these data indicate that rapid and sustained phosphorylation

of Smad2 is associated with TGF-␤1-induced MMT events and that TGF-␤1-induced Smad2 signaling pathways are elevated after the loss of Wt1 during MMT of PMCs. Decologne et al. (39) administered carbon particles, along with intratracheal bleomycin, into the chest cavities of mice and observed severe pleural fibrosis, which was associated with progressive subpleural fibrosis, similar to IPF. The same group showed that overexpression of TGF-␤1 in the mesothelium of the rat lung results in pleural fibrosis, which subsequently expanded into the lung parenchyma. Nasreen et al. (12) demonstrated that stimulation of PMCs with TGF-␤1 leads to MMT transition of myofibroblasts. Our findings suggest that loss of Wt1 results in subsequent phenotypic transformation. In various cancers, Wt1 has been reported to modulate cytoskeleton dynamics (40, 41). EMT/MMT converts epithelial/ mesothelial cells into migratory and/or invasive mesenchymal cells. Prerequisite cellular changes in MMT include the release of cells from epithelial polarity and the remodeling of epithelial cell– cell and cell–matrix adhesion contacts and of their actin cytoskeletons (42). In addition, these motile, differentiated cells undergo de novo synthesis of the ECM, with exhibition of phenotypic modules, such as the invasion through basement membrane and migration that define the MMT phenotype (43). Our findings demonstrate that Wt1 knockdown cells with higher fibronectin promote collagen gel contraction. Nakamura et al. (44) showed that fibronectin has a permissive effect on the formation of actin stress fibers and is a determinant of contractility of the trabecular meshwork. MMT may contribute to the degeneration of mature epithelial structures and to the generation of fibroblasts associated with the accumulation of ECM in chronic fibrotic disorders (45). Haptotaxis is defined as the movement of cells in response to a dose-dependent gradient of substratumbound cytokines. Because of the loss of Wt1, the PMCs attained phenotypic plasticity and showed migratory behavior, even in the absence of TGF-␤1. The haptotactic behavior of the sh Wt1 cells may be attributable to the reduced expression of E-cadherin, allowing for the loss of cell– cell binding and subsequent haptotaxis of PMC. E-cadherin is a recognized Wt1 target gene (46) and is a junctional protein, that regulates cell motility and migration (47, 48). Hosono et al. (46) showed that mesenchymal NIH 3T3 fibroblasts stably expressing Wt1 exhibit growth suppression and features of epithelial differentiation including up-regulation of E-cadherin mRNA. In our study, we found that loss of Wt1 led to suppression of E-cadherin expression. Live imaging of cells and tissues enables the visualization of dynamic and spatial interactions of cells and their environment in real time. Transgenic mice expressing fluorescent proteins or adoptive transfer of fluorescently labeled cells can be imaged with 2-photon microscopes, enabling the visualization of spatial interactions between the different cells in the lung (27). Our group has reported the migration of PMCs from the pleura into the parenchyma with activation of TGF-␤1 (13). In that study, we used Wt1tm1(EGFP/Cre)Wtp/ J mice to investigate whether PMCs in adult mice

LOSS OF WT1 IN PMCS LEADS TO MMT AND CONTRIBUTES TO FIBROSIS

1129

activate and migrate into the lung parenchyma in response to TGF-␤1. In our live-imaging experiments, Wt1-expressing, GFP⫹ PMCs from lungs of mice administered TGF-␤1 migrated into the lung parenchyma. The wavelength used in the 2-photon excitation was specific for EGFP, and no dyes were involved. PMCs from the control mice receiving PBS showed the Wt1expressing EGFP cells on the pleural membrane but not in the parenchyma. Wt1-based Cre alleles are useful tools for genetic lineage tracing of mesothelial cells (49). We used TAM-inducible Wt1CreERT2 mice to trace the fate of PMCs in response to active TGF-␤1 administration. During cardiac development, epicardial cells transition to a mesenchymal phenotype, migrate into the subjacent myocardium and lose Wt1 as ␣-SMA expression increases (24). In developing lung, Wt1⫹ mesothelial cells of the pleura migrate into the organ and give rise to various cell types (27); however, there is no report of expression of Wt1 in the parenchyma of normal adult lung. We found that PMCs migrated into the lung parenchyma in response to TGF-␤1. The mice given TAM, but not TGF-␤1, did not show ␤-gal⫹ cells in the lung parenchyma. Taken together, our data suggest that loss of Wt1 differentiates PMCs into a migratory myofibroblast-like phenotype. Maintenance of homeostasis in the pleural mesothelium is crucial for normal lung function. In this study, Wt1 was not only a marker of PMCs but also was indispensable for their morphologic and phenotypic integrity. Loss of Wt1 in the PMCs induced distorted morphology and caused mesenchymal transition of PMCs into myofibroblasts. Our data strongly suggest a crucial role for Wt1 in the regulation of MMT, with the loss of Wt1 transforming PMCs into a migratory and invasive myofibroblast phenotype. Our findings support the growing body of evidence that the pleural mesothelium contributes to the generation of myofibroblasts in IPF via MMT and that Wt1 is a key mediator in the generation of myofibroblasts.

5.

6.

7.

8. 9. 10.

11.

12.

13.

14. 15.

16.

This work was supported by U.S. National Insitutes of Health (NIH) grant P01 HL114470. The authors thank Prof. Lucas Puzzo-Miller for help in the vibratome sectioning and live imaging of mouse lung sections and the University of Alabama School of Medicine Comprehenive Flow Cytometry Core (NIH grant P30AR048311) for help in sorting the transfected cells. The authors declare no conflicts of interest.

17.

18. 19.

REFERENCES 1.

Khalil, N., and O’Connor, R. (2004) Idiopathic pulmonary fibrosis: current understanding of the pathogenesis and the status of treatment. CMAJ 171, 153–160 2. Bjoraker, J. A., Ryu, J. H., Edwin, M. K., Myers, J. L., Tazelaar, H. D., Schroeder, D. R., and Offord, K. P. (1998) Prognostic significance of histopathologic subsets in idiopathic pulmonary fibrosis. Am. J. Resp. Crit. Care Med. 157, 199 –203 3. Hinz, B., and Gabbiani, G. (2010) Fibrosis: recent advances in myofibroblast biology and new therapeutic perspectives. F1000 Biol. Rep. 2, 78 4. Lansley, S. M., Searles, R. G., Hoi, A., Thomas, C., Moneta, H., Herrick, S. E., Thompson, P. J., Newman, M., Sterrett, G. F., Prele, C. M., and Mutsaers, S. E. (2011) Mesothelial cell

1130

Vol. 28

March 2014

20. 21. 22.

differentiation into osteoblast- and adipocyte-like cells. J. Cell. Mol. Med. 15, 2095–2105 Misumi, S., and Lynch, D. A. (2006) Idiopathic pulmonary fibrosis/usual interstitial pneumonia: imaging diagnosis, spectrum of abnormalities, and temporal progression. Proc. Am. Thorac. Soc. 3, 307–314 Cool, C. D., Groshong, S. D., Rai, P. R., Henson, P. M., Stewart, J. S., and Brown, K. K. (2006) Fibroblast foci are not discrete sites of lung injury or repair: the fibroblast reticulum. Am. J. Respir. Crit. Care Med. 174, 654 –658 Bostrom, H., Willetts, K., Pekny, M., Leveen, P., Lindahl, P., Hedstrand, H., Pekna, M., Hellstrom, M., Gebre-Medhin, S., Schalling, M., Nilsson, M., Kurland, S., Tornell, J., Heath, J. K., and Betsholtz, C. (1996) PDGF-A signaling is a critical event in lung alveolar myofibroblast development and alveogenesis. Cell 85, 863–873 Borok, Z. (2009) Role for alpha3 integrin in EMT and pulmonary fibrosis. J. Clin. Invest. 119, 7–10 Willis, B. C., duBois, R. M., and Borok, Z. (2006) Epithelial origin of myofibroblasts during fibrosis in the lung. Proc. Am. Thorac. Soc. 3, 377–382 Chilosi, M., Poletti, V., Zamo, A., Lestani, M., Montagna, L., Piccoli, P., Pedron, S., Bertaso, M., Scarpa, A., Murer, B., Cancellieri, A., Maestro, R., Semenzato, G., and Doglioni, C. (2003) Aberrant Wnt/beta-catenin pathway activation in idiopathic pulmonary fibrosis. Am. J. Pathol. 162, 1495–1502 Rock, J. R., Barkauskas, C. E., Cronce, M. J., Xue, Y., Harris, J. R., Liang, J., Noble, P. W., and Hogan, B. L. (2011) Multiple stromal populations contribute to pulmonary fibrosis without evidence for epithelial to mesenchymal transition. Proc. Natl. Acad. Sci. U. S. A. 108, E1475–E1483 Nasreen, N., Mohammed, K. A., Mubarak, K. K., Baz, M. A., Akindipe, O. A., Fernandez-Bussy, S., and Antony, V. B. (2009) Pleural mesothelial cell transformation into myofibroblasts and haptotactic migration in response to TGF-beta1 in vitro. Am. J. Physiol. Lung Cell. Mol. Physiol. 297, L115–L124 Mubarak, K. K., Montes-Worboys, A., Regev, D., Nasreen, N., Mohammed, K. A., Faruqi, I., Hensel, E., Baz, M. A., Akindipe, O. A., Fernandez-Bussy, S., Nathan, S. D., and Antony, V. B. (2012) Parenchymal trafficking of pleural mesothelial cells in idiopathic pulmonary fibrosis. Eur. Respir. J. 39, 133–140 Antony, V. B. (2003) Immunological mechanisms in pleural disease. Eur. Respir. J. 21, 539 –544 Antony, V. B., Hott, J. W., Kunkel, S. L., Godbey, S. W., Burdick, M. D., and Strieter, R. M. (1995) Pleural mesothelial cell expression of C-C (monocyte chemotactic peptide) and C-X-C (interleukin 8) chemokines. Am. J. Respir. Cell Mol. Biol. 12, 581–588 Pace, E., Ferraro, M., Mody, C. H., Melis, M. R., Scafidi, V., Bonanno, A., Profita, M., Giarratano, A., and Gjomarkaj, M. (2008) Pleural mesothelial cells express both BLT2 and PPARalpha and mount an integrated response to pleural leukotriene B4. J. Immunol. 181, 7292–7299 Glista-Baker, E. E., Taylor, A. J., Sayers, B. C., Thompson, E. A., and Bonner, J. C. (2012) Nickel nanoparticles enhance plateletderived growth factor-induced chemokine expression by mesothelial cells via prolonged mitogen-activated protein kinase activation. Am. J. Respir. Cell Mol. Biol. 47, 552–561 Mutsaers, S. E. (2002) Mesothelial cells: their structure, function and role in serosal repair. Respirology 7, 171–191 Humphreys, B. D., Lin, S. L., Kobayashi, A., Hudson, T. E., Nowlin, B. T., Bonventre, J. V., Valerius, M. T., McMahon, A. P., and Duffield, J. S. (2010) Fate tracing reveals the pericyte and not epithelial origin of myofibroblasts in kidney fibrosis. Am. J. Pathol. 176, 85–97 Scholz, H., and Kirschner, K. M. (2011) Oxygen-Dependent Gene Expression in development and cancer: lessons learned from the Wilms’ tumor gene, WT1. Front. Mol. Neurosci. 4, 4 Miller-Hodges, E., and Hohenstein, P. (2012) WT1 in disease: shifting the epithelial-mesenchymal balance. J. Pathol. 226, 229 –240 Zolak, J. S., Jagirdar, R., Surolia, R., Karki, S., Oliva, O., Hock, T., Guroji, P., Ding, Q., Liu, R. M., Bolisetty, S., Agarwal, A., Thannickal, V. J., and Antony, V. B. (2013) Pleural mesothelial cell differentiation and invasion in fibrogenic lung injury. Am J. Pathol. 182, 1239 –1247

The FASEB Journal 䡠 www.fasebj.org

KARKI ET AL.

23.

24.

25.

26. 27. 28.

29. 30.

31. 32.

33.

34.

35.

36.

Debnath, J., Muthuswamy, S. K., and Bruggea, J. S. (2003) Morphogenesis and oncogenesis of MCF-10A mammary epithelial acini grown in three-dimensional basement membrane cultures. Methods 30, 256 –268 Zhou, B., Ma, Q., Rajagopal, S., Wu, S. M., Domian, I., RiveraFeliciano, J., Jiang, D., von Gise, A., Ikeda, S., Chien, K. R., and Pu, W. T. (2008) Epicardial progenitors contribute to the cardiomyocyte lineage in the developing heart. Nature 454, 109 –113 Arlt, M. J., Born, W., and Fuchs, B. (2012) Improved visualization of lung metastases at single cell resolution in mice by combined in-situ perfusion of lung tissue and X-Gal staining of lacZ-tagged tumor cells. J. Vis. Exp. 66, e4162 Walters, D. M., and Kleeberger, S. R. (2008) Mouse models of bleomycin-induced pulmonary fibrosis. Curr. Protoc. Pharmacol. Chapter 5, Unit 5.46 Thornton, E. E., Krummel, M. F., and Looney, M. R. (2012) Live imaging of the lung. Curr. Protoc. Cytom. Chapter 12, Unit 12.28 Que, J., Wilm, B., Hasegawa, H., Wang, F., Bader, D., and Hogan, B. L. (2008) Mesothelium contributes to vascular smooth muscle and mesenchyme during lung development. Proc. Natl. Acad. Sci. U. S. A. 105, 16626 –16630 Sakairi, T., Abe, Y., and Kopp, J. B. (2011) TGF-beta1 reduces Wilms’ tumor suppressor gene expression in podocytes. Nephrol. Dial. Transplant. 26, 2746 –2752 Parenti, R., Perris, R., Vecchio, G. M., Salvatorelli, L., Torrisi, A., Gravina, L., and Magro, G. (2013) Immunohistochemical expression of Wilms’ tumor protein (WT1) in developing human epithelial and mesenchymal tissues. Acta Histochem. 115, 70 –75 Gauldie, J., Bonniaud, P., Sime, P., Ask, K., and Kolb, M. (2007) TGF-beta, Smad3 and the process of progressive fibrosis. Biochem. Soc. Trans. 35, 661–664 Ju, W., Ogawa, A., Heyer, J., Nierhof, D., Yu, L., Kucherlapati, R., Shafritz, D. A., and Bottinger, E. P. (2006) Deletion of Smad2 in mouse liver reveals novel functions in hepatocyte growth and differentiation. Mol. Cell. Biol. 26, 654 –667 Phanish, M. K., Wahab, N. A., Colville-Nash, P., Hendry, B. M., and Dockrell, M. E. (2006) The differential role of Smad2 and Smad3 in the regulation of pro-fibrotic TGFbeta1 responses in human proximal-tubule epithelial cells. Biochem. J. 393, 601–607 Thuault, S., Valcourt, U., Petersen, M., Manfioletti, G., Heldin, C. H., and Moustakas, A. (2006) Transforming growth factorbeta employs HMGA2 to elicit epithelial-mesenchymal transition. J. Cell Biol. 174, 175–183 Come, C., Arnoux, V., Bibeau, F., and Savagner, P. (2004) Roles of the transcription factors snail and slug during mammary morphogenesis and breast carcinoma progression. J. Mammary Gland Biol. Neoplasia 9, 183–193 Takeichi, M., Nimura, K., Mori, M., Nakagami, H., and Kaneda, Y. (2013) The transcription factors Tbx18 and Wt1 control the epicardial epithelial-mesenchymal transition through bi-direc-

37.

38.

39.

40.

41.

42. 43. 44.

45. 46. 47. 48.

49.

tional regulation of Slug in murine primary epicardial cells. PloS ONE 8, e57829 Morita, T., Mayanagi, T., and Sobue, K. (2007) Dual roles of myocardin-related transcription factors in epithelial mesenchymal transition via Slug induction and actin remodeling. J. Cell Biol. 179, 1027–1042 Sato, M., Muragaki, Y., Saika, S., Roberts, A. B., and Ooshima, A. (2003) Targeted disruption of TGF-beta1/Smad3 signaling protects against renal tubulointerstitial fibrosis induced by unilateral ureteral obstruction. J. Clin. Invest. 112, 1486 –1494 Decologne, N., Kolb, M., Margetts, P. J., Menetrier, F., Artur, Y., Garrido, C., Gauldie, J., Camus, P., and Bonniaud, P. (2007) TGF-beta1 induces progressive pleural scarring and subpleural fibrosis. J. Immunol. 179, 6043–6051 Jomgeow, T., Oji, Y., Tsuji, N., Ikeda, Y., Ito, K., Tsuda, A., Nakazawa, T., Tatsumi, N., Sakaguchi, N., Takashima, S., Shirakata, T., Nishida, S., Hosen, N., Kawakami, M., Tsuboi, A., Oka, Y., Itoh, K., and Sugiyama, H. (2006) Wilms’ tumor gene WT1 17AA(⫺)/KTS(⫺) isoform induces morphological changes and promotes cell migration and invasion in vitro. Cancer Sci. 97, 259 –270 Burwell, E. A., McCarty, G. P., Simpson, L. A., Thompson, K. A., and Loeb, D. M. (2007) Isoforms of Wilms’ tumor suppressor gene (WT1) have distinct effects on mammary epithelial cells. Oncogene 26, 3423–3430 Chapman, H. A. (2012) Epithelial responses to lung injury: role of the extracellular matrix. Proc. Am. Thorac. Soc. 9, 89 –95 Zavadil, J., and Bottinger, E. P. (2005) TGF-beta and epithelialto-mesenchymal transitions. Oncogene 24, 5764 –5774 Nakamura, Y., Sagara, T., Seki, K., Hirano, S., and Nishida, T. (2003) Permissive effect of fibronectin on collagen gel contraction mediated by bovine trabecular meshwork cells. Invest. Ophthalmol. Vis. Sci. 44, 4331–4336 Kalluri, R., and Neilson, E. G. (2003) Epithelial-mesenchymal transition and its implications for fibrosis. J. Clin. Invest. 112, 1776 –1784 Hosono, S., Gross, I., English, M. A., Hajra, K. M., Fearon, E. R., and Licht, J. D. (2000) E-cadherin is a WT1 target gene. J. Biol. Chem. 275, 10943–10953 Chen, H., Paradies, N. E., Fedor-Chaiken, M., and Brackenbury, R. (1997) E-cadherin mediates adhesion and suppresses cell motility via distinct mechanisms. J. Cell Sci. 110, 345–356 Fransvea, E., Angelotti, U., Antonaci, S., and Giannelli, G. (2008) Blocking transforming growth factor-beta up-regulates E-cadherin and reduces migration and invasion of hepatocellular carcinoma cells. Hepatology 47, 1557–1566 Zhou, B., and Pu, W. T. (2012) Genetic Cre-loxP assessment of epicardial cell fate using Wt1-driven Cre alleles. Circulation Res. 111, e276 –e280

LOSS OF WT1 IN PMCS LEADS TO MMT AND CONTRIBUTES TO FIBROSIS

Received for publication July 8, 2013. Accepted for publication November 11, 2013.

1131