Plant Mol Biol DOI 10.1007/s11103-016-0441-3

WRKY1 regulates stomatal movement in drought-stressed Arabidopsis thaliana Zhu Qiao1 • Chun-Long Li1 • Wei Zhang1

Received: 31 July 2015 / Accepted: 16 January 2016 Ó Springer Science+Business Media Dordrecht 2016

Abstract A key response of plants to moisture stress is stomatal closure, a process mediated by the phytohormone abscisic acid (ABA). Closure is affected by changes in the turgor of the stomatal guard cell. The transcription factor WRKY1 is a part of the regulatory machinery underlying stomatal movements, and through this, in the plant’s response to drought stress. The loss-of-function T-DNA insertion mutant wrky1 was particularly sensitive to ABA, with respect to both ion channel regulation and stomatal movements, and less sensitive to drought than the wild type. Complementation of the wrky1 mutant resulted in the recovery of the wild type phenotype. The WRKY1 product localized to the nucleus, and was shown able to bind to the W-box domain in the promoters of MYB2, ABCG40, DREB1A and ABI5, and thereby to control their transcription in response to drought stress or ABA treatment. WRKY1 is thought to act as a negative regulator in guard cell ABA signalling. Keywords Drought tolerance  Abscisic acid (ABA)  Transcription factor  Guard cell  Ion channels

Zhu Qiao and Chun-Long Li have contributed equally to this work. & Wei Zhang [email protected] 1

Key Laboratory of Plant Cell Engineering and Germplasm Innovation, Ministry of Education, School of Life Science, Shandong University, Jinan 250100, China

Introduction Stomatal closure is a key component of the plant response to drought stress; its effect is to reduce water loss from the leaf, but it simultaneously also shuts down photosynthesis as it prevents the influx of carbon dioxide (Geiger et al. 2011; Hetherington 2001; Katul et al. 2010; Schroeder et al. 2001a). The closure process is effected by a change in the turgor of the stomatal guard cells: the influx of ions and sucrose promotes water uptake, which swells the guard cell, thereby forcing open the stomata; their efflux reduces the cell’s osmotic potential, thereby collapsing the cell and allowing the stomata to close (Cochrane and Cochrane 2009; Kim et al. 2010; Lu et al. 1995; Pandey et al. 2007; Roelfsema and Hedrich 2005; Schroeder et al. 2001a). Abscisic acid (ABA) is the most influential phytohormone involved in the response to drought stress (Ben-Ari 2012; Schroeder et al. 2001b); when its content is raised as a result of the imposition of stress, the hormone regulates stomatal movement in conjunction with cytosolic free calcium, acting on both the guard cell’s ion channels and on localized gene expression (Fan et al. 2008; Lee et al. 2012; Macrobbie 1997; Okamoto et al. 2013; Roelfsema et al. 2004; Vahisalu et al. 2008). For example, ABA is known to inhibit the inward rectifying K? (Kþ in ) channels in the guard cell plasma membrane, thereby inhibiting K? influx; the result is a brake on stomatal opening. ABA also activates various anion channels, which act to encourage solute efflux and thus to hasten stomatal closure (Schroeder et al. 2001a; Wang et al. 1998). The large family of WRKY transcription factors exert an influence over plant growth, development and the plant– environment interaction (Rushton et al. 2010; Ulker and Somssich 2004). In the model plant Arabidopsis thaliana,

123

Plant Mol Biol

AtWRKY10 is important for seed development (Luo et al. 2005), AtWRKY44 for trichome development (Johnson et al. 2002), and AtWRKY6, AtWRKY53, AtWRKY70 for leaf senescence (Robatzek and Somssich 2002; Ulker et al. 2007). AtWRKY3, AtWRKY4, AtWRKY52, AtWRKY53 and AtWRKY70 all participate in the plant’s response to pathogen attack (Pandey and Somssich 2009). AtWRKY22 and AtWRKY29 are two of the downstream components in a MAPK pathway which is responsible for conferring resistance against both bacterial and fungal pathogens (Asai et al. 2002). In rice, OsWRKY13 down-regulates the plant’s tolerance to both salinity and low temperature tolerance, while also activating the transcription of a number of genes acting to enhance disease resistance (Qiu et al. 2008; Xiao et al. 2013). AtWRKY25, AtWRKY33, AtWRKY8 and OsWRKY45 are all involved in the response to salinity stress (Hu et al. 2013; Jiang and Deyholos 2009; Tao et al. 2011). In response to water deficiency status, a highly expressing allele of AtWRKY57 confers an enhanced level of drought tolerance (Jiang et al. 2012), and the mutant of ABO3 (AtWRKY63) reduces the plant drought tolerance (Ren et al. 2010), showing they are positive regulators in plant drought response. While the double mutant of another two transcription factors WRKY54 and WRKY57 improves the ABA sensitivity in stomatal closing and thus enhances the plant tolerance to osmotic stress (Li et al. 2013), indicating the WRKY54 and WRKY57 are the negative regulators in plant drought tolerance and guard cell ABA signalling. In the present study, we proved that the AtWRKY1 is a functional transcription factor, and its loss-of-function mutant showed enhanced sensitivity to ABA regulated ion trafficking of guard cells and stomatal movements, and thus improved plant drought tolerance. Taken the roles of WRKYs reported and the WRKY1 data in the current work together, all the findings suggested the complicated roles of WRKY members in plant–environment interaction.

Materials and methods Plant materials and growing conditions A. thaliana seed (wild type Col-0 [WT] and the T-DNA insertion mutant wrky1) was sterilized by immersion in 70 % ethanol for 3 min, then in 95 % ethanol for 1 min. The wrky1 mutant (Salk_016954 in a Col-0 background) was obtained from Arabidopsis Biological Resource Center (https://abrc.osu.edu). The seed was then air-dried and plated on solidified Murashige and Skoog (1962) medium containing 1 % w/v sucrose. After a 3 day exposure to 4 °C in the dark to promote germination, the plates were held under a 10 h photoperiod (100 lmol m-2 s-1 light

123

intensity) and *70 % relative humidity, with the temperature controlled during the lit period to 22 ± 1 °C and during the dark period to 18 ± 2 °C. After a week, the seedlings were potted into a potting mix (Lu-Qing Plant Inc. China) and returned to the same growth chamber. The genetic status of the wrky1 mutant was validated using a PCR based on primers targeting the WRKY1 sequence (WRKY1 LP/RP) and the T-DNA left border (LBb1.3) (these, and all further primer sequences are detailed in Table 1). The transcription of WRKY1 was monitored by RT-PCR, using total RNA was isolated with the TriPure Isolation Regent (Roche. Switzerland), then reverse-transcribed into cDNA with the aid of a reverse aid kit (Thermo Scientific. U.S.A). The WRKY1-specific primer pair was WRKY1-F/-R, while the reference sequence was the AtACTIN2 gene primed by ACTIN2-F/-R (Table 1). Stomatal movement, water loss and drought stress assays Stomatal movement was assayed as described by Li et al. (2014) with minor modifications (Li et al. 2014). Fully expanded rosette leaves were excised from a 4-week old plant and immersed in 20 mM KCl, 1 mM CaCl2, 5 mM MES–KOH (pH 6.15) for 2.5 h in the light (450 lmol m-2 s-1) at room temperature, following which ABA with final concentration of 50 lM (or as a control the same volume of ethanol) was added and the leaves held for a further 2.5 h. Abaxial epidermal strips were then peeled off and the stomata were imaged by light microscopy at 4009 magnification. The width of the stomatal aperture was estimated from the resulting images using ImageJ v1.37 (imagej.nih.gov/ij/) and analyzed by Sigmaplot v11.0 (sigmaplot.softonic.com) software. To quantify the ABA-induced inhibition of stomatal opening, the leaves were floated in 10 mM KCl, 7.5 mM iminodiacetic acid, 10 mM MES-KOH (pH 6.15) in the dark for 2.5 h, after which either ABA with final concentration of 50 lM or the same volume of ethanol was added, and the leaves were kept illuminated for a further 2.5 h. Stomatal aperture was assessed as above from epidermal strips. Water loss was measured (% loss in fresh weight) from detached rosette leaves (three replicates per assay), by weighing them at a series of time points. Drought stress was imposed on 3-week old, well watered seedlings by depriving them of further water for 2–3 weeks. At the end of the period, the plants were imaged and re-watered. Quantitative real-time PCR (qRT-PCR) qRT-PCR was performed using a CFX96 TouchTM RealTime PCR Detection System (Bio-Rad. U.S.A) based on FastStart Universal SYBR Green master mix (Roche.

Plant Mol Biol Table 1 PCR primer sequences (shown 50 –30 ) Mutant identification WRKY1 LP/RP

AAAATCGATCCCCAAAGTTTG/CTAGCCAGAACTTTTCCCACC

LBb1.3

ATTTTGCCGATTTCGGAAC

RT-PCR WRKY1-F/-R

ATGGCTGAGGTGGGAAAAGT/TTAGCTTTGGGCAGGCTCTG

ACTIN2-F/-R

TCTTCTTCCGCTCTTTCTTTCC/TCTTACAATTTCCCGCTCTGC

qRT-PCT WRKY1-QF/-QR

AGGCAGCCCATATCCAAGGAGC/TCGTGGTCGTGTTTTCCCTCGT

DREB1A-QF/QR

TTACACGGCGGAACAGAGCG/TACGGACGGAAGCGGCAAA

MYB2-QF/-QR

ACATCGCTCGTTCCTCTGGG/TCTTCGACCACCTATTGCCCC

ABI5-QF/-QR

ACATGCATTGGCGGAGTTGG/TCGGCAATTTCGGTTGTGCC

ABCG40-QF/-QR ACTIN2-QF-QR

TAACCACCACATCGCCTCCG/TCGTGGTCGTGTTTTCCCTCGT GGTAACATTGTGCTCAGTGGTGG/AACGACCTTAATCTTCATGCTGC

ChIP qRT-PCR DREB1A-P2F/-P2R

GGATGTAGAACATTCAAATGGGTC/CCAAGGTACTCGTGCTAACC

MYB2-PF/-PR

GAGTGCGTGTTACTATACATCTGA/TCTCCATTTGGTCAATTGTTTGTG

ABCG40-PF/-PR

TTCATGGTCCAATTAGAATCTTCG/ACATATACAGTACAGTTGACCGAT

ABI5-P1F/P1R

CTGGACCTGTCTAAGTTAGCATTC/GTCTAAGAAGAGAGGCGTGAAG

NG-F/-R

TTACACGGCGGAACAGAG/CTGCCATATTAGCCAACAAACTC

Plasmid construction WRKY1-ProF/-ProR

CGCGGATCCCTAACAAACTCAAGTAAACTCAAA/CGCAAGCTTAGTGTCTAGATGATCAGTGG

WRKY1-C-F/-R

TCCCCCGGGATGGCTGAGGTGGGAAAAGT/CGCGAGCTCTTAGCTTTGGCAGGCTCTG

WRKY1-GFP-F/-R

CGCGTCGACGCTTTGGGCAGGCTCTG/TCCGGATCCATGGCTGAGGTGGGAAAAGT

Transcriptional activation WRKY1-FL-F/-R

CGGAATTCATGGCTGAGGTGGGAAAAGT/ACGCGTCGACTTAGCTTTGGGCAGGCTCTG

WRKY1-N-F/-R

CGGAATTCATGGCTGAGGTGGGAAAAGT/ACGCGTCGACTTACATAACCTTCTCACGAATAA

WRKY1-NW-F/-R

CGGAATTCATGGCTGAGGTGGGAAAAGT/ACGCGTCGACTTAGACATCACTTCGCTTATCCTGA

WRKY1-CW-F/-R WRKY1-C-F/-R

CGGAATTCATGCCATATCCAAGGAGCTACTATA/ACGCGTCGACTTAGCTTTGGGCAGGCTCTG CGGAATTCATGAACAAGACTCCACAGAGCTC/ACGCGTCGACTTAGCTTTGGGCAGGCTCTG

Protein purification WRKY1-GST-F/-R

TCCGAATTCATGGCTGAGGTGGGAAAAGT/CGCGTCGACTTAGCTTTGGGCAGGCTCTG

ChIP assay WRKY1-HA-F/-R

TCCGTCGACATGGCTGAGGTGGGAAAAGT/CGCACTAGTTTAGCTTTGGGCAGGCTCTG

Switzerland). The reference sequence was AtACTIN2. The relevant primer sequences are all given in Table 1. Plasmid construction and plant transformation The WRKY1 promoter sequence (1133 bp) was PCR amplified using the primer pair WRKY1-ProF/-ProR (Table 1) and the amplicon inserted into the pCambiaubiGus vector (Cambia, www.cambia.org) in the place of the Ubi promoter, resulting in the construct pWRKY1:: GUS. This construct was then introduced into Agrobacterium tumefaciens strain GV3101 and transformed into A. thaliana via the floral infiltration method (Clough and Bent 1998). The WRKY1 coding sequence was amplified from WT template (primer pair WRKY1-C-F-/-R, see Table 1)

and fused to its native promoter to form the pWRKY1::WRKY1 transgene, which was similarly transformed into the wrky1 mutant; this line is referred to hereafter as ‘‘C-1’’. GUS staining and subcellular localization The topography of WRKY1 expression was monitored via GUS staining of material harvested from plants harbouring pWRKY1::GUS. Following immersion in 2 mM X-Gluc, 2 mM K3Fe(CN)6, 2 mM K4Fe(CN)6, 0.1 % v/v Triton X-100, 10 mM EDTA in 50 mM sodium phosphate buffer (pH 7.2) at 37 °C for 5 h, a treatment with 70 % ethanol was used to bleach out the chlorophyll. The WRKY1 coding sequence was PCR amplified using the primer pair

123

Plant Mol Biol

WRKY1-GFP-F/-R (Table 1) and inserted into a pCaMV35S::GFP vector to generate the transgene p35S::WRKY1-GFP. After purification using a NucleoBondÒ Xtra Midi kit (Macherey–Nagel, www.mnnet.com), the plasmid was introduced into A. thaliana mesophyll protoplasts as described by Sheen, and incubated overnight in the dark at 23 °C (Sheen 2001). GFP signal and chlorophyll autofluorescence were detected using confocal laser-scanning microscopy, with excitation wavelengths 488 and 647 nm, respectively. Electrophysiology A. thaliana guard cell protoplasts were isolated as described by Zhang et al. (2008). Inward K? currents were recorded as reported by Coursol et al. (2003) and Wang et al. (2001) with minor modifications. The bathing solution was 4 mM MgCl2, 10 mM K-Glu, 1 mM CaCl2, 10 mM MES-Tris (pH 5.6) and the osmolarity was adjusted with sorbitol to 500 mOSM. The pipette solutions contained 20 mM KCl, 10 mM HEPES-Tris (pH 7.8), and 80 mM K-Glu, and the osmolarity was adjusted to 550 mOSM. ATP-Mg was added to the pipetting solutions to a final concentration of 5 mM just prior to recording. The patch clamp amplifier was an Axonpatch-200B device (Molecular Devices. U.S.A), connected to a computer via a Digidata1440A data acquisition system (Molecular Devices. U.S.A). The hold potential was -60 mV and the test voltage was stepped from -200 to -40 mV in 20 mV increments (4.9 s hold at each voltage level). The ABA treatment was effected by solution changing with 50 lM

Fig. 1 Characterization of the wrky1 mutant. a The structure of the mutation to WRKY1. b RT-PCR demonstrates that WRKY1 is transcribed in WT but not in wrky1. c wrky1 mutant was more tolerant to drought stress than WT

123

ABA contained bath solution. Slow anion currents were recorded as described (Pei et al. 1997; Wang et al. 2001). The bathing solution was 2 mM MgCl2, 30 mM CsCl, 10 mM CaCl2, MES-Tris (pH 5.6) adjusted with sorbitol to 480 mOSM. The pipetting solution was 150 mM CsCl, 2 mM MgCl2, 6.7 mM EDTA, 3.35 mM CaCl2, 10 mM HEPES (pH 7.5) adjusted to 500 mOSM. 10 mM ATP-Mg and 10 mM GTP were freshly added into pipette solution before each experiment. The hold potential was 30 mV and the test voltage range was -145 to ?35 mV, changed in 30 mV increments (1 min duration at each voltage level). For the ABA treatment, the guard cell protoplasts were exposed to 50 lM ABA for 2 h before recording was initiated. pCLAMP software v10.2 (Axon Instruments. U.S.A) was used to acquire the currents, and SigmaPlot v11.0 software to assemble the current–voltage plots and to analyze the data. Transcriptional activation To analyse transcriptional activation, full length WRKY1, along with various fragments maintaining or lacking W-domain(s) were inserted into pGBK-T7 vector (Clontech. U.S.A) fused to a GAL4 DNA binding domain. The fragments were obtained by PCR using primer pairs detailed in Table 1. Both the recombinant plasmids and an empty pGBK-T7 were transformed into the yeast strain AH109, and transformed yeast cells were selected on synthetic complete plates lacking both Trp and Ade. Transcriptional activation was analyzed on plates lacking Trp, Ade, His and X-gal staining.

Plant Mol Biol Fig. 2 WRKY1 transcription and expression. a WRKY1 transcript abundance as affected by drought stress and ABA treatment. b WRKY1 transcription in various parts of the A. thaliana plant. Whiskers represent the SE (n = 3). c– h GUS staining showing the operation of the WRKY1 promoter in c, e seedlings, d the cauline leaf, f the root, g the inflorescence and h the guard cell

Protein purification and electrophoretic mobility shift assay (EMSA) To obtain the WRKY1-GST fusion protein required for the EMSA assay, the WRKY1 coding sequence was amplified with the primer pair WRKY1-GST-F/-R (Table 1), then inserted into the EcoRI/SalI site of pGEX-6P-1. The recombinant plasmids was transformed into E. coli BL21 The expression of the WRKY1-GST fusion was induced by the addition of 0.1 mM isopropyl-D-1-thiogalactopyranoside (IPTG) and a 5 h incubationg at 30 °C. The fusion protein was purified by passage through a Glutathione Sepharose 4B column (GE Healthcare. U.S.A). EMSA was performed following the protocol supplied with the LightShiftÒ Chemiluminescent EMSA Kit (Thermo Scientific. U.S.A). The relevant DNA fragments were PCR amplified using primers detailed in Table 1 (ChIP-qPCR

primers). The DNA fragments were 30 labeled with biotin The reaction products were separated by 5 % PAGE and detected by using an ImageQuant 400 ECL CCD camera (GE Healthcare. U.S.A). Chromatin immunoprecipitation (ChIP) assay ChIP was performed following the Haring et al. protocol with minor modifications (Haring et al. 2007). The WRKY1 coding sequence was amplified using the primer pair WRKY1-HA-F/-R (Table 1) and inserted into pCambia1300-HA (Cambia) to form the construct p35S::WRKY1HA. DNA was purified from the leaf of a 4-week old p35S::WRKY1-HA transgenic plant. The precipitated DNA was quantified by qRT-PCR using the specific primers described above. Anti-HA antibodies and DNA/protein A agarose were obtained from Thermo Scientific.

123

Plant Mol Biol

Results WRKY1 transcription in the guard cell was suppressed by drought The T-DNA insertion wrky1 mutant (Fig. 1a) generated no full length WRKY1 transcript (Fig. 1b). When the plants were subjected to drought stress, the mutant proved to be more tolerant than WT (Fig. 1c). Following this observation, the influence of both drought stress and exogenously supplied ABA over WRKY1 transcription in the WT was characterized using qRT-PCR. The initial response was a gradual reduction in transcript abundance in response to both treatments, followed by a return to a baseline level after around 3 h (Fig. 2a). The gene was transcribed in various tissues and organs (Fig. 2b). When the WRKY1 promoter was used to drive the expression of GUS, GUS signal was detected in the seeding, root, leaf and inflorescence (Fig. 2c–g). The stomatal cells showed

Fig. 3 The phenotype of the wrky1 mutant. a, b Stomatal movement in the wrky1 mutant is highly sensitive to ABA treatment, in contrast to their behavior in WT. Data based on at least 180 stomatal apertures per experiment. Whiskers represent the SE (n = 3). c Detached leaves of the wrky1 mutant lose water more slowly than WT leaves. Error bars represent the SE (n = 3)

123

the highest intensity of GUS signal (Fig. 2h), suggesting the participation of WRKY1 in the regulation of stomatal movement. The regulation of stomatal movement in the wrky1 mutant was highly sensitive to ABA and the mutant’s rate of water loss was slowed Stomatal opening under well watered conditions was similar in WT and the wrky1 mutant (Fig. 3a, b). However, when the plants were treated with ABA, stomatal opening was noticeably smaller in the wrky1 mutant than in WT. The formation of a smaller stomatal opening is consistent with the observed lower rate of water loss in the detached leaf experiment (Fig. 3c). The proposition was therefore that WRKY1 negatively regulates stomatal movement in response to ABA treatment, and that the wrky1 mutant’s superior drought tolerance reflects a more restricted stomatal opening.

Plant Mol Biol

Transformation with pWRKY1::WRKY1 rescued the wrky1 phenotype RT-PCR analysis showed that in the line C-1 (which harbours the pWRKY1::WRKY1 transgene), WRKY1 was transcribed as effectively as was the native gene in the WT

background (Fig. 4a, b). As predicted, the phenotype of C-1 was unlike that of the wrky1 mutant in terms of its stomatal movement’s sensitivity to ABA (Fig. 4d, e). The C-1 line also also behaved similarly to WT with respect to its rate of water loss from the leaf and its response to drought stress (Fig. 4c, f).

Fig. 4 The phenotype of the C-1 line (wrky1 mutant harboring pWRKY1::WRKY1) resembles that of WT. a, b RTPCR and qRT-PCR assays demonstrate the transcription of WRKY1 in WT and C-1, but not in wrky1. c Water loss from detached leaves of WT, wrky1 and C-1. Error bars represent the SE (n = 3). d, e Stomatal movement in WT, wrky1 and C-1. Data based on at least 180 stomatal apertures per experiment. Whiskers represent the SE (n = 4). f Contrasting drought stress of WT, wrky1 and C-1 seedlings

123

Plant Mol Biol

WRKY1 participated in the ABA-modulated regulation of the inward rectifying K1 channels (Kþ in ) and the slow type anion currents in the guard cells ABA is known to both inhibit Kþ in and activate anion channels to induce the stomatal closure (Schroeder et al. 2001a; Wang et al. 1998). In contrast to the response of WT plants, the wrky1 mutant was highly sensitive to ABA in the regulation of stomatal movement (Fig. 3a, b). To test the hypothesis that WRKY1 regulates stomatal movement by modulating Kþ in and anion channel activity in the guard cells, ion currents in guard cell protoplasts were measured. In the absence of ABA, there was no significant variation for Kþ in between WT, wrky1 and C-1, but when the plants were exposed to ABA, the size of the current induced by a

Fig. 5 WRKY1 is involved in ABA-regulated inward-rectify K? channels (Kþ in ) and slowtype anion channels. a Typical whole cell recordings of Kþ in currents. b Current–voltage (I–V) curves of time-activated whole cell Kþ in currents. The numbers of guard cells measured were WT (6), WT-ABA (9), wrky1 (8), wrky1-ABA (8), C-1 (9), C-1-ABA (8). Whiskers represent the SE. c Typical whole cell recordings of slow anion currents. d Current– voltage (I–V) curves of whole cell anion currents. The numbers of guard cells measured were WT (8), WTABA (10), wrky1 (9), wrky1ABA (9), C-1 (8), C-1-ABA (8). Whiskers represent the SE

123

potential difference of -200 mV was less in wrky1 than in either WT or C-1 (Fig. 5a, b). Anion currents arising from S-type anion channels were increased more strongly by the exogenous ABA treatment in wrky1 than in WT or C-1, but there was no significant variation between the three genotypes in the absence of the treatment (Fig. 5c, d). The data demonstrated that WRKY1 functions as a regulatory element in the ABA-mediated regulation of both Kþ in and anion channel activity in the guard cells. WRKY1 was expressed in the nucleus and its W-domains were essential for its transcription When the WRKY1 GFP fusion (p35S::WRKY1-GFP) was transformed into mesophyll protoplasts, the fusion protein was deposited exclusively in the nucleus, unlike the

Plant Mol Biol Fig. 6 Subcellular localization of WRKY1 and the transcriptional activity assay. a WRKY1 localizes to the nucleus. Bar: 10 lm. b Transcriptional activity assay. c Schematic representation of GAL4 DNA binding domains fused to the various WRKY1 fragments

product of the p35S::GFP transgene, which was deposited throughout the entire cell (Fig. 6a). The yeast-based assay of the transcriptional activity of WRKY1 was designed to identify the contribution of the gene’s two W-domains, by fusing various WRKY1 fragments with the GAL4 DNA binding domain (Fig. 6c). The full length WRKY1 sequence successfully activated the transcription of the reporter genes, while the fragments harboring no or just one W-domain did not (Fig. 6b). Thus both W-domains appear to be essential for WRKY1’s transcriptional activity. The targets of WRKY1 regulation The transcription of various genes was monitored in WT, wrky1 and C-1 plants subjected to either ABA treatment or

drought stress. Four genes (MYB2, ABI5, DREB1A and ABCG40) responded differentially in wrky1 compared to WT and C-1 (Fig. 7a–d). MYB2 and ABI5 are both transcription factors involved in ABA signal transduction, DREB1A is thought to activate the transcription of ABF genes and ABCG40 encodes an ABA transporter active in the guard cells. The promoter sequence of each of these genes includes one or two W-boxes (Fig. 8a). The application of EMSA showed that WRKY1 was able to bind to all of these W-box sequences in vitro (Fig. 8b). ChIP-based qRT-PCR confirmed that WRKY1 bound directly to the genes’ promoter in vivo as well (Fig. 8c). The implication is that WRKY1 acts as a node in a transcriptional regulatory network which functions in ABA signalling and the response to drought.

123

Plant Mol Biol Fig. 7 ABCG40, MYB2 and DREB1A transcription is repressed but that of ABI5 is enhanced in wrky1. a–d qRTPCR based assay of ABI5, ABCG40, MYB2 and DREB1A transcript abundance in wrky1, WT and C-1. Whiskers represent the SE (n = 3)

Discussion AtWRKY1 (syn. ZAP1) was the first member of this large plant gene family to be isolated in A. thaliana (de Pater et al. 1996). Since it was shown to be inducible by salicylic acid, it has been assumed to act as a regulator of the plant’s response to pathogen attack (Duan et al. 2007). Here, the loss-of-function wrky1 mutant has been shown to exhibit a greater degree of drought tolerance than WT (Fig. 1c), and that stomatal movement (both closure and opening) in the mutant is much more sensitive to ABA treatment than the WT (Fig. 3a, b). The ion channels in the mutant’s guard cells also proved to be very sensitive to ABA treatment (Fig. 5). The level of WRKY1 transcription was initially suppressed by the imposition of either drought or ABA stress, but recovered within a few hours. A reasonable interpretation of these data is that WRKY1 contributes to the initial perception of the stress, rather than to the medium or long term regulation of the plant’s response. The WRKY1 transcription factor binds to W-box domains [(T)(T)TGAC(C/T)] in its targets’ promoter

123

(Eulgem et al. 2000). The W-box domain is too common for its presence to be predictive of interaction with WRKY1. Instead, the search for WRKY1 targets was based on a selection of genes known to be associated with ABA signalling and/or drought stress. As a result, a focus was placed on the four genes ABI5, ABCG40, MYB2 and DREB1A (Figs. 7, 8). ABI5 has been documented to participate in the ABA-mediated inhibition of germination (Lopez-Molina and Chua 2000). In A. thaliana plants transgenically expressing the soybean WRKY gene GsWRKY20, the abundance of ABI5 transcript was suppressed by ABA treatment, although their drought tolerance was superior to that of WT plants (Luo et al. 2013). ABCG40 is a transporter of ABA from the apoplasm into the guard cell, and facilitates ABA-mediated stomatal movement (Kang et al. 2010). A high abundance of ABCG40 transcript can be expected to increase the influx rate of ABA into the guard cell, and thus to accelerate stomatal movement, with a knock-on effect on drought tolerance. The wrky1 with high transcription of MYB2 and sensitivity to ABA is consisting with phenotype of trans-

Plant Mol Biol

Fig. 9 Proposed model for the participation of WRKY1 in ABAregulated stomatal movement and the plant response to drought stress

Fig. 8 WRKY1 binds to the promoters of ABI5, ABCG40, MYB2 and DREB1A. a The distribution of W-Boxes in the promoters. b The EMSA assay verifies that WRKY1 was able to bind to the ABI5, ABCG40, MYB2 and DREB1A promoters. c WRKY1 bound to the promoter regions of ABI5, ABCG40, MYB2 and DREB1A analyzed by ChIP. NC negative control (no W-Box). Whiskers represent the SE (n = 3)

genic plant with over-expression of MYB2, which upregulated several ABA-inducible genes and sensitivity to ABA (Abe et al. 2003). DREB1A itself is a transcription factor, implicated in the plant response to dehydration and freezing. As the over-expression of AtDREB1A increases the level of tolerance to freezing, drought and salinity stress (Liu et al. 1998), its heterologous, constitutive expression has been attempted in a range of crop species, including rice, eggplant, groundnut and lemon (Alvarez-Gerding et al. 2015; Vadez et al. 2013; Wan et al. 2014). Given that three of the WRKY1 target genes are themselves transcription factors, and other reported transcription factors are positively (WRKY57 and ABO3/WRKY63) or negatively (WRKY54 and WRKY70) involved in plant drought or osmotic stress tolerance and ABA regulation of stomatal movements (Ren et al. 2010; Jiang et al. 2012; Li et al. 2013), there is a strong possibility that they, along with WRKY1, form regulatory network active in the sensing of drought and ABA stress, and through their downstream regulated genes to modulate. For example, the ABCG40 and DREB1A are both regulated genes by WRKY54, WRKY70 and WRKY1 and involved in plant drought response (Liu et al. 1998; Kang et al. 2010; Li et al. 2013; Figs. 7, 8), suggesting the common genes and joint signaling components (e.g. the Kþ in ion channels ion channels for direct solute transmembrane-trafficking and consequent osmotically-driven stomatal movements; Fig. 5) are shared downstream of the drought regulated WRKYs.

123

Plant Mol Biol

The overall conclusion is that WRKY1 has a negative role in guard cell trans-membrane ion trafficking and stomatal movement in response to ABA, and thus provokes the plant to surrender the drought. At the molecular level, the suggestion is that WRKY1 transcription is rapidly downregulated by both drought stress and ABA treatment, and that this aids the plant to adapt to the stress. Acting as a transcription factor, WRKY1, probably work together with other transcription factors—directly and/or indirectly— regulates a number of genes involved in ABA signalling and the drought response (Fig. 9).

Accession numbers Relevant sequence were retrieved from the Arabidopsis Genome Initiative database (www.arabidopsis.org) under accession numbers: At3g18780 (ACTIN2), At2g04880 (WRKY1), At2g36270 (ABI5), At1g15520 (ABCG40), At2g47190 (MYB2), At4g25480 (DREB1A). Acknowledgments This research was financially supported by thethe key special project ‘‘Breeding and Cultivation of Novel GM varieties’’ (2014ZX08009-022B), National Natural Science Foundations of China (31170236 and 31271506), Program for New Century Excellent Talents in University (NCET-13-0354) and the Shandong Science Fund for Distinguished Young Scholars (2014JQE27047). The wrky1 T-DNA insertion mutant (Salk_016954) was got from Arabidopsis Biological Resource Center (ABRC).

References Abe H, Urao T, Ito T, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003) Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signalling. Plant Cell 15:63–78 Alvarez-Gerding X, Espinoza C, Inostroza-Blancheteau C, ArceJohnson P (2015) Molecular and physiological changes in response to salt stress in Citrus macrophylla W plants overexpressing Arabidopsis CBF3/DREB1A. Plant Physiol Biochem PPB Societe francaise de physiologie vegetale 92:71–80 Asai T, Tena G, Plotnikova J, Willmann MR, Chiu WL, GomezGomez L, Boller T, Ausubel FM, Sheen J (2002) MAP kinase signalling cascade in Arabidopsis innate immunity. Nature 415:977–983 Ben-Ari G (2012) The ABA signal transduction mechanism in commercial crops: learning from Arabidopsis. Plant Cell Rep 31:1357–1369 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16:735–743 Cochrane TT, Cochrane TA (2009) The vital role of potassium in the osmotic mechanism of stomata aperture modulation and its link with potassium deficiency. Plant Signal Behav 4:240–243 Coursol S, Fan LM, Le Stunff H, Spiegel S, Gilroy S, Assmann SM (2003) Sphingolipid signalling in Arabidopsis guard cells involves heterotrimeric G proteins. Nature 423:651–654 de Pater S, Greco V, Pham K, Memelink J, Kijne J (1996) Characterization of a zinc-dependent transcriptional activator from Arabidopsis. Nucleic Acids Res 24:4624–4631

123

Duan MR, Nan J, Liang YH, Mao P, Lu L, Li L, Wei C, Lai L, Li Y, Su XD (2007) DNA binding mechanism revealed by high resolution crystal structure of Arabidopsis thaliana WRKY1 protein. Nucleic Acids Res 35:1145–1154 Eulgem T, Rushton PJ, Robatzek S, Somssich IE (2000) The WRKY superfamily of plant transcription factors. Trends Plant Sci 5:199–206 Fan LM, Zhang W, Chen JG, Taylor JP, Jones AM, Assmann SM (2008) Abscisic acid regulation of guard-cell K? and anion channels in Gbeta- and RGS-deficient Arabidopsis lines. Proc Natl Acad Sci USA 105:8476–8481 Geiger D, Maierhofer T, Al-Rasheid KA, Scherzer S, Mumm P, Liese A, Ache P, Wellmann C, Marten I, Grill E, Romeis T, Hedrich R (2011) Stomatal closure by fast abscisic acid signaling is mediated by the guard cell anion channel SLAH3 and the receptor RCAR1. Sci Signal 4:ra32 Haring M, Offermann S, Danker T, Horst I, Peterhansel C, Stam M (2007) Chromatin immunoprecipitation: optimization, quantitative analysis and data normalization. Plant Methods 3:11 Hetherington AM (2001) Guard cell signaling. Cell 107:711–714 Hu Y, Chen L, Wang H, Zhang L, Wang F, Yu D (2013) Arabidopsis transcription factor WRKY8 functions antagonistically with its interacting partner VQ9 to modulate salinity stress tolerance. Plant J 74:730–745 Jiang Y, Deyholos MK (2009) Functional characterization of Arabidopsis NaCl-inducible WRKY25 and WRKY33 transcription factors in abiotic stresses. Plant Mol Biol 69:91–105 Jiang Y, Liang G, Yu D (2012) Activated expression of WRKY57 confers drought tolerance in Arabidopsis. Mol Plant 5:1375–1388 Johnson CS, Kolevski B, Smyth DR (2002) TRANSPARENT TESTA GLABRA2, a trichome and seed coat development gene of Arabidopsis, encodes a WRKY transcription factor. Plant Cell 14:1359–1375 Kang J, Hwang JU, Lee M, Kim YY, Assmann SM, Martinoia E, Lee Y (2010) PDR-type ABC transporter mediates cellular uptake of the phytohormone abscisic acid. Proc Natl Acad Sci USA 107:2355–2360 Katul G, Manzoni S, Palmroth S, Oren R (2010) A stomatal optimization theory to describe the effects of atmospheric CO2 on leaf photosynthesis and transpiration. Ann Bot 105:431–442 Kim TH, Bohmer M, Hu H, Nishimura N, Schroeder JI (2010) Guard cell signal transduction network: advances in understanding abscisic acid, CO2, and Ca2? signaling. Annu Rev Plant Biol 61:561–591 Lee SC, Lim CW, Lan W, He K, Luan S (2012) ABA signaling in guard cells entails a dynamic protein–protein interaction relay from the PYL-RCAR family receptors to ion channels. Mol Plant 6:528–538 Li J, Besseau S, To¨ro¨nen P, Sipari N, Kollist H, Holm L, Palva ET (2013) Defense-related transcription factors WRKY70 and WRKY54 modulate osmotic stress tolerance by regulating stomatal aperture in Arabidopsis. New Phytol 200:457–472 Li CL, Wang M, Ma XY, Zhang W (2014) NRGA1, a putative mitochondrial pyruvate carrier, mediates ABA regulation of guard cell ion channels and drought stress responses in Arabidopsis. Mol Plant 7:1508–1521 Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, Yamaguchi-Shinozaki K, Shinozaki K (1998) Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought- and lowtemperature-responsive gene expression, respectively, in Arabidopsis. Plant Cell 10:1391–1406 Lopez-Molina L, Chua NH (2000) A null mutation in a bZIP factor confers ABA-insensitivity in Arabidopsis thaliana. Plant Cell Physiol 41:541–547

Plant Mol Biol Lu P, Zhang SQ, Outlaw WH Jr, Riddle KA (1995) Sucrose: a solute that accumulates in the guard-cell apoplast and guard-cell symplast of open stomata. FEBS Lett 362:180–184 Luo M, Dennis ES, Berger F, Peacock WJ, Chaudhury A (2005) MINISEED3 (MINI3), a WRKY family gene, and HAIKU2 (IKU2), a leucine-rich repeat (LRR) KINASE gene, are regulators of seed size in Arabidopsis. Proc Natl Acad Sci USA 102:17531–17536 Luo X, Bai X, Sun X, Zhu D, Liu B, Ji W, Cai H, Cao L, Wu J, Hu M, Liu X, Tang L, Zhu Y (2013) Expression of wild soybean WRKY20 in Arabidopsis enhances drought tolerance and regulates ABA signalling. J Exp Bot 64:2155–2169 Macrobbie EA (1997) Signalling in guard cells and regulation of ion channel activity. J Exp Bot 48(Spec No):515–528 Okamoto M, Peterson FC, Defries A, Park SY, Endo A, Nambara E, Volkman BF, Cutler SR (2013) Activation of dimeric ABA receptors elicits guard cell closure, ABA-regulated gene expression, and drought tolerance. Proc Natl Acad Sci USA 110:12132–12137 Pandey SP, Somssich IE (2009) The role of WRKY transcription factors in plant immunity. Plant Physiol 150:1648–1655 Pandey S, Zhang W, Assmann SM (2007) Roles of ion channels and transporters in guard cell signal transduction. FEBS Lett 581:2325–2336 Pei ZM, Kuchitsu K, Ward JM, Schwarz M, Schroeder JI (1997) Differential abscisic acid regulation of guard cell slow anion channels in Arabidopsis wild-type and abi1 and abi2 mutants. Plant Cell 9:409–423 Qiu D, Xiao J, Xie W, Liu H, Li X, Xiong L, Wang S (2008) Rice gene network inferred from expression profiling of plants overexpressing OsWRKY13, a positive regulator of disease resistance. Mol Plant 1:538–551 Ren XZ, Chen ZZ, Liu Y, Zhang HR, Zhang M, Liu Q, Hong XH, Zhu JK, Gong ZZ (2010) ABO3, a WRKY transcription factor, mediates plant responses to abscisic acid and drought tolerance in Arabidopsis. Plant J 63:417–429 Robatzek S, Somssich IE (2002) Targets of AtWRKY6 regulation during plant senescence and pathogen defense. Genes Dev 16:1139–1149 Roelfsema MR, Hedrich R (2005) In the light of stomatal opening: new insights into ‘the Watergate’. New Phytol 167:665–691 Roelfsema MR, Levchenko V, Hedrich R (2004) ABA depolarizes guard cells in intact plants, through a transient activation of Rand S-type anion channels. Plant J 37:578–588 Rushton PJ, Somssich IE, Ringler P, Shen QJ (2010) WRKY transcription factors. Trends Plant Sci 15:247–258

Schroeder JI, Allen GJ, Hugouvieux V, Kwak JM, Waner D (2001a) Guard cell signal transduction. Annu Rev Plant Physiol Plant Mol Biol 52:627–658 Schroeder JI, Kwak JM, Allen GJ (2001b) Guard cell abscisic acid signalling and engineering drought hardiness in plants. Nature 410:327–330 Sheen J (2001) Signal transduction in maize and Arabidopsis mesophyll protoplasts. Plant Physiol 127:1466–1475 Tao Z, Kou Y, Liu H, Li X, Xiao J, Wang S (2011) OsWRKY45 alleles play different roles in abscisic acid signalling and salt stress tolerance but similar roles in drought and cold tolerance in rice. J Exp Bot 62:4863–4874 Ulker B, Somssich IE (2004) WRKY transcription factors: from DNA binding towards biological function. Curr Opin Plant Biol 7:491–498 Ulker B, Shahid Mukhtar M, Somssich IE (2007) The WRKY70 transcription factor of Arabidopsis influences both the plant senescence and defense signaling pathways. Planta 226:125–137 Vadez V, Rao JS, Bhatnagar-Mathur P, Sharma KK (2013) DREB1A promotes root development in deep soil layers and increases water extraction under water stress in groundnut. Plant Biol (Stuttg) 15:45–52 Vahisalu T, Kollist H, Wang YF, Nishimura N, Chan WY, Valerio G, Lamminmaki A, Brosche M, Moldau H, Desikan R, Schroeder JI, Kangasjarvi J (2008) SLAC1 is required for plant guard cell S-type anion channel function in stomatal signalling. Nature 452:487–491 Wan F, Pan Y, Li J, Chen X, Wang Y, Tian S, Zhang X (2014) Heterologous expression of Arabidopsis C-repeat binding factor 3 (AtCBF3) and cold-regulated 15A (AtCOR15A) enhanced chilling tolerance in transgenic eggplant (Solanum melongena L.). Plant Cell Rep 33:1951–1961 Wang XQ, Wu WH, Assmann SM (1998) Differential responses of abaxial and adaxial guard cells of broad bean to abscisic acid and calcium. Plant Physiol 118:1421–1429 Wang XQ, Ullah H, Jones AM, Assmann SM (2001) G protein regulation of ion channels and abscisic acid signaling in Arabidopsis guard cells. Science 292:2070–2072 Xiao J, Cheng H, Li X, Xu C, Wang S (2013) Rice WRKY13 regulates cross talk between abiotic and biotic stress signaling pathways by selective binding to different cis-elements. Plant Physiol 163:1868–1882 Zhang W, Nilson SE, Assmann SM (2008) Isolation and whole-cell patch clamping of Arabidopsis guard cell protoplasts. CSH Protoc 2008:pdb prot5014

123