SHORT COMMUNICATION XY Sex Reversal Associated with a Nonsense Mutation KEN D. MCELREAVEY,**’
in SRY
ERIC VILAIN,” CHAFIKA BOUCEKKINE, t MICHEL VIDAUD, $ FRANCOK JAUBERT, 3 FRANCOIS RICHAUD,* AND MARC FELLOUS*
*Unite INSERM U276, Universite Paris VII, Laboratoire d’lmmunogenetique Humaine, lnstitut Pasteur, 25 rue du Dr Roux, 75724 Paris Cedex 15, France; tService d’Endocrinologie, Hopital Bologhine, CHU d’Alger Ouest, Algeria; SLaboratoire de Biologie Moleculaire, lnstitut de Puericulture, 26 Bd Brune, 75014 Paris; and §Hopital Necker-Enfants Malades, 149 rue de Sevres, 75734 Paris Cedex 75, France Received November 7, 1991; revised February 28, 1992
rhea. At presentation she received estrogen therapy, which induced menstruation and slight enlargement of her breasts. Her parents (unrelated) had another child
Sex determination in humans is mediated through the expression of a testis-determining gene on the Y chromosome. In humans, a candidate gene for the testis-determining factor (TDF) that encodes a protein with a putative DNA-binding motif and has been isolated is termed SRY. Here we describe an XY sex-reversed female with pure gonadal dysgenesis who harbors a de nouo nonsense mutation in the SRY open reading frame (SRY-orf). This single-basepair substitution results directly in the formation of a termination codon in the putative SRY DNA-binding motif, presumably leading to a nonfunctional gene product. This brings the number of reported XY sex-reversed females with de nouo mutations in the known SRY-orf to three, each occurring in the putative DNA-binding domain. This proSRY being TDF in vides further evidence to support humans and also indicates the functional importance of the putative DNA-binding domain of the SRY 0 1992 Academic Press, Inc. protein.
A
B
The minimum portion of the human Y chromosome known to contain the testis-determining factor (TDF) is a 35-kb Y-specific sequence located immediately adjacent to the pseudoautosomal boundary (8). Within this region an open reading frame termed SR Y, which fulfills many of the requirements of TDF, has been found (2,6, 8). Genetic evidence equating SRY with TDF comes from two studies of 23 XY females with gonadal dysgenesis (2, 4). In total, three XY sex-reversed women were found who harbored mutations in the SRY-orf, two of which were de nouo. All three mutations (two amino acid substitutions and the third a frameshift mutation) were in the conserved domain of the SRY-orf, which has a putative DNA-binding function (9). Here we describe a sporadic case of an XY female with pure gonadal dysgenesis with a single-basepair substitution in the SRYorf-conserved domain, which directly generates a stop codon presumably resulting in premature translational termination. Propositus (Z.B.) is a single phenotypic female (Algerian) who presented at 20 years for primary amenor1 To whom GENOMICS
0888-X543/92 Copyright All rights
reprint
13, 838-840 $5.00
requests
should
be addressed.
(1992)
Q 1992 by Academic Press, Inc. of reproduction in any form reserved.
838
1 G T C
Leu
-I Gln
G A C
LYS
G A A
i-
TCGATCGA
2
1 G T C
Leu
G A T*
stop
G A A
LYS
L
FIG. 1. (A) Pedigree of the family. Solid symbol indicates the XY sex-reversed female Z.B. The number in the symbol indicates the number of siblings of that sex. Double line indicates related individuals (in this case first cousins). (B) Autoradiogram of sequencing gel of PCRamplified SRY-orf DNA from XY sex-reversed individual Z.B. (2) and her father (1). An asterisk marks the single basepair substitution at position 687 of pY53.3 (8), which converts the codon CAG (glutamine) to TAG (termination codon). Asymmetric PCR amplification was performed as previously described (3), using the oligonucleotides GGAATTCCCTAACTCTAAGTATCAGTGT (bases 529-584; (Ref. (8)) and GGAATTCCGCAAACTGCAATTCTTCGGC (bases 843823: (Ref. (8)). Both oligonucleotides contained a terminal EcoRI site.
SHORT
839
COMMUNICATION
who died shortly after birth. There was no other similar case nor any congenital anomaly on either side of the family (Fig. 1A). The father later remarried and had five normal sons. Somatic examination at 42 years showed a tall macroskele female (weight, 57 kg; height, 170 cm). Pubic and axillary hair were sparse. Breasts were hypotrophic. External genitalia were female with a normal sized clitoris. On rectal examination a small uterus was palpable. Laparotomy revealed two streak gonads, which were removed. Histological examination showed that they consisted of an attenuated cortex composed of loose connective tissue with round basophilic cells associated to epithelial inclusion cysts (Fig. 2). The medulla was more developed, having scant fibroblasts with elongated nuclei, separated by large bundles of collagen. Germ cells and remnants of tubes were not observed. There was no evidence of a tumor. The diagnosis inferred from the clinical and histological data was pure gonadal dysgenesis. Denaturant gradient gel electrophoresis [DGGE; (7)] was performed on the PCR-amplified SR Y-conserved motif of individual Z.B. Heteroduplex formation and gel retardation was observed when this sample was mixed with a normal male and run on a denaturant gradient gel under conditions described elsewhere [data not shown;
(l)]. For direct PCR sequencing, the SRY-conserved motif was amplified asymmetrically by the method of
Gyllensten and Erlich (3) and sequenceddirectly using Sequenase (USB). Sequencing revealed a single-basepair change of a C to T nucleotide (Fig. lB), which changes a glutamine codon (CAG) to a termination codon (TAG). This would therefore result in a truncated and presumably nonfunctional gene product since it affects the putative DNA-binding domain of the protein. The fact that Z.B.‘s father did not harbor this mutation (Fig. 1B) and is therefore de lzouo strongly infers that the mutated SRY protein resulted in an XY female phenotype. The paternity was checked by Southern hybridization using minisatellite DNA probes [data not shown; (5)]. There are now three reported cases of XY sex-reversed females harboring de novo mutations in the SR Yorf. Each mutation is present in the conserved domain and hence potentially may affect the putative DNAbinding activity of the protein (2, 4). There remain 20 documented XY females with no mutation within the known SRY-orf (2, 4). Since the extent of the human SRY gene has not been defined, it cannot be excluded that these sex-reversed individuals arose due to mutations in loci flanking SRY, within the 3%kb Y-chromosomal region proximal to the pseudoautosomal boundary that is critical for human sex determination (8). Such mutations may influence the expression or function of the SRY gene product. Alternatively XY sex reversal may result from Xchromosomal or autosomal mutations in the male sexdetermining/differentiation pathway. In this respect, detailed histological examination of the undifferentiated gonad is necessary to ascertain whether there are remnants of testicular tissue. This could differentiate between mutations occurring in either the testis-determining or testis-differentiation pathway. Histological examination of Z.B.‘s undifferentiated gonad showed no remnants of testicular tissue, which is consistent with a mutation in the testis-determining pathway and, in particular, with a nonsense mutation in the SRY-orf. ACKNOWLEDGMENTS We thank Nicole Souleyreau for technical assistance. K. McElreavey is supported by an INSERM poste vert. This research was supported by a grant from the Ligue Nationale Contre le Cancer.
REFERENCES 1.
2.
FIG. 2. Biopsy of XY female Z.B.‘s left gonad. cortex composed of loose connective tissue with round associated to epithelial inclusion cysts was observed. remnants of tubes.
An attenuated basopbilic cells There were no
3.
Attree, O., Vidaud, D., Vidaud, M., Amselem, S., Lavergne, J. M., and Goossens, M. (1989). Mutations in the catalytic domain of the human coagulation factor IX: Rapid characterization by direct genomic sequencing of DNA fragments displaying an altered melting behavior. Genomics 4: 266-272. Berta, P., Hawkins, J. R., Sinclair, A. H., Taylor, A., Griffith, B. L., Goodfellow, P., and Fellous, M. (1990). Genetic evidence equating SRY and the testis determining factor. Nature 348: 448-450. Gyllensten, U. stranded DNA tion to direct Natl. Sci. USA
B., and Erlich, H. A. (1988). Generation of singleby the polymerase chain reaction and its applicaDNA-sequencing of the HZ&DQA locus. Proc. 85: 7652-7656.
SHORTCOMMUNICATION 4. Jager, R. d., Anvret, man XY female testis determining
M., Hall, K., and Scherer, G. (1990). A huwith a frame/shift mutation in the candidate gene SRY. Nature 348: 452-454.
5.
Jeffreys, specific
6.
Koopman, P., Gubbay, J., Vivian, N., Goodfellow, P., and LovellBadge, R. (1991). Male development of chromosomally female mice transgenic for Sry. Nature 351: 117-121.
7.
A. J., Wilson, “fingerprints”
V., and Thein, of human DNA.
8.
S. L. (1985). IndividualNature 316: 76-79.
Myers, R. M., Maniatis, T., and Lerman, L. S. (1987). Detection and localization of single base pair changes by denaturing gra-
9.
dient gel electrophoresis. In “Methods in Enzymology” (R. Wu, Ed.), Vol. 155, pp. 501-527, Academic Press, San Diego. Sinclair, A. H., Berta, P., Palmer, M. S., Hawkins, J. R., Griffiths, B. L., Smith, M. J., Foster, J. W., Frischauf, A. W., LovellBadge, R., and Goodfellow, P. (1990). A gene from the human sex-determining region encodes a protein with homology to a conserved DNA-binding motif. Nature 346: 240-244. van de Wetering, M., Oosterwegel, M., Dooijes, D., and Clevers, H. (1991). Identification and cloning of TCF-1, a T lymphocytespecific transcription factor containing a sequence-specific HMG box. EMBO. J. 10: 123-132.
in SRY
ERIC VILAIN,” CHAFIKA BOUCEKKINE, t MICHEL VIDAUD, $ FRANCOK JAUBERT, 3 FRANCOIS RICHAUD,* AND MARC FELLOUS*
*Unite INSERM U276, Universite Paris VII, Laboratoire d’lmmunogenetique Humaine, lnstitut Pasteur, 25 rue du Dr Roux, 75724 Paris Cedex 15, France; tService d’Endocrinologie, Hopital Bologhine, CHU d’Alger Ouest, Algeria; SLaboratoire de Biologie Moleculaire, lnstitut de Puericulture, 26 Bd Brune, 75014 Paris; and §Hopital Necker-Enfants Malades, 149 rue de Sevres, 75734 Paris Cedex 75, France Received November 7, 1991; revised February 28, 1992
rhea. At presentation she received estrogen therapy, which induced menstruation and slight enlargement of her breasts. Her parents (unrelated) had another child
Sex determination in humans is mediated through the expression of a testis-determining gene on the Y chromosome. In humans, a candidate gene for the testis-determining factor (TDF) that encodes a protein with a putative DNA-binding motif and has been isolated is termed SRY. Here we describe an XY sex-reversed female with pure gonadal dysgenesis who harbors a de nouo nonsense mutation in the SRY open reading frame (SRY-orf). This single-basepair substitution results directly in the formation of a termination codon in the putative SRY DNA-binding motif, presumably leading to a nonfunctional gene product. This brings the number of reported XY sex-reversed females with de nouo mutations in the known SRY-orf to three, each occurring in the putative DNA-binding domain. This proSRY being TDF in vides further evidence to support humans and also indicates the functional importance of the putative DNA-binding domain of the SRY 0 1992 Academic Press, Inc. protein.
A
B
The minimum portion of the human Y chromosome known to contain the testis-determining factor (TDF) is a 35-kb Y-specific sequence located immediately adjacent to the pseudoautosomal boundary (8). Within this region an open reading frame termed SR Y, which fulfills many of the requirements of TDF, has been found (2,6, 8). Genetic evidence equating SRY with TDF comes from two studies of 23 XY females with gonadal dysgenesis (2, 4). In total, three XY sex-reversed women were found who harbored mutations in the SRY-orf, two of which were de nouo. All three mutations (two amino acid substitutions and the third a frameshift mutation) were in the conserved domain of the SRY-orf, which has a putative DNA-binding function (9). Here we describe a sporadic case of an XY female with pure gonadal dysgenesis with a single-basepair substitution in the SRYorf-conserved domain, which directly generates a stop codon presumably resulting in premature translational termination. Propositus (Z.B.) is a single phenotypic female (Algerian) who presented at 20 years for primary amenor1 To whom GENOMICS
0888-X543/92 Copyright All rights
reprint
13, 838-840 $5.00
requests
should
be addressed.
(1992)
Q 1992 by Academic Press, Inc. of reproduction in any form reserved.
838
1 G T C
Leu
-I Gln
G A C
LYS
G A A
i-
TCGATCGA
2
1 G T C
Leu
G A T*
stop
G A A
LYS
L
FIG. 1. (A) Pedigree of the family. Solid symbol indicates the XY sex-reversed female Z.B. The number in the symbol indicates the number of siblings of that sex. Double line indicates related individuals (in this case first cousins). (B) Autoradiogram of sequencing gel of PCRamplified SRY-orf DNA from XY sex-reversed individual Z.B. (2) and her father (1). An asterisk marks the single basepair substitution at position 687 of pY53.3 (8), which converts the codon CAG (glutamine) to TAG (termination codon). Asymmetric PCR amplification was performed as previously described (3), using the oligonucleotides GGAATTCCCTAACTCTAAGTATCAGTGT (bases 529-584; (Ref. (8)) and GGAATTCCGCAAACTGCAATTCTTCGGC (bases 843823: (Ref. (8)). Both oligonucleotides contained a terminal EcoRI site.
SHORT
839
COMMUNICATION
who died shortly after birth. There was no other similar case nor any congenital anomaly on either side of the family (Fig. 1A). The father later remarried and had five normal sons. Somatic examination at 42 years showed a tall macroskele female (weight, 57 kg; height, 170 cm). Pubic and axillary hair were sparse. Breasts were hypotrophic. External genitalia were female with a normal sized clitoris. On rectal examination a small uterus was palpable. Laparotomy revealed two streak gonads, which were removed. Histological examination showed that they consisted of an attenuated cortex composed of loose connective tissue with round basophilic cells associated to epithelial inclusion cysts (Fig. 2). The medulla was more developed, having scant fibroblasts with elongated nuclei, separated by large bundles of collagen. Germ cells and remnants of tubes were not observed. There was no evidence of a tumor. The diagnosis inferred from the clinical and histological data was pure gonadal dysgenesis. Denaturant gradient gel electrophoresis [DGGE; (7)] was performed on the PCR-amplified SR Y-conserved motif of individual Z.B. Heteroduplex formation and gel retardation was observed when this sample was mixed with a normal male and run on a denaturant gradient gel under conditions described elsewhere [data not shown;
(l)]. For direct PCR sequencing, the SRY-conserved motif was amplified asymmetrically by the method of
Gyllensten and Erlich (3) and sequenceddirectly using Sequenase (USB). Sequencing revealed a single-basepair change of a C to T nucleotide (Fig. lB), which changes a glutamine codon (CAG) to a termination codon (TAG). This would therefore result in a truncated and presumably nonfunctional gene product since it affects the putative DNA-binding domain of the protein. The fact that Z.B.‘s father did not harbor this mutation (Fig. 1B) and is therefore de lzouo strongly infers that the mutated SRY protein resulted in an XY female phenotype. The paternity was checked by Southern hybridization using minisatellite DNA probes [data not shown; (5)]. There are now three reported cases of XY sex-reversed females harboring de novo mutations in the SR Yorf. Each mutation is present in the conserved domain and hence potentially may affect the putative DNAbinding activity of the protein (2, 4). There remain 20 documented XY females with no mutation within the known SRY-orf (2, 4). Since the extent of the human SRY gene has not been defined, it cannot be excluded that these sex-reversed individuals arose due to mutations in loci flanking SRY, within the 3%kb Y-chromosomal region proximal to the pseudoautosomal boundary that is critical for human sex determination (8). Such mutations may influence the expression or function of the SRY gene product. Alternatively XY sex reversal may result from Xchromosomal or autosomal mutations in the male sexdetermining/differentiation pathway. In this respect, detailed histological examination of the undifferentiated gonad is necessary to ascertain whether there are remnants of testicular tissue. This could differentiate between mutations occurring in either the testis-determining or testis-differentiation pathway. Histological examination of Z.B.‘s undifferentiated gonad showed no remnants of testicular tissue, which is consistent with a mutation in the testis-determining pathway and, in particular, with a nonsense mutation in the SRY-orf. ACKNOWLEDGMENTS We thank Nicole Souleyreau for technical assistance. K. McElreavey is supported by an INSERM poste vert. This research was supported by a grant from the Ligue Nationale Contre le Cancer.
REFERENCES 1.
2.
FIG. 2. Biopsy of XY female Z.B.‘s left gonad. cortex composed of loose connective tissue with round associated to epithelial inclusion cysts was observed. remnants of tubes.
An attenuated basopbilic cells There were no
3.
Attree, O., Vidaud, D., Vidaud, M., Amselem, S., Lavergne, J. M., and Goossens, M. (1989). Mutations in the catalytic domain of the human coagulation factor IX: Rapid characterization by direct genomic sequencing of DNA fragments displaying an altered melting behavior. Genomics 4: 266-272. Berta, P., Hawkins, J. R., Sinclair, A. H., Taylor, A., Griffith, B. L., Goodfellow, P., and Fellous, M. (1990). Genetic evidence equating SRY and the testis determining factor. Nature 348: 448-450. Gyllensten, U. stranded DNA tion to direct Natl. Sci. USA
B., and Erlich, H. A. (1988). Generation of singleby the polymerase chain reaction and its applicaDNA-sequencing of the HZ&DQA locus. Proc. 85: 7652-7656.
SHORTCOMMUNICATION 4. Jager, R. d., Anvret, man XY female testis determining
M., Hall, K., and Scherer, G. (1990). A huwith a frame/shift mutation in the candidate gene SRY. Nature 348: 452-454.
5.
Jeffreys, specific
6.
Koopman, P., Gubbay, J., Vivian, N., Goodfellow, P., and LovellBadge, R. (1991). Male development of chromosomally female mice transgenic for Sry. Nature 351: 117-121.
7.
A. J., Wilson, “fingerprints”
V., and Thein, of human DNA.
8.
S. L. (1985). IndividualNature 316: 76-79.
Myers, R. M., Maniatis, T., and Lerman, L. S. (1987). Detection and localization of single base pair changes by denaturing gra-
9.
dient gel electrophoresis. In “Methods in Enzymology” (R. Wu, Ed.), Vol. 155, pp. 501-527, Academic Press, San Diego. Sinclair, A. H., Berta, P., Palmer, M. S., Hawkins, J. R., Griffiths, B. L., Smith, M. J., Foster, J. W., Frischauf, A. W., LovellBadge, R., and Goodfellow, P. (1990). A gene from the human sex-determining region encodes a protein with homology to a conserved DNA-binding motif. Nature 346: 240-244. van de Wetering, M., Oosterwegel, M., Dooijes, D., and Clevers, H. (1991). Identification and cloning of TCF-1, a T lymphocytespecific transcription factor containing a sequence-specific HMG box. EMBO. J. 10: 123-132.
