Home
Search
Collections
Journals
About
Contact us
My IOPscience
ZnO nanorod–templated well-aligned ZrO2 nanotube arrays for fibroblast adhesion and proliferation
This content has been downloaded from IOPscience. Please scroll down to see the full text. 2014 Nanotechnology 25 215102 (http://iopscience.iop.org/0957-4484/25/21/215102) View the table of contents for this issue, or go to the journal homepage for more
Download details: IP Address: 132.236.27.111 This content was downloaded on 11/11/2014 at 23:05
Please note that terms and conditions apply.
Nanotechnology Nanotechnology 25 (2014) 215102 (8pp)
doi:10.1088/0957-4484/25/21/215102
ZnO nanorod–templated well-aligned ZrO2 nanotube arrays for fibroblast adhesion and proliferation Zhisong Lu1,2,3,5, Zhihong Zhu4,5, Jinping Liu4, Weihua Hu1,2,3 and Chang Ming Li1,2,3 1
Chongqing Key Laboratory for Advanced Materials & Technologies of Clean Energies, Southwest University, Chongqing 400715, People’s Republic of China 2 Institute for Clean Energy & Advanced Materials, Southwest University, Chongqing 400715, People’s Republic of China 3 Faculty of Materials & Energy, Southwest University, Chongqing 400715, People’s Republic of China 4 Center for Nanoscience and Nanotechnology, College of Physical Science and Technology, Huazhong Normal University, Wuhan 430079, People’s Republic of China E-mail: [email protected] Received 14 January 2014, revised 12 March 2014 Accepted for publication 31 March 2014 Published 2 May 2014 Abstract
Cellular responses to porous tubular structures have recently been investigated in highly ordered ZrO2 nanotube arrays fabricated with anodization. However, the potential applications of the nanotube arrays are hindered by instrument requirements and substrate limitations, as well as by the complicated processes needed for synthesis. In this work, ZrO2 nanotube arrays were synthesized by in situ hydrolysis of zirconium propoxide with a zinc oxide nanorod array–based template. Fibroblast cells were able to grow on the nanotube array surface with produced elongated filopodia. Studies of the capability of cell growth and the expression of adhesion- and proliferation-related genes reveal that ZrO2 nanotube arrays may provide a better environment for cell adhesion and growth than a flat titanium surface. These findings not only provide fundamental insight into cell response to nanostructures but also provide an opportunity to use a unique approach to fabricate ZrO2 nanotube array structures for potential implant applications. S Online supplementary data available from stacks.iop.org/nano/25/215102/mmedia Keywords: zirconium dioxide, nanotube arrays, cell adhesion, cell proliferation (Some figures may appear in colour only in the online journal) 1. Introduction
titanium surfaces; this provides good passivation and chemical stability, making this material the one most extensively applied. Like TiO2, zirconium dioxide (ZrO2) is another bioinert material that has been utilized as an abutment and a dental implant [7–9]. Because ZrO2 possesses greater mechanical strength and biocompatibility than TiO2, there has recently been an increase in investigations focusing on the fabrication of implantable ZrO2-based or ZrO2-modified materials. In the design of implantable materials, considerable attention has been paid to cell-material interactions because they may determine the eventual success or failure of such
Nowadays, bone implants are widely applied clinically to replace damaged or missing pieces of bone [1, 2]. Development of biocompatible materials that are suitable for implantation usage has attracted a great deal of interest from researchers. Some biocompatible materials, including titanium and its alloys [3, 4], stainless steel [5], and silicone [6] have been reported as implantable materials in clinics. A thin layer of titanium dioxide (TiO2) forms spontaneously on 5
The authors contributed equally to this work.
0957-4484/14/215102+08$33.00
1
© 2014 IOP Publishing Ltd Printed in the UK
Nanotechnology 25 (2014) 215102
Z Lu et al
materials. Cell contact, attachment, and adhesion are regarded as the initial steps in cell-material interactions [10, 11], which may be influenced by the surface chemistry, topography, and roughness of implants, ultimately affecting the formation rate and quality of new tissue [12–17]. In the past, the surface characteristics and chemical compositions of materials were optimized to improve bone healing [18–21]. Currently, as an advancement in nanotechnology, nanoscale patterns on material surfaces are fabricated to modulate cellular behaviors for the enhancement of protein adsorption, cell adhesion, and cell differentiation [22, 23]. Up to now, it has been confirmed that cellular behaviors are sensitive to a variety of surface topologies, which include nanopits, nanoposts, nanocracks, nanotubes, nanorods, and nanoislands [24–30]. Among cell responses to different nanopatterns, a porous surface involving nanotubes has recently received attention. Nanotubes improve osteoblast attachment, function, and proliferation [27] and exhibit very low immunogenicity, eliciting low levels of monocyte activation and cytokine secretion [31]. They may be used in vascular applications to enhance endothelial cell extracellular matrix (ECM) production and motility [15]. To date, cellular responses to nanotubes have been determined mainly from TiO2-based nanotube arrays. Recently, behaviors of mesenchymal stem cells on ZrO2 nanotube arrays have been reported [32], in which highly ordered ZrO2 nanotube arrays were fabricated with a complicated 2-round anodization via an anodization method using a direct current (DC) power supply and 25-volt output. Using this approach, the ZrO2 nanotube arrays can be fabricated only on a Zr substrate. Although ZrO2 nanotubes can be grown on other substrates with atomic layer deposition [33] and carbon nanotube template–based synthesis [34, 35], the obtained nanotubes are all in the form of random powders rather than well-aligned ones. Therefore, the potential applications of the nanotube arrays are greatly hindered by instrument requirements, complicated processes, and substrate limitations. It is a challenge to develop a novel approach for the synthesis of well-aligned ZrO2 nanotubes on different substrates that are comparable to TiO2 nanotubes and to study their cell responses for further understanding of the overall advantages of a porous nanotube-shaped structure in an implant design. In this work, an economical strategy to synthesize wellaligned ZrO2 nanotube arrays on titanium foil was developed. The responses of NIH 3T3 fibroblast cells to ZrO2 nanotube arrays, including cell attachment, cell proliferation, and gene expression, were also investigated in order to demonstrate the great potential of this unique nanotubular structure to be employed as an implantable material.
Figure 1. Strategy for the synthesis of ZrO2 nanotube arrays on titanium foil.
synthesis of the ZrO2 coating layer, was deposited on the ZnO nanorod arrays by dip-coating at a withdrawing speed of ∼100 μL min−1. After 72 h of hydrolysis, the deposited substrate was dried at 100 °C for 30 min and heated at 550 °C for 2 h in air to obtain core-shell structured nanorod arrays. Then the nanorod arrays were immersed in 1% hydrochloric acid aqueous solution at room temperature for 10 min to remove ZnO cores. After the nanotube arrays were washed with deionized water and dried at room temperature, one-dimensional ZrO2 nanotube arrays were obtained. A schematic diagram of the synthesis strategy is shown in figure 1. 2.2. Cell culture and adhesion
The titanium substrate with the freshly synthesized ZrO2 nanotube arrays was cut into small square slices of 1 cm × 1 cm. The slices were placed into 12-well culture plates, followed by UV irradiation for 30 min to sterilize the surface. Fibroblast NIH 3T3 cells were seeded into each well containing the slice and cultured in Dulbecco’s modified eagle’s medium (DMEM) supplemented with 10% FBS in a humidified atmosphere containing 5% CO2 at 37 °C. The slices, which were removed from the culture plates at different intervals, were subsequently used in the scanning electron microscopy (SEM), confocal microscopy, and reverse transcription polymerase chain reaction (RT-PCR) tests described in the following sections.
2. Materials and methods 2.1. Fabrication of ZrO2 nanotube arrays
2.3. Scanning electron microscopy
ZnO nanorod arrays were fabricated as templates on titanium substrate in mild solutions according to our report [36]. 70% Zr[O(CH2)3CH3]4 in 1-propanol solution, the precursor for
Cell samples for the SEM test were prepared as described in our previous works [37, 38]. The cell-attached nanotube 2
Nanotechnology 25 (2014) 215102
Z Lu et al
arrays were washed with 0.01 M PBS (pH 7.4) three times, followed by fixation with 0.25% glutaraldehyde and dehydration with 20%, 40%, 60%, 80%, and 100% ethanol. After being coated with a layer of platinum in a vacuum (20 mV, 70 sec), the slices were measured by SEM. The SEM images were obtained by using a JEOL field emission electron microscope (JSM-6700F) at an accelerating voltage of 5 kV.
core-shell structured nanorod arrays (figure 2(B)). The subsequent acid treatment was able to completely remove the ZnO cores while still retaining the ZrO2 shell structure. In contrast with the reported structures with ZrO2 nanotubes scattered on the surfaces, the ZnO nanorod template approach resulted in uniformly distributed nanotube arrays on the substrate (figure 2(C)). The inset of figure 2(C) represents a nanotube with a wall thickness of ∼20 nm, and the TEM image (figure 2(D)) demonstrates the tubular structure of a single nanotube. Energy dispersive x-ray spectroscopy (EDS) further confirmed the removal of ZnO and the ZrO2 component of the nanotube arrays on the titanium substrate (figure 2(E)). Because it has been reported that nanotubes with inner diameters in the range of 50 to 70 nm are appropriate for cell attachments [42], the synthesized ZrO2 nanotube with an inner diameter of ∼60 nm was expected to be suitable for the subsequent cell response tests. The x-ray diffraction spectrum indicated that the ZrO2 nanotube arrays consisted of a primitive tetragonal phase, which could help explain the substantial stability of the nanotube arrays observed in cell adhesion studies (figure S-1 available in the supplementary data available at stacks.iop.org/nano/25/ 215102/mmedia). NIH 3T3 fibroblast cells were grown on the nanotubular surfaces to investigate the interaction of cells with the ZrO2 nanotube arrays. Confocal micrographs (figure 3) revealed that more cells could be observed on the nanotube arrays as the incubation time was prolonged. Because single cells were distributed on the surface after 2 and 6 h (figures 3(A) and (B)), the increase in the number of cells during this period may be attributed to cell adhesion. After 24 h of incubation, several couples of cells were observed (figure 3(C)), suggesting the division of the cells on the nanotube array surface. The well proliferation of the cells on the surface led to the formation of cell clusters after 48 h (figure 3(D)). SEM images of fibroblast cells cultured at different times (figure S-2 in SI) also showed a trend consistent with that revealed by the confocal microscopy. These results agree substantially with the trend reported in the cell responses to TiO2 nanotubes [16, 27], implying that ZrO2 nanotubes are also suitable for the adhesion and growth of fibroblast cells. Besides the number of cells, the elongated filopodia of cells measuring several hundred micrometers in length are illustrated in figures 3(C) and (D). Because shear stress, hydrostatic pressure, and topographical cues may induce the elongation of filopodia [13, 27], the long filopodia found in this work may have been the result of the favorable mechanical properties of both the ZrO2 and the nanotube structures. SEM was conducted to better illuminate the interaction of tubular surface morphology with the edges of the cells. Figure 4(A) exhibits a 2-hr cultured cell without well-defined filopodia. After 24-hr incubation, the fibroblast cells on the ZrO2 nanotube array surface (figure 4(B)) showed pronounced protrusion of filopodia with a long configuration and a high degree of contraction (higher-magnification image inset in figure 4(B) and figure S-3 in SI). The filopodia appeared to probe the surface and closely contact the nanotubes, in some cases even protruding into the pores. The significant pores, edges, and ledges provided by the nanotubes may have acted as
2.4. Transmission electron microscopy
The ZrO2 nanotubes were scraped from the substrate and sonicated in ethanol. The suspension was dropped onto a Cu grid, followed by evaporation of the solvent in the ambient environment. Transmission electron microscopy (TEM) images were obtained by using a JEOL transmission electron microscope (JEM-2010FEF) at an accelerating voltage of 200 kV. 2.5. Confocal microscopy
20 μl of freshly prepared 1% paraformaldehyde was dropped onto the slice surfaces to fix the attached cells. Then the slices were immersed in 0.1% Triton-X 100 for 1 min. Rhodaminephalloidin (Molecular Probes, Invitrogen, USA) (1:100 in PBS) was used to dye the cells. After being washed with PBS for 5 min, the slices were covered with 20 μl of glycerol to prevent surface drying. Laser scanning confocal microscopy (LSCM) measurement was carried out using Zeiss LSM 510 equipment with an Ar/Kr laser. 2.6. Biocompatibility
The cell-attached slices were transferred to a new 12-well culture plate. A 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was conducted as described in our previous work [39]. Absorbance was measured at a wavelength of 570 nm with the subtraction of the 650 nm background by spectrophotometer. 2.7. Reverse transcription-polymerase chain reaction (RT-PCR)
Cells were removed from the titanium and nanotube surfaces using a cell scraper. Total RNA samples were extracted from the cells using Qiagen’s RNA mini kit. The reverse transcription was conducted using the first-strand synthesis system (Invitrogen, USA) to produce cDNA. The sequences of primers for PCR are shown in table 1. PCR, agarose gel electrophoresis, and products analysis were conducted as reported in our papers [40, 41].
3. Results and discussion The ZnO nanorods with smooth surfaces were successfully aligned on the titanium substrate to serve as templates for the synthesis of ZrO2 nanotube arrays (figure 2(A)). After deposition of ZrO2, the increased diameter, rough surface, and protruding ends of the rods clearly showed the formation of ZnO/ZrO2 3
Nanotechnology 25 (2014) 215102
Z Lu et al
Figure 2. (A) SEM image of ZnO nanorod array; (B) SEM image of core-shell structured ZnO/ZrO2 nanorod array; (C) SEM image of ZrO2
nanotube array—inset is the high-magnification image of the nanotube; (D) TEM image of ZrO2 nanotube; (E) EDS spectrum of ZrO2 nanotube array on the titanium foil. Table 1. PCR primers for adhesion and proliferation related genes.
Gene Name
Sequence (5′ > 3′)
Bases (bp)
Fibronectin upper lower Integrin alpha 5 upper lower Rac1 upper lower CdC42 upper lower GAPDH upper lower
ACGCCCTGGTTTGTACCT TCCATTGCCTTCGCCTAGACA GGCCAGTTCTACACTACCAAA TTGAGGATTCCAGTCGCTGAC AGAGTACATCCCCACCGTCTT AGGCTGGACCGAGAACGAGG CCATCGGAATATGTACCAACT GGCTCTTCTTCGGTTCTG GGAGAAACCTGCCAAGTATGA GTTGCTGTAGCCGTATTC
18 21 21 21 21 21 21 17 21 17
4
Products (bp) 558 569 521 521 220
Nanotechnology 25 (2014) 215102
Z Lu et al
Figure 3. Immunofluorescent images of fibroblast cells on ZrO2 nanotube array after different culture times. (A) 2 h; (B) 6 h; (C) 24 h;
(D) 48 h.
Figure 4. SEM image of fibroblast cell on ZrO2 nanotube array after 2 h (A) and 24 h (B) of culture.
nanocues for the interaction of fibroblast cells with the substrate, further promoting the elongation and the contraction of the filopodia. The results demonstrate that the nanotubes provided the topography for the fibroblast cells to be embedded. This phenomenon is quite similar to the embedding of osetoblast cells and endothelial cells in TiO2 nanotubes [16, 27]. It is well known that a typical proliferation process involves extension and adhesion of the leading cell edges and cell
division. The interaction of filopodia with nanotubes may increase their capability to extend and adhere to leading cell edges, subsequently promoting cell communication and proliferation. An additional noteworthy aspect is the unique geometry of ZrO2 nanotube arrays, which show a 200–300 nm space between adjacent nanotubes (inset of figure 4(B))—much higher than that of TiO2 and ZrO2 nanotubes fabricated by anodic oxidation. This geometry allows the culture medium to 5
Nanotechnology 25 (2014) 215102
Z Lu et al
Figure 5. Growth of fibroblast cells on the flat Ti and the ZrO2
nanotube arrays.
easily penetrate into the nanotube spaces even after coverage of the top surface by the cells, thus enabling the adsorption of medium-contained ECM proteins and a continuous supply of nutrient to the attached cells. As shown in the inset of figure 4(B), the nanotube arrays were covered by a layer of small dots, which probably represents the ECM proteins adsorbed on the nanotubes after a long incubation period. Because ECM is of great importance for cell adhesion and proliferation, the results here indicate that nanotubes can regulate cell behaviors by facilitating ECM deposition. Interestingly, it was found that the adhesion and growth of the cells did not significantly affect the nanotube array structure and its attachment to the titanium substrate. Because the cell adhesion force was reported to be several nN, the interaction force between the nanotubes and the substrate could be estimated to fall in the same range. Currently titanium is the most widely used material for medical applications, including surgical implements and implants. To evaluate the potential of ZrO2 nanotube arrays in biomedical applications, MTT proliferation testing and RTPCR assays were carried out to study the capability of cell growth and the expression of adhesion- and proliferationrelated genes on titanium and nanotube array surfaces. MTT assays are one of the more popular approaches for determining cell growth by measuring absorbance of solution. Yellow MTT can be reduced to purple formazan in the mitochondria of living cells. Thus, the greater the number of cells, the higher the absorbance. As shown in figure 5, the cells on the surface of flat titanium and the nanotube arrays were tested after 6-, 12-, 24-, and 48-hr growth, respectively. The enhancement in the absorbance at 570 nm with the increase in culture period indicates that fibroblast cells can grow on both titanium and nanotube array surfaces. The results are quite consistent with the confocal microscopy data, which show a time-dependent increase in cell numbers on the nanotube arrays. It was observed that after identical culture periods the absorbancies of nanotube array samples were significantly higher than those of titanium samples, indicating a much faster growth rate of the fibroblast cells on the
Figure 6. Expressions of adhesion- and growth-related genes of
fibroblast cells on flat Ti and ZrO2 nanotube array.
nanotube array surface. After 48 h, the absorbance of the nanotube array sample was about 2 times higher than that of the titanium sample. The data demonstrate that ZrO2 nanotube arrays favor the growth of fibroblast cells and, compared with titanium, the nanotube arrays may provide a more biocompatible surface for cell growth. There are two possible explanations for these results: ZrO2 has been clinically used for single-tooth replacement [1, 7], and thus the material itself could provide good biocompatibility. Alternatively, nanotube arrays are likely to provide a rough surface with nanoclues for cell filopodia elongation and adhesion as shown in our SEM measurements, further accelerating the cell division process. With the RT-PCR assay, two pairs of adhesion- and proliferation-related genes were chosen as targets to compare the cell behaviors on titanium and nanotube array surfaces at a gene expression level. Fibronectin is an extracellular matric glycoprotein that binds with integrin, a membrane-spanning receptor, to play a major role in cell adhesion, growth, and migration. Therefore, the expression levels of both fibronectin 1 and integrin α-5 were examined to study cell adhesion and migration on the surfaces. It can be seen from figure 6 that the expression levels of both fibronectin 1 and integrin α-5 were significantly higher in the nanotube array–attached cells than those in the titanium–attached cells. With the experimental parameters in our test, we could not even detect the expression of fibronectin 1 and integrin α-5 genes in flat titanium–grown cells. Based on the data, high levels of fibronectin proteins were secreted into the ECM, providing numerous binding sites on the nanotube array surface for cell adhesion. Meanwhile, over-expressed integrin proteins were transferred to the cell membranes to promote the adhesion, migration, and growth of the fibroblast cells. The expression level of fibronectin 1 and integrin α-5 genes substantially corroborated the cell behaviors discovered in both the 6
Nanotechnology 25 (2014) 215102
Z Lu et al
References
confocal microscopy and SEM tests. These results suggest that the nanotube arrays were able to provide a much better surface for cell adhesion and migration than the flat titanium surface. Genes encoding two cell growth–related proteins (Rac 1 and Cdc 42) were studied to clarify different roles of the flat titanium and the nanotube arrays in fibroblast cell growth. Figure 6 illustrates that the cells on the nanotube arrays had much higher Rac 1 and Cdc 42 gene expression levels when compared with those on the titanium surface. Even though the expression of Cdc 42 could be detected in the titanium samples, the level was still not comparable to that in the cells attached to the nanotube arrays. Defects in Rac 1 and Cdc 42 proteins could have blocked the cell cycle, further affecting the division and proliferation of the cells. On the other hand, high expression levels of these proteins could have reduced the time of the cell cycle and accelerated the cell division and growth rate. Thus, fast proliferation of nanotube array–attached cells was found in the MTT proliferation assay. The results from the MTT proliferation assay and RT-PCR data confirm that a ZrO2 nanotube array possesses better biocompatibility than a conventional titanium surface and may be applied as a potential alternative or complementary material for surgical implements and implants.
[1] Christel P, Meunier A, Dorlot J M, Crolet J M, Witvoet J, Sedel L et al 1988 Biomechanical compatibility and design of ceramic implants for orthopedic surgery Ann. N Y Acad. Sci. 523 234–56 [2] Puleo D A and Nanci A 1999 Understanding and controlling the bone-implant interface Biomaterials 23 2311–21 [3] Yamamoto O, Alvarez K, Kikuchi T and Fukuda M 2009 Fabrication and characterization of oxygen-diffused titanium for biomedical applications Acta. Biomater. 5 3605–15 [4] Wang X J, Li Y C, Xiong J Y, Hodgson P D and Wen C E 2009 Porous TiNbZr alloy scaffolds for biomedical applications Acta. Biomater. 5 3616–24 [5] Elter P, Sickel F and Ewald A 2009 Nanoscaled periodic surface structures of medical stainless steel and their effect on osteoblast cells Acta. Biomater. 5 1468–73 [6] Backovic A, Huang H L, Del Frari B, Piza H, Huber L A and Wick G 2007 Identification and dynamics of proteins adhering to the surface of medical silicones in vivo and in vitro J. Proteome. Res. 1 376–81 [7] Piconi C and Maccauro G 1999 Zirconia as a ceramic biomaterial Biomaterials 1 1–25 [8] Balla V K, Xue W C, Bose S and Bandyopadhyay A 2009 Laser-assisted Zr/ZrO2 coating on Ti for load-bearing implants Acta. Biomater. 5 2800–9 [9] Att W, Takeuchi M, Suzuki T, Kubo K, Anpo M and Ogawa T 2009 Enhanced osteoblast function on ultraviolet lighttreated zirconia Biomaterials 7 1273–80 [10] Grinnell F 1978 Cellular adhesiveness and extracellular substrata Int. Rev. Cytol. 53 65–144 [11] Altankov G, Grinnell F and Groth T 1996 Studies on the biocompatibility of materials: fibroblast reorganization of substratum-bound fibronectin on surfaces varying in wettability J. Biomed. Mater. Res. 3 385–91 [12] Sul Y T, Kang B S, Johansson C, Um H S, Park C J and Albrektsson T 2009 The roles of surface chemistry and topography in the strength and rate of osseointegration of titanium implants in bone J. Biomed. Mater. Res. A 4 942–50 [13] Park J W, Kim Y J, Park C H, Lee D H, Ko Y G, Jang J H et al 2009 Enhanced osteoblast response to an equal channel angular pressing-processed pure titanium substrate with microrough surface topography Acta. Biomater. 5 3272–80 [14] Bretagnol F, Rauscher H, Hasiwa M, Kylian O, Ceccone G, Hazell L et al 2008 The effect of sterilization processes on the bioadhesive properties and surface chemistry of a plasma-polymerized polyethylene glycol film: XPS characterization and L929 cell proliferation tests Acta. Biomater. 4 1745–51 [15] Kalbacova M, Rezek B, Baresova V, Wolf-Brandstetter C and Kromka A 2009 Nanoscale topography of nanocrystalline diamonds promotes differentiation of osteoblasts Acta. Biomater. 5 3076–85 [16] Peng L, Eltgroth M L, LaTempa T J, Grimes C A and Desai T A 2009 The effect of TiO2 nanotubes on endothelial function and smooth muscle proliferation Biomaterials 7 1268–72 [17] Biela S A, Su Y, Spatz J P and Kemkemer R 2009 Different sensitivity of human endothelial cells, smooth muscle cells and fibroblasts to topography in the nano-micro range Acta. Biomater. 5 2460–6 [18] Lincks J, Boyan B D, Blanchard C R, Lohmann C H, Liu Y, Cochran D L et al 1998 Response of MG63 osteoblast-like cells to titanium and titanium alloy is dependent on surface roughness and composition Biomaterials 23 2219–32 [19] Sul Y T, Johansson C B, Petronis S, Krozer A, Jeong Y, Wennerberg A et al 2002 Characteristics of the surface
4. Conclusions In conclusion, ZrO2 nanotube arrays on a titanium surface were fabricated using ZnO nanorod arrays as a template. The fibroblast cells were able to adhere and grow on the nanotubular surface. Elongated filopodia from the cells spread on the surface or even protruded into pores, indicating the strong interaction of the cells with the surface. The fast proliferation rate and high expression levels of adhesion- and proliferationrelated genes in the fibroblast cells grown on the ZrO2 nanotube arrays further confirmed that such nanotube arrays provide a better environment for cell adhesion and growth than does a titanium surface. The results suggest that the ZrO2 nanotube array structure fabricated using the ZnO nanorod–templated approach may be provided as a potential material for surgical implements and implants.
Acknowledgments This work is financially supported by the National Program on Key Basic Research Projects of China (973 Program) under contract No. 2013CB127804, start-up grant under SWU111071 from Southwest University. Z S Lu would like to thank the Fundamental Research Funds for the Central Universities (Grant No. XDJK2012C005) and the Chongqing Key Natural Science Foundation (cstc2012jjA1137) for their support. 7
Nanotechnology 25 (2014) 215102
[20]
[21]
[22] [23] [24]
[25] [26] [27] [28] [29]
[30]
Z Lu et al
[31] Waldeck H and Kao W J 2008 Extended interaction of beta 1 integrin subunit-deficient cells (GD25) with surfaces modified with fibronectin-derived peptides: culture optimization, adhesion and cytokine panel studies Acta. Biomater. 5 1172–86 [32] Bauer S, Park J, Faltenbacher J, Berger S, von der Mark K and Schmuli P 2009 Size selective behavior of mesenchymal stem cells on ZrO2 and TiO2 nanotube arrays Integr. Biol. 1 525–32 [33] Shin H J, Jeong D K, Lee J G, Sung M M and Kim J 2004 Formation of TiO2 and ZrO2 nanotubes using atomic layer deposition with ultraprecise control of the wall thickness Adv. Mater. 14 1197–200 [34] Duszovda A, Dusza J, Tomasek K, Blugan G and Kuebler J 2008 Microstructure and properties of carbon nanotube/ zirconia composite J. Euro. Cer. Soc. 5 1023–7 [35] Lu J, Zang J B, Shan S I, Huang H and Wang Y H 2008 Synthesis and characterization of core-shell structural MWNT-zirconia nanocomposites Nano Lett. 11 4070–4 [36] Liu J P et al 2007 Vertically aligned 1D ZnO nanostructures on bulk alloy substrates: direct solution synthesis, photoluminescence, and field emission J. Phys. Chem. C 13 4990–7 [37] Lu Z S, Qiao Y, Zheng X T, Chan-Park M B and Li C M 2010 Effect of particle shape on phagocytosis of CdTe quantum dot–cystinecomposites. Med. Chem. Commun. 1 84–6 [38] Qiao Y, Bao S J, Li C M, Cui X Q, Lu Z S and Guo J 2008 Nanostructured polyanifine/titanium dioxide composite anode for microbial fuel cells ACS Nano 2 113–9 [39] Bao H F et al 2010 Extracellular microbial synthesis of biocompatible CdTe quantum dots Acta. Biomater. 6 3534–41 [40] Lu Z S, Li C M, Bao H F, Qiao Y, Toh Y H and Yang X 2008 Mechanism of antimicrobial activity of CdTe quantum dots Langmuir 10 5445–52 [41] Lu Z S, Li C M, Bao H F, Qiao Y and Bao Q L 2009 Photophysical mechanism for quantum dots-induced bacterial growth inhibition J. Nanosci. Nanotechnol. 9 3252–5 [42] Oh S, Daraio C, Chen L H, Pisanic T R, Fiñones R R and Jin S 2006 Significantly accelerated osteoblast cell growth on aligned TiO2 nanotubes J. Biomed. Mater. Res. A 78A 97–103
oxides on turned and electrochemically oxidized pure titanium implants up to dielectric breakdown: the oxide thickness, micropore configurations, surface roughness, crystal structure and chemical composition Biomaterials 2 491–501 Cai K Y, Rechtenbach A, Hao J Y, Bossert J and Jandt K D 2005 Polysaccharide-protein surface modification of titanium via a layer-by-layer technique: characterization and cell behaviour aspects Biomaterials 30 5960–71 Dalby M J, Gadegaard N, Tare R, Andar A, Riehle M O, Herzyk P et al 2007 The control of human mesenchymal cell differentiation using nanoscale symmetry and disorder Nat. Mater. 6 997–1003 Anselme K and Bigerelle M 2005 Topography effects of pure titanium substrates on human osteoblast long-term adhesion Acta. Biomater. 1 211–22 Balasundaram G and Webster T J 2006 Nanotechnology and biomaterials for orthopedic medical applications Nanomedicine 2 169–76 Dalby M J, Gadegaard N and Wilkinson C D W 2008 The response of fibroblasts to hexagonal nanotopography fabricated by electron beam lithography J. Biomed. Mater. Res. A 84 973–9 Choi C H, Hagvall S H, Wu B M, Dunn J C, Beygui R E and Kim C J 2007 Cell interaction with three-dimensional sharptip nanotopography Biomaterials 28 1672–9 Zhu X Y, Mills K L, Peters P R, Bahng J H, Liu E H, Shim J et al 2005 Fabrication of reconfigurable protein matrices by cracking Nat. Mater. 4 403–6 Brammer K S, Oh S H, Gallagher J O and Jin S 2008 Enhanced cellular mobility guided by TiO2 nanotube surfaces Nano Lett. 3 786–93 Lee J Y, Kang B S, Hicks B, Chancellor T F Jr, Chu B H, Wang H T et al 2008 The control of cell adhesion and viability by zinc oxide nanorods Biomaterials 27 3743–9 Hu W H, Liu Y S, Zhu Z H, Yang H B and Li C M 2010 Randomly oriented ZnO nanorods as advanced substrate for high-performance protein microarrays ACS Appl. Mater. Interfaces 2 1569–72 Dalby M J, Riehle M O, Johnstone H, Affrossman S and Curtis A S 2002 In vitro reaction of endothelial cells to polymer demixed nanotopography Biomaterials 23 2945–54
8
Search
Collections
Journals
About
Contact us
My IOPscience
ZnO nanorod–templated well-aligned ZrO2 nanotube arrays for fibroblast adhesion and proliferation
This content has been downloaded from IOPscience. Please scroll down to see the full text. 2014 Nanotechnology 25 215102 (http://iopscience.iop.org/0957-4484/25/21/215102) View the table of contents for this issue, or go to the journal homepage for more
Download details: IP Address: 132.236.27.111 This content was downloaded on 11/11/2014 at 23:05
Please note that terms and conditions apply.
Nanotechnology Nanotechnology 25 (2014) 215102 (8pp)
doi:10.1088/0957-4484/25/21/215102
ZnO nanorod–templated well-aligned ZrO2 nanotube arrays for fibroblast adhesion and proliferation Zhisong Lu1,2,3,5, Zhihong Zhu4,5, Jinping Liu4, Weihua Hu1,2,3 and Chang Ming Li1,2,3 1
Chongqing Key Laboratory for Advanced Materials & Technologies of Clean Energies, Southwest University, Chongqing 400715, People’s Republic of China 2 Institute for Clean Energy & Advanced Materials, Southwest University, Chongqing 400715, People’s Republic of China 3 Faculty of Materials & Energy, Southwest University, Chongqing 400715, People’s Republic of China 4 Center for Nanoscience and Nanotechnology, College of Physical Science and Technology, Huazhong Normal University, Wuhan 430079, People’s Republic of China E-mail: [email protected] Received 14 January 2014, revised 12 March 2014 Accepted for publication 31 March 2014 Published 2 May 2014 Abstract
Cellular responses to porous tubular structures have recently been investigated in highly ordered ZrO2 nanotube arrays fabricated with anodization. However, the potential applications of the nanotube arrays are hindered by instrument requirements and substrate limitations, as well as by the complicated processes needed for synthesis. In this work, ZrO2 nanotube arrays were synthesized by in situ hydrolysis of zirconium propoxide with a zinc oxide nanorod array–based template. Fibroblast cells were able to grow on the nanotube array surface with produced elongated filopodia. Studies of the capability of cell growth and the expression of adhesion- and proliferation-related genes reveal that ZrO2 nanotube arrays may provide a better environment for cell adhesion and growth than a flat titanium surface. These findings not only provide fundamental insight into cell response to nanostructures but also provide an opportunity to use a unique approach to fabricate ZrO2 nanotube array structures for potential implant applications. S Online supplementary data available from stacks.iop.org/nano/25/215102/mmedia Keywords: zirconium dioxide, nanotube arrays, cell adhesion, cell proliferation (Some figures may appear in colour only in the online journal) 1. Introduction
titanium surfaces; this provides good passivation and chemical stability, making this material the one most extensively applied. Like TiO2, zirconium dioxide (ZrO2) is another bioinert material that has been utilized as an abutment and a dental implant [7–9]. Because ZrO2 possesses greater mechanical strength and biocompatibility than TiO2, there has recently been an increase in investigations focusing on the fabrication of implantable ZrO2-based or ZrO2-modified materials. In the design of implantable materials, considerable attention has been paid to cell-material interactions because they may determine the eventual success or failure of such
Nowadays, bone implants are widely applied clinically to replace damaged or missing pieces of bone [1, 2]. Development of biocompatible materials that are suitable for implantation usage has attracted a great deal of interest from researchers. Some biocompatible materials, including titanium and its alloys [3, 4], stainless steel [5], and silicone [6] have been reported as implantable materials in clinics. A thin layer of titanium dioxide (TiO2) forms spontaneously on 5
The authors contributed equally to this work.
0957-4484/14/215102+08$33.00
1
© 2014 IOP Publishing Ltd Printed in the UK
Nanotechnology 25 (2014) 215102
Z Lu et al
materials. Cell contact, attachment, and adhesion are regarded as the initial steps in cell-material interactions [10, 11], which may be influenced by the surface chemistry, topography, and roughness of implants, ultimately affecting the formation rate and quality of new tissue [12–17]. In the past, the surface characteristics and chemical compositions of materials were optimized to improve bone healing [18–21]. Currently, as an advancement in nanotechnology, nanoscale patterns on material surfaces are fabricated to modulate cellular behaviors for the enhancement of protein adsorption, cell adhesion, and cell differentiation [22, 23]. Up to now, it has been confirmed that cellular behaviors are sensitive to a variety of surface topologies, which include nanopits, nanoposts, nanocracks, nanotubes, nanorods, and nanoislands [24–30]. Among cell responses to different nanopatterns, a porous surface involving nanotubes has recently received attention. Nanotubes improve osteoblast attachment, function, and proliferation [27] and exhibit very low immunogenicity, eliciting low levels of monocyte activation and cytokine secretion [31]. They may be used in vascular applications to enhance endothelial cell extracellular matrix (ECM) production and motility [15]. To date, cellular responses to nanotubes have been determined mainly from TiO2-based nanotube arrays. Recently, behaviors of mesenchymal stem cells on ZrO2 nanotube arrays have been reported [32], in which highly ordered ZrO2 nanotube arrays were fabricated with a complicated 2-round anodization via an anodization method using a direct current (DC) power supply and 25-volt output. Using this approach, the ZrO2 nanotube arrays can be fabricated only on a Zr substrate. Although ZrO2 nanotubes can be grown on other substrates with atomic layer deposition [33] and carbon nanotube template–based synthesis [34, 35], the obtained nanotubes are all in the form of random powders rather than well-aligned ones. Therefore, the potential applications of the nanotube arrays are greatly hindered by instrument requirements, complicated processes, and substrate limitations. It is a challenge to develop a novel approach for the synthesis of well-aligned ZrO2 nanotubes on different substrates that are comparable to TiO2 nanotubes and to study their cell responses for further understanding of the overall advantages of a porous nanotube-shaped structure in an implant design. In this work, an economical strategy to synthesize wellaligned ZrO2 nanotube arrays on titanium foil was developed. The responses of NIH 3T3 fibroblast cells to ZrO2 nanotube arrays, including cell attachment, cell proliferation, and gene expression, were also investigated in order to demonstrate the great potential of this unique nanotubular structure to be employed as an implantable material.
Figure 1. Strategy for the synthesis of ZrO2 nanotube arrays on titanium foil.
synthesis of the ZrO2 coating layer, was deposited on the ZnO nanorod arrays by dip-coating at a withdrawing speed of ∼100 μL min−1. After 72 h of hydrolysis, the deposited substrate was dried at 100 °C for 30 min and heated at 550 °C for 2 h in air to obtain core-shell structured nanorod arrays. Then the nanorod arrays were immersed in 1% hydrochloric acid aqueous solution at room temperature for 10 min to remove ZnO cores. After the nanotube arrays were washed with deionized water and dried at room temperature, one-dimensional ZrO2 nanotube arrays were obtained. A schematic diagram of the synthesis strategy is shown in figure 1. 2.2. Cell culture and adhesion
The titanium substrate with the freshly synthesized ZrO2 nanotube arrays was cut into small square slices of 1 cm × 1 cm. The slices were placed into 12-well culture plates, followed by UV irradiation for 30 min to sterilize the surface. Fibroblast NIH 3T3 cells were seeded into each well containing the slice and cultured in Dulbecco’s modified eagle’s medium (DMEM) supplemented with 10% FBS in a humidified atmosphere containing 5% CO2 at 37 °C. The slices, which were removed from the culture plates at different intervals, were subsequently used in the scanning electron microscopy (SEM), confocal microscopy, and reverse transcription polymerase chain reaction (RT-PCR) tests described in the following sections.
2. Materials and methods 2.1. Fabrication of ZrO2 nanotube arrays
2.3. Scanning electron microscopy
ZnO nanorod arrays were fabricated as templates on titanium substrate in mild solutions according to our report [36]. 70% Zr[O(CH2)3CH3]4 in 1-propanol solution, the precursor for
Cell samples for the SEM test were prepared as described in our previous works [37, 38]. The cell-attached nanotube 2
Nanotechnology 25 (2014) 215102
Z Lu et al
arrays were washed with 0.01 M PBS (pH 7.4) three times, followed by fixation with 0.25% glutaraldehyde and dehydration with 20%, 40%, 60%, 80%, and 100% ethanol. After being coated with a layer of platinum in a vacuum (20 mV, 70 sec), the slices were measured by SEM. The SEM images were obtained by using a JEOL field emission electron microscope (JSM-6700F) at an accelerating voltage of 5 kV.
core-shell structured nanorod arrays (figure 2(B)). The subsequent acid treatment was able to completely remove the ZnO cores while still retaining the ZrO2 shell structure. In contrast with the reported structures with ZrO2 nanotubes scattered on the surfaces, the ZnO nanorod template approach resulted in uniformly distributed nanotube arrays on the substrate (figure 2(C)). The inset of figure 2(C) represents a nanotube with a wall thickness of ∼20 nm, and the TEM image (figure 2(D)) demonstrates the tubular structure of a single nanotube. Energy dispersive x-ray spectroscopy (EDS) further confirmed the removal of ZnO and the ZrO2 component of the nanotube arrays on the titanium substrate (figure 2(E)). Because it has been reported that nanotubes with inner diameters in the range of 50 to 70 nm are appropriate for cell attachments [42], the synthesized ZrO2 nanotube with an inner diameter of ∼60 nm was expected to be suitable for the subsequent cell response tests. The x-ray diffraction spectrum indicated that the ZrO2 nanotube arrays consisted of a primitive tetragonal phase, which could help explain the substantial stability of the nanotube arrays observed in cell adhesion studies (figure S-1 available in the supplementary data available at stacks.iop.org/nano/25/ 215102/mmedia). NIH 3T3 fibroblast cells were grown on the nanotubular surfaces to investigate the interaction of cells with the ZrO2 nanotube arrays. Confocal micrographs (figure 3) revealed that more cells could be observed on the nanotube arrays as the incubation time was prolonged. Because single cells were distributed on the surface after 2 and 6 h (figures 3(A) and (B)), the increase in the number of cells during this period may be attributed to cell adhesion. After 24 h of incubation, several couples of cells were observed (figure 3(C)), suggesting the division of the cells on the nanotube array surface. The well proliferation of the cells on the surface led to the formation of cell clusters after 48 h (figure 3(D)). SEM images of fibroblast cells cultured at different times (figure S-2 in SI) also showed a trend consistent with that revealed by the confocal microscopy. These results agree substantially with the trend reported in the cell responses to TiO2 nanotubes [16, 27], implying that ZrO2 nanotubes are also suitable for the adhesion and growth of fibroblast cells. Besides the number of cells, the elongated filopodia of cells measuring several hundred micrometers in length are illustrated in figures 3(C) and (D). Because shear stress, hydrostatic pressure, and topographical cues may induce the elongation of filopodia [13, 27], the long filopodia found in this work may have been the result of the favorable mechanical properties of both the ZrO2 and the nanotube structures. SEM was conducted to better illuminate the interaction of tubular surface morphology with the edges of the cells. Figure 4(A) exhibits a 2-hr cultured cell without well-defined filopodia. After 24-hr incubation, the fibroblast cells on the ZrO2 nanotube array surface (figure 4(B)) showed pronounced protrusion of filopodia with a long configuration and a high degree of contraction (higher-magnification image inset in figure 4(B) and figure S-3 in SI). The filopodia appeared to probe the surface and closely contact the nanotubes, in some cases even protruding into the pores. The significant pores, edges, and ledges provided by the nanotubes may have acted as
2.4. Transmission electron microscopy
The ZrO2 nanotubes were scraped from the substrate and sonicated in ethanol. The suspension was dropped onto a Cu grid, followed by evaporation of the solvent in the ambient environment. Transmission electron microscopy (TEM) images were obtained by using a JEOL transmission electron microscope (JEM-2010FEF) at an accelerating voltage of 200 kV. 2.5. Confocal microscopy
20 μl of freshly prepared 1% paraformaldehyde was dropped onto the slice surfaces to fix the attached cells. Then the slices were immersed in 0.1% Triton-X 100 for 1 min. Rhodaminephalloidin (Molecular Probes, Invitrogen, USA) (1:100 in PBS) was used to dye the cells. After being washed with PBS for 5 min, the slices were covered with 20 μl of glycerol to prevent surface drying. Laser scanning confocal microscopy (LSCM) measurement was carried out using Zeiss LSM 510 equipment with an Ar/Kr laser. 2.6. Biocompatibility
The cell-attached slices were transferred to a new 12-well culture plate. A 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was conducted as described in our previous work [39]. Absorbance was measured at a wavelength of 570 nm with the subtraction of the 650 nm background by spectrophotometer. 2.7. Reverse transcription-polymerase chain reaction (RT-PCR)
Cells were removed from the titanium and nanotube surfaces using a cell scraper. Total RNA samples were extracted from the cells using Qiagen’s RNA mini kit. The reverse transcription was conducted using the first-strand synthesis system (Invitrogen, USA) to produce cDNA. The sequences of primers for PCR are shown in table 1. PCR, agarose gel electrophoresis, and products analysis were conducted as reported in our papers [40, 41].
3. Results and discussion The ZnO nanorods with smooth surfaces were successfully aligned on the titanium substrate to serve as templates for the synthesis of ZrO2 nanotube arrays (figure 2(A)). After deposition of ZrO2, the increased diameter, rough surface, and protruding ends of the rods clearly showed the formation of ZnO/ZrO2 3
Nanotechnology 25 (2014) 215102
Z Lu et al
Figure 2. (A) SEM image of ZnO nanorod array; (B) SEM image of core-shell structured ZnO/ZrO2 nanorod array; (C) SEM image of ZrO2
nanotube array—inset is the high-magnification image of the nanotube; (D) TEM image of ZrO2 nanotube; (E) EDS spectrum of ZrO2 nanotube array on the titanium foil. Table 1. PCR primers for adhesion and proliferation related genes.
Gene Name
Sequence (5′ > 3′)
Bases (bp)
Fibronectin upper lower Integrin alpha 5 upper lower Rac1 upper lower CdC42 upper lower GAPDH upper lower
ACGCCCTGGTTTGTACCT TCCATTGCCTTCGCCTAGACA GGCCAGTTCTACACTACCAAA TTGAGGATTCCAGTCGCTGAC AGAGTACATCCCCACCGTCTT AGGCTGGACCGAGAACGAGG CCATCGGAATATGTACCAACT GGCTCTTCTTCGGTTCTG GGAGAAACCTGCCAAGTATGA GTTGCTGTAGCCGTATTC
18 21 21 21 21 21 21 17 21 17
4
Products (bp) 558 569 521 521 220
Nanotechnology 25 (2014) 215102
Z Lu et al
Figure 3. Immunofluorescent images of fibroblast cells on ZrO2 nanotube array after different culture times. (A) 2 h; (B) 6 h; (C) 24 h;
(D) 48 h.
Figure 4. SEM image of fibroblast cell on ZrO2 nanotube array after 2 h (A) and 24 h (B) of culture.
nanocues for the interaction of fibroblast cells with the substrate, further promoting the elongation and the contraction of the filopodia. The results demonstrate that the nanotubes provided the topography for the fibroblast cells to be embedded. This phenomenon is quite similar to the embedding of osetoblast cells and endothelial cells in TiO2 nanotubes [16, 27]. It is well known that a typical proliferation process involves extension and adhesion of the leading cell edges and cell
division. The interaction of filopodia with nanotubes may increase their capability to extend and adhere to leading cell edges, subsequently promoting cell communication and proliferation. An additional noteworthy aspect is the unique geometry of ZrO2 nanotube arrays, which show a 200–300 nm space between adjacent nanotubes (inset of figure 4(B))—much higher than that of TiO2 and ZrO2 nanotubes fabricated by anodic oxidation. This geometry allows the culture medium to 5
Nanotechnology 25 (2014) 215102
Z Lu et al
Figure 5. Growth of fibroblast cells on the flat Ti and the ZrO2
nanotube arrays.
easily penetrate into the nanotube spaces even after coverage of the top surface by the cells, thus enabling the adsorption of medium-contained ECM proteins and a continuous supply of nutrient to the attached cells. As shown in the inset of figure 4(B), the nanotube arrays were covered by a layer of small dots, which probably represents the ECM proteins adsorbed on the nanotubes after a long incubation period. Because ECM is of great importance for cell adhesion and proliferation, the results here indicate that nanotubes can regulate cell behaviors by facilitating ECM deposition. Interestingly, it was found that the adhesion and growth of the cells did not significantly affect the nanotube array structure and its attachment to the titanium substrate. Because the cell adhesion force was reported to be several nN, the interaction force between the nanotubes and the substrate could be estimated to fall in the same range. Currently titanium is the most widely used material for medical applications, including surgical implements and implants. To evaluate the potential of ZrO2 nanotube arrays in biomedical applications, MTT proliferation testing and RTPCR assays were carried out to study the capability of cell growth and the expression of adhesion- and proliferationrelated genes on titanium and nanotube array surfaces. MTT assays are one of the more popular approaches for determining cell growth by measuring absorbance of solution. Yellow MTT can be reduced to purple formazan in the mitochondria of living cells. Thus, the greater the number of cells, the higher the absorbance. As shown in figure 5, the cells on the surface of flat titanium and the nanotube arrays were tested after 6-, 12-, 24-, and 48-hr growth, respectively. The enhancement in the absorbance at 570 nm with the increase in culture period indicates that fibroblast cells can grow on both titanium and nanotube array surfaces. The results are quite consistent with the confocal microscopy data, which show a time-dependent increase in cell numbers on the nanotube arrays. It was observed that after identical culture periods the absorbancies of nanotube array samples were significantly higher than those of titanium samples, indicating a much faster growth rate of the fibroblast cells on the
Figure 6. Expressions of adhesion- and growth-related genes of
fibroblast cells on flat Ti and ZrO2 nanotube array.
nanotube array surface. After 48 h, the absorbance of the nanotube array sample was about 2 times higher than that of the titanium sample. The data demonstrate that ZrO2 nanotube arrays favor the growth of fibroblast cells and, compared with titanium, the nanotube arrays may provide a more biocompatible surface for cell growth. There are two possible explanations for these results: ZrO2 has been clinically used for single-tooth replacement [1, 7], and thus the material itself could provide good biocompatibility. Alternatively, nanotube arrays are likely to provide a rough surface with nanoclues for cell filopodia elongation and adhesion as shown in our SEM measurements, further accelerating the cell division process. With the RT-PCR assay, two pairs of adhesion- and proliferation-related genes were chosen as targets to compare the cell behaviors on titanium and nanotube array surfaces at a gene expression level. Fibronectin is an extracellular matric glycoprotein that binds with integrin, a membrane-spanning receptor, to play a major role in cell adhesion, growth, and migration. Therefore, the expression levels of both fibronectin 1 and integrin α-5 were examined to study cell adhesion and migration on the surfaces. It can be seen from figure 6 that the expression levels of both fibronectin 1 and integrin α-5 were significantly higher in the nanotube array–attached cells than those in the titanium–attached cells. With the experimental parameters in our test, we could not even detect the expression of fibronectin 1 and integrin α-5 genes in flat titanium–grown cells. Based on the data, high levels of fibronectin proteins were secreted into the ECM, providing numerous binding sites on the nanotube array surface for cell adhesion. Meanwhile, over-expressed integrin proteins were transferred to the cell membranes to promote the adhesion, migration, and growth of the fibroblast cells. The expression level of fibronectin 1 and integrin α-5 genes substantially corroborated the cell behaviors discovered in both the 6
Nanotechnology 25 (2014) 215102
Z Lu et al
References
confocal microscopy and SEM tests. These results suggest that the nanotube arrays were able to provide a much better surface for cell adhesion and migration than the flat titanium surface. Genes encoding two cell growth–related proteins (Rac 1 and Cdc 42) were studied to clarify different roles of the flat titanium and the nanotube arrays in fibroblast cell growth. Figure 6 illustrates that the cells on the nanotube arrays had much higher Rac 1 and Cdc 42 gene expression levels when compared with those on the titanium surface. Even though the expression of Cdc 42 could be detected in the titanium samples, the level was still not comparable to that in the cells attached to the nanotube arrays. Defects in Rac 1 and Cdc 42 proteins could have blocked the cell cycle, further affecting the division and proliferation of the cells. On the other hand, high expression levels of these proteins could have reduced the time of the cell cycle and accelerated the cell division and growth rate. Thus, fast proliferation of nanotube array–attached cells was found in the MTT proliferation assay. The results from the MTT proliferation assay and RT-PCR data confirm that a ZrO2 nanotube array possesses better biocompatibility than a conventional titanium surface and may be applied as a potential alternative or complementary material for surgical implements and implants.
[1] Christel P, Meunier A, Dorlot J M, Crolet J M, Witvoet J, Sedel L et al 1988 Biomechanical compatibility and design of ceramic implants for orthopedic surgery Ann. N Y Acad. Sci. 523 234–56 [2] Puleo D A and Nanci A 1999 Understanding and controlling the bone-implant interface Biomaterials 23 2311–21 [3] Yamamoto O, Alvarez K, Kikuchi T and Fukuda M 2009 Fabrication and characterization of oxygen-diffused titanium for biomedical applications Acta. Biomater. 5 3605–15 [4] Wang X J, Li Y C, Xiong J Y, Hodgson P D and Wen C E 2009 Porous TiNbZr alloy scaffolds for biomedical applications Acta. Biomater. 5 3616–24 [5] Elter P, Sickel F and Ewald A 2009 Nanoscaled periodic surface structures of medical stainless steel and their effect on osteoblast cells Acta. Biomater. 5 1468–73 [6] Backovic A, Huang H L, Del Frari B, Piza H, Huber L A and Wick G 2007 Identification and dynamics of proteins adhering to the surface of medical silicones in vivo and in vitro J. Proteome. Res. 1 376–81 [7] Piconi C and Maccauro G 1999 Zirconia as a ceramic biomaterial Biomaterials 1 1–25 [8] Balla V K, Xue W C, Bose S and Bandyopadhyay A 2009 Laser-assisted Zr/ZrO2 coating on Ti for load-bearing implants Acta. Biomater. 5 2800–9 [9] Att W, Takeuchi M, Suzuki T, Kubo K, Anpo M and Ogawa T 2009 Enhanced osteoblast function on ultraviolet lighttreated zirconia Biomaterials 7 1273–80 [10] Grinnell F 1978 Cellular adhesiveness and extracellular substrata Int. Rev. Cytol. 53 65–144 [11] Altankov G, Grinnell F and Groth T 1996 Studies on the biocompatibility of materials: fibroblast reorganization of substratum-bound fibronectin on surfaces varying in wettability J. Biomed. Mater. Res. 3 385–91 [12] Sul Y T, Kang B S, Johansson C, Um H S, Park C J and Albrektsson T 2009 The roles of surface chemistry and topography in the strength and rate of osseointegration of titanium implants in bone J. Biomed. Mater. Res. A 4 942–50 [13] Park J W, Kim Y J, Park C H, Lee D H, Ko Y G, Jang J H et al 2009 Enhanced osteoblast response to an equal channel angular pressing-processed pure titanium substrate with microrough surface topography Acta. Biomater. 5 3272–80 [14] Bretagnol F, Rauscher H, Hasiwa M, Kylian O, Ceccone G, Hazell L et al 2008 The effect of sterilization processes on the bioadhesive properties and surface chemistry of a plasma-polymerized polyethylene glycol film: XPS characterization and L929 cell proliferation tests Acta. Biomater. 4 1745–51 [15] Kalbacova M, Rezek B, Baresova V, Wolf-Brandstetter C and Kromka A 2009 Nanoscale topography of nanocrystalline diamonds promotes differentiation of osteoblasts Acta. Biomater. 5 3076–85 [16] Peng L, Eltgroth M L, LaTempa T J, Grimes C A and Desai T A 2009 The effect of TiO2 nanotubes on endothelial function and smooth muscle proliferation Biomaterials 7 1268–72 [17] Biela S A, Su Y, Spatz J P and Kemkemer R 2009 Different sensitivity of human endothelial cells, smooth muscle cells and fibroblasts to topography in the nano-micro range Acta. Biomater. 5 2460–6 [18] Lincks J, Boyan B D, Blanchard C R, Lohmann C H, Liu Y, Cochran D L et al 1998 Response of MG63 osteoblast-like cells to titanium and titanium alloy is dependent on surface roughness and composition Biomaterials 23 2219–32 [19] Sul Y T, Johansson C B, Petronis S, Krozer A, Jeong Y, Wennerberg A et al 2002 Characteristics of the surface
4. Conclusions In conclusion, ZrO2 nanotube arrays on a titanium surface were fabricated using ZnO nanorod arrays as a template. The fibroblast cells were able to adhere and grow on the nanotubular surface. Elongated filopodia from the cells spread on the surface or even protruded into pores, indicating the strong interaction of the cells with the surface. The fast proliferation rate and high expression levels of adhesion- and proliferationrelated genes in the fibroblast cells grown on the ZrO2 nanotube arrays further confirmed that such nanotube arrays provide a better environment for cell adhesion and growth than does a titanium surface. The results suggest that the ZrO2 nanotube array structure fabricated using the ZnO nanorod–templated approach may be provided as a potential material for surgical implements and implants.
Acknowledgments This work is financially supported by the National Program on Key Basic Research Projects of China (973 Program) under contract No. 2013CB127804, start-up grant under SWU111071 from Southwest University. Z S Lu would like to thank the Fundamental Research Funds for the Central Universities (Grant No. XDJK2012C005) and the Chongqing Key Natural Science Foundation (cstc2012jjA1137) for their support. 7
Nanotechnology 25 (2014) 215102
[20]
[21]
[22] [23] [24]
[25] [26] [27] [28] [29]
[30]
Z Lu et al
[31] Waldeck H and Kao W J 2008 Extended interaction of beta 1 integrin subunit-deficient cells (GD25) with surfaces modified with fibronectin-derived peptides: culture optimization, adhesion and cytokine panel studies Acta. Biomater. 5 1172–86 [32] Bauer S, Park J, Faltenbacher J, Berger S, von der Mark K and Schmuli P 2009 Size selective behavior of mesenchymal stem cells on ZrO2 and TiO2 nanotube arrays Integr. Biol. 1 525–32 [33] Shin H J, Jeong D K, Lee J G, Sung M M and Kim J 2004 Formation of TiO2 and ZrO2 nanotubes using atomic layer deposition with ultraprecise control of the wall thickness Adv. Mater. 14 1197–200 [34] Duszovda A, Dusza J, Tomasek K, Blugan G and Kuebler J 2008 Microstructure and properties of carbon nanotube/ zirconia composite J. Euro. Cer. Soc. 5 1023–7 [35] Lu J, Zang J B, Shan S I, Huang H and Wang Y H 2008 Synthesis and characterization of core-shell structural MWNT-zirconia nanocomposites Nano Lett. 11 4070–4 [36] Liu J P et al 2007 Vertically aligned 1D ZnO nanostructures on bulk alloy substrates: direct solution synthesis, photoluminescence, and field emission J. Phys. Chem. C 13 4990–7 [37] Lu Z S, Qiao Y, Zheng X T, Chan-Park M B and Li C M 2010 Effect of particle shape on phagocytosis of CdTe quantum dot–cystinecomposites. Med. Chem. Commun. 1 84–6 [38] Qiao Y, Bao S J, Li C M, Cui X Q, Lu Z S and Guo J 2008 Nanostructured polyanifine/titanium dioxide composite anode for microbial fuel cells ACS Nano 2 113–9 [39] Bao H F et al 2010 Extracellular microbial synthesis of biocompatible CdTe quantum dots Acta. Biomater. 6 3534–41 [40] Lu Z S, Li C M, Bao H F, Qiao Y, Toh Y H and Yang X 2008 Mechanism of antimicrobial activity of CdTe quantum dots Langmuir 10 5445–52 [41] Lu Z S, Li C M, Bao H F, Qiao Y and Bao Q L 2009 Photophysical mechanism for quantum dots-induced bacterial growth inhibition J. Nanosci. Nanotechnol. 9 3252–5 [42] Oh S, Daraio C, Chen L H, Pisanic T R, Fiñones R R and Jin S 2006 Significantly accelerated osteoblast cell growth on aligned TiO2 nanotubes J. Biomed. Mater. Res. A 78A 97–103
oxides on turned and electrochemically oxidized pure titanium implants up to dielectric breakdown: the oxide thickness, micropore configurations, surface roughness, crystal structure and chemical composition Biomaterials 2 491–501 Cai K Y, Rechtenbach A, Hao J Y, Bossert J and Jandt K D 2005 Polysaccharide-protein surface modification of titanium via a layer-by-layer technique: characterization and cell behaviour aspects Biomaterials 30 5960–71 Dalby M J, Gadegaard N, Tare R, Andar A, Riehle M O, Herzyk P et al 2007 The control of human mesenchymal cell differentiation using nanoscale symmetry and disorder Nat. Mater. 6 997–1003 Anselme K and Bigerelle M 2005 Topography effects of pure titanium substrates on human osteoblast long-term adhesion Acta. Biomater. 1 211–22 Balasundaram G and Webster T J 2006 Nanotechnology and biomaterials for orthopedic medical applications Nanomedicine 2 169–76 Dalby M J, Gadegaard N and Wilkinson C D W 2008 The response of fibroblasts to hexagonal nanotopography fabricated by electron beam lithography J. Biomed. Mater. Res. A 84 973–9 Choi C H, Hagvall S H, Wu B M, Dunn J C, Beygui R E and Kim C J 2007 Cell interaction with three-dimensional sharptip nanotopography Biomaterials 28 1672–9 Zhu X Y, Mills K L, Peters P R, Bahng J H, Liu E H, Shim J et al 2005 Fabrication of reconfigurable protein matrices by cracking Nat. Mater. 4 403–6 Brammer K S, Oh S H, Gallagher J O and Jin S 2008 Enhanced cellular mobility guided by TiO2 nanotube surfaces Nano Lett. 3 786–93 Lee J Y, Kang B S, Hicks B, Chancellor T F Jr, Chu B H, Wang H T et al 2008 The control of cell adhesion and viability by zinc oxide nanorods Biomaterials 27 3743–9 Hu W H, Liu Y S, Zhu Z H, Yang H B and Li C M 2010 Randomly oriented ZnO nanorods as advanced substrate for high-performance protein microarrays ACS Appl. Mater. Interfaces 2 1569–72 Dalby M J, Riehle M O, Johnstone H, Affrossman S and Curtis A S 2002 In vitro reaction of endothelial cells to polymer demixed nanotopography Biomaterials 23 2945–54
8
