Acta Biochim Biophys Sin 2014, 46: 572 – 581 | ª The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. DOI: 10.1093/abbs/gmu040. Advance Access Publication 21 May 2014
Original Article
Characterization of a micro-roughened TiO2/ZrO2 coating: mechanical properties and HBMSC responses in vitro Jiawen Si1, Jianjun Zhang1, Sha Liu2, Wenbin Zhang1, Dedong Yu1, Xudong Wang1, Lihe Guo2,3*, and Steve G.F. Shen1 * 1
Previous studies have shown that using ZrO2 as a second phase to bioceramics can significantly increase the bonding strength of plasma-sprayed composite material. In the present study, micro-roughened titanium dioxide/ zirconia (TiO2/ZrO2) (30 wt% ZrO2) coating and TiO2 coating were plasma-sprayed onto Ti plates. The microstructural characteristics and mechanical properties of both coatings were investigated. Furthermore, the biological behavior and osteogenic differentiation of human bone marrow mesenchymal stem cells (HBMSCs) on both TiO2/ZrO2 and TiO2 coatings were compared. The results indicated that the shear bond strength and microhardness of TiO2/ZrO2 coating were statistically higher than those of TiO2 coating. Scanning electron microscope observation revealed that more irregularly shaped protuberances and denser pores were formed on the surface of TiO2/ ZrO2 coating compared with those of TiO2 coating. Further comparative analysis of HBMSC proliferation and osteogenic differentiation on both coatings showed that significantly higher cellular alkaline phosphatase activity and expression levels of Runx2 and Osterix at day 10 after osteogenic culture were found on TiO2/ZrO2 coating compared with TiO2 coating, while no statistically significant difference in cell proliferation and extracellular calcium deposition was observed. The present study suggests that TiO2/ZrO2 coating may be favorable for dental implant applications.
Keywords plasma spraying; titanium dioxide; zirconia; mechanical property; human bone mesenchymal stem cell; osteogenesis Received: February 14, 2014
Accepted: March 30, 2014
Acta Biochim Biophys Sin (2014) | Volume 46 | Issue 7 | Page 572
Introduction Titanium and its alloys have received worldwide attention in both orthopedic and dental applications due to their superior biocompatibility and favorable clinical responses [1–3]. The use of titanium osseous implants has been an effective and essential treatment modality in dental and orthopedic reconstructive therapy [4,5]. In the past few decades, persistent efforts on surface modification technology have been made to enhance the surface properties of titanium implants based on the evidence that endosseous implant surface is one of the principal factors affecting the process of osteo-integration [6,7]. These surface modification techniques aim at retaining the key bulk properties of titanium and its alloys while modifying the material surface for (i) optimum compatibility with the biological environment, (ii) bioactivity promoting tissue– surface interactions, and (iii) suitability in terms of the physical, chemical, and electrical characteristics required for implant application [1,7,8]. Considerable biological and clinical evidence has been well established that osteoblastic differentiation is promoted on micro-roughened titanium surfaces made by several methods such as acid etching, sandblasting, plasma spraying, or a combination of these, compared with relatively smooth machined titanium surfaces [6,7,9]. A significantly enhanced osteogenic phenotype and mineral deposition in the bone matrix were also observed around the micro-roughened endosseous implant surface in vivo [10]. Titanium dioxide (TiO2), the earliest and most popular dental and orthopedic implant material, has been widely reported to display superior biocompatibility and osteointegrated properties. Micro-roughened surfaces created by
Downloaded from http://abbs.oxfordjournals.org/ at University of Iowa Libraries/Serials Acquisitions on June 15, 2015
Department of Oral and Craniomaxillofacial Science, Ninth People’s Hospital College of Stomatology, Shanghai Jiao Tong University School of Medicine, Shanghai Key Laboratory of Stomatology, Shanghai, China 2 Shanghai United Stem Cell Biotechnology Co. Ltd, Shanghai 200333, China 3 Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, China *Correspondence address. Tel: þ86-21-23271251; Fax: þ86-21-23271251; E-mail: [email protected] (G.S.). Tel: þ86-21-51623022; Fax: þ86-21-54921011; E-mail: [email protected] (L.G.)
Characterization of a micro-roughened TiO2/ZrO2 coating in vitro
Materials and Methods Coating preparation Commercially pure titanium (Cp-Ti, purity .99.85%) plates (diameter, 11 mm; height, 2 mm) and commercial grade TiO2 and ZrO2 powder (diameter, 75–37 mm) were purchased from Beijing General Research Institute of Mining and Metallurgy (Beijing, China). The TiO2/ZrO2 powder was prepared by mixing 30 g ZrO2 with 70 g of TiO2, which were then milled for 6 h at 70 rpm followed by drying in an oven at 908C for 24 h. Prior to coating, the Cp-Ti plates were sandblasted, washed ultrasonically in deionized water, and then cleaned with acetone to remove organic materials. According to the product sheet provided by the manufacturer, 0.2 mm-thick micro-roughened coatings were plasma-sprayed with TiO2/ZrO2 powder onto the Cp-Ti plates using a Praxair-3710 plasma-spray system (Praxair Ltd, Danbury, USA). The plasma power, working distance, flow rate of plasma gas (Ar/H2), and powder feeding rate were 40 kW,
80 mm, 50/6 l/min, and 30 g/min, respectively. As a control, commercial grade TiO2 powders were also plasma-sprayed onto the Cp-Ti plates in a parallel experiment. After surface preparation, all the coated Cp-Ti plates were washed in deionized water and further cleaned ultrasonically in absolute ethanol for three times and air dried.
Coating characterization Scanning electron microscopy (SEM) analysis. A scanning electron microscope (Hitachi-S450; Hitachi, Tokyo, Japan) was used to visualize the surface morphology of both TiO2/ ZrO2 and TiO2 coatings. Bond strength testing. The shear bond strength test of six randomly selected samples in each group was performed using a universal testing instrument (AG-10TA; Shimadzu, Kyoto, Japan). Prior to testing, 12 counter steel rods (diameter, 11 mm; height, 2 cm) were sandblasted and attached to the surface of both TiO2/ZrO2 and TiO2 coatings using epoxy resin glue as an adhesive agent. All the fixtures were clamped and heated in a furnace for 3 h at 1008C, followed by furnace cooling. Then shear bond strength testing was performed at a crosshead speed of 1 mm/min until failure. The shear bond strength was calculated as failure load/ coating area (MPa). Microhardness testing. The microhardness was determined using a Vickers hardness measuring tester (HXD-1000TM, Shanghai, China). Six random indentations were recorded at different points on TiO2/ZrO2 and TiO2 coatings with 50 g load for 15 s. The recorded value was converted into a Vickers hardness number (HV). Surface roughness testing. The surface roughness was assessed using a portable roughness measurement device (MarSurf M 300 C; Mahr GmbH, Go¨ttingen, Germany). The roughness of random points at six TiO2/ZrO2 coatings and six TiO2 coatings was recorded according to the manufacturer’s instruction.
Cell isolation and characterization To isolate HBMSCs, human bone marrow was obtained with written and informed consent from patients with alveolar cleft undergoing autogenous bone grafting. All patients were negative for HIV-I, hepatitis B, and hepatitis C. The appropriate use of human bone marrow was approved by the Institutional Patients and Ethics Committee. HBMSCs were prepared and harvested as reported previously [22,23]. After isolation, the HBMSCs were resuspended in a standard culture medium and cultured in 10 cm dishes. The standard culture medium was prepared with a-minimum essential medium (a-MEM; Invitrogen, Carlsbad, USA) supplemented with 10% fetal bovine serum (Invitrogen), and 1% Acta Biochim Biophys Sin (2014) | Volume 46 | Issue 7 | Page 573
Downloaded from http://abbs.oxfordjournals.org/ at University of Iowa Libraries/Serials Acquisitions on June 15, 2015
TiO2 deposition have been proved to possess enhanced osteointegrated properties [3,6,11]. These studies demonstrated that the proliferation rate and overall osteoblastic functional phenotypes of osteoblasts were significantly increased on microroughened TiO2 surfaces when compared with commercial pure Ti (cpTi) surfaces. However, the potential drawbacks of these coatings are the low mechanical properties and poor chemical stability, which may lead to delamination of the coatings and even implant failure [3,12]. Zirconia (ZrO2), due to its high chemical–thermal stability, strong mechanical strength, and stress-induced phase transformation toughening, is frequently used to reinforce other ceramics [13]. Adding ZrO2 as a second phase has been reported to significantly improve the toughness and the bonding strength of composite material [12–17]. In vitro and in vivo studies have also shown that ZrO2 ceramics display favorable biocompatibility and good osteogenic properties [18–21]. In fact, ZrO2 film produced by cathodic arc deposition on Ti has been shown to elicit enhanced cellular adhesion and alkaline phosphatase (ALP) activity compared with TiO2 [5]. In light of these findings, we hypothesized that adding ZrO2 to TiO2 ceramics may improve the mechanical properties and bioactivity of TiO2 coating on the Ti surface. In the present study, a micro-roughened TiO2/ZrO2 (30 wt% ZrO2) coating on Ti plates was fabricated with the plasma-spray technique. A TiO2 coating was deposited onto Ti plates by the same technique as a control. Both coating microstructure and physical properties were investigated. Furthermore, human bone marrow mesenchymal stem cells (HBMSCs) were seeded on the coating surfaces. The cell attachment, proliferation, in vitro osteogenic differentiation, and osteogenic-specific gene expression profile on both TiO2/ZrO2 and TiO2 coatings were investigated.
Characterization of a micro-roughened TiO2/ZrO2 coating in vitro
Cell seeding and osteogenic induction Prior to cell seeding, both TiO2/ZrO2 and TiO2 coated Cp-Ti plates were gamma sterilized and transferred to 24-well culture plates, rinsed in standard medium alone, and then left to dry overnight in a sterile hood. For immunofluorescence and assessment of cell adhesion and proliferation, P4 HBMSCs were seeded at low density (8 103 cells/well) onto the coatings. For real-time PCR assay and semi-quantitative assessment of ALP activity and calcium deposition, P4 HBMSCs cells were seeded at higher density (5 104 cells/well) onto the coatings to eliminate the potential effect of proliferation on cell differentiation. After seeding for 2 h, 1 ml of standard medium described above was added to cover all the plates. To investigate cells osteogenic differentiation, seeded cells were cultured in osteogenic medium at 24 h after seeding. To validate the culture system, P4 HBMSCs were also grown in 24-well culture plates in a parallel experiment. All cells were incubated for different periods of time with replacement of medium every 2–3 days. Assessment of cell adhesion and proliferation SEM observation. To investigate cell adhesion, P4 HBMSCs were cultured on both TiO2/ZrO2 and TiO2 coatings in standard medium for 24 h. Then HBMSCs for SEM observation were washed with phosphate buffered saline (PBS) and fixed in 2.5% (w/v) glutaraldehyde (Sigma– Aldrich) overnight. All samples were washed three times with PBS and dehydrated in a graded series of ethanol (50%, 70%, 90%, and 100%) for 30 min, respectively, and subsequently critical point-dried with a Polaron E3100 (Quorum Technologies, East Sussex, UK). After sputter coating with a Acta Biochim Biophys Sin (2014) | Volume 46 | Issue 7 | Page 574
thin layer of gold, the morphology of the adherent cells on both coatings was observed by SEM. CCK-8 assay. To investigate cell proliferation, P4 HBMSCs were cultured on both TiO2/ZrO2 and TiO2 coatings in a standard medium for 4 h, 2, 4, 6, and 8 days. Cell proliferation was assessed using a Cell Counting Kit-8 (CCK-8; Dojindo, Kumamoto, Japan). At each predetermined time point, samples were washed three times with PBS to eliminate non-viable cells. Total of 50 ml of CCK-8 solution and 500 ml standard medium were added to each sample and incubated for 3 h in the incubator. Then, 100 ml of the supernatant was transferred to a 96-well plate and measured using a plate reader at a wavelength of 450 nm. Triplicate samples were tested in each group at each incubation time and the absorbance for each of the samples was averaged.
RNA isolation and real-time PCR analysis P4 HBMSCs cultured on both TiO2/ZrO2 and TiO2 coatings in the osteogenic medium and standard medium were harvested at 0, 3, 7 and 10 days. Total RNA was extracted with RNAiso Plus reagent (TaKaRa, Dalian, China) and equivalent amounts of each RNA sample were reverse-transcribed into complementary DNA using a PrimeScript RT-PCR kit (TaKaRa) according to the product sheet provided by the manufacturer. The expression levels of Runx2, Osterix, ALP, OPN, and GAPDH at each time point were determined quantitatively on a real-time PCR machine (ABI 73000 ABI Applied Biosystems, Foster City, USA) with a SYBR Premix Ex Taq kit (TaKaRa), using GAPDH as the control for normalization. The details of primers are listed in Table 1. Data were analyzed using the comparative CT method and expressed as the fold changes [24]. Immunofluorescence analysis P4 HBMSCs cultured on both TiO2/ZrO2 and TiO2 coatings in the osteogenic medium and standard medium at day 7 were fixed with 4% paraformaldehyde solution in PBS for 20 min at room temperature (RT) and washed with PBS three times for 5 min. Samples were then permeabilized with 0.1% Triton X-100 in PBS for 15 min at RT. Nonspecific binding sites were blocked with 5% bovine serum albumin in PBS for 60 min at RT. After co-incubation with primary rabbit polyclonal anti-human osteopontin antibodies (1 : 100; Proteintech Group, Chicago, USA) and primary mouse monoclonal anti-human Runx2 antibodies (1 : 100; ProSci, Poway, USA) overnight at 48C, all the samples were then washed with PBS and co-incubated with Cy3-labeled goat anti-rabbit IgG (1:1000; Beyotime, Beijing, China) and fluorescein (FITC)-labeled goat anti-mouse IgG (1:1000; Beyotime) for 1 h at RT. At the end of incubation, the samples were counterstained with DAPI (1:5000; Beyotime)
Downloaded from http://abbs.oxfordjournals.org/ at University of Iowa Libraries/Serials Acquisitions on June 15, 2015
penicillin-streptomycin (PS) (Invitrogen). All cells were cultured at 378C with 5% CO2 and 100% humidity. After expanding to passage 4 (P4), HBMSCs were characterized by demonstrating their multipotency of adipogenic and osteogenic differentiation. For adipogenic differentiation, P4 HBMSCs were cultured under either adipogenic (standard culture medium, 1023 mM dexamethasone, 0.2 mM indomethacin, 0.5 mM 1-methyl-3-isobutylxanthine, and 1022 mg/ml insulin; all agents from Sigma–Aldrich, USA) or standard culture medium for 14 days in a 12-well culture plate. Oil Red O staining was used to visualize the presence of lipids. For osteogenic differentiation, P4 HBMSCs were cultured under either osteogenic medium (standard culture medium, 0.1 mM ascorbic acid, 10 mM b-glycerophosphate, 1025 mM dexamethasone; all agents from Sigma–Aldrich, St Louis, USA) or standard culture medium up to 21 days in 12-well culture plates. ALP staining and alizarin red staining were used to visualize cellular osteogenic differentiation and extracellular calcium deposition. All medium were changed every 3–5 days.
Characterization of a micro-roughened TiO2/ZrO2 coating in vitro
Table 1. Primer sequences used for real-time PCR analysis of osteogenic-specific gene expression
Gene
Primer sequence (50 !30 )
Accession number
GAPDH
Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
NM_002046.3
COL I ALP OPN
Runx2
to target the cellular nuclei, and then washed with PBS three times. The Cy3, FITC, and DAPI images were taken separately using a fluorescence microscope (DP71; Olympus, Tokyo, Japan) equipped with a digital image capture system (Olympus).
Biochemical assays ALP assay. The ALP activity of P4 HBMSCs cultured on both TiO2/ZrO2 and TiO2 coatings in the osteogenic medium at days 3, 7, and 10 was measured using a p-nitrophenyl phosphate (pNPP) (Sigma–Aldrich) method [24]. Briefly, the cells in each well were washed with PBS and lysed by incubation of 500 ml of 0.1% (w/v) TritonX-100 (Sigma–Aldrich) in 10 mM Tris–HCl (pH 7.4) for 2 h at 48C. Total 50 ml lysate of each sample was mixed with 50 ml pNPP (1 mg/ml) and incubated at 378C for 15 min in a 96-well culture plate. The ALP activity was quantified by measuring the absorbance at 405 nm using a plate reader. The ALP activity was normalized according to the level of total protein content at each time point using a BCA kit (Thermo Scientific, Waltham, USA). Experiments were performed in triplicate for each group. Semi-quantitative ARS assay. Extracellular calcium deposition of P4 HBMSCs cultured on both TiO2/ZrO2 and TiO2 coatings in the osteogenic medium and standard medium at day 21 was determined using a semi-quantitative Alizarin red stain (ARS) assay [24]. Briefly, cells were washed three times with PBS without calcium or magnesium prior to fixation with 4% paraformaldehyde solution in PBS for 20 min at RT. Cell layers were stained with 40 mM Alizarin red (Sigma–Aldrich) solution at pH 4.2 for 10 min and rinsed five times for 15 min with water to reduce nonspecific stain. The Alizarin red on each sample was de-stained in 10 mM sodium phosphate containing 10% cetylpyridinium chloride (Sigma–Aldrich), pH 7.0, for 15 min at RT. The reaction
NM_000088.3 J04948.1 NM_001040058 BC101549.1 BC108920.1
products were transferred to a 96-well culture plate and determined by measuring the absorbance at 562 nm using a plate reader. Experiments were performed in triplicate for each group.
Statistical analysis Data were expressed as the mean + standard deviation unless otherwise noted. Data for these measurements were analyzed using one-way analysis of variance and Student’s t-test. A P value of ,0.05 was considered statistically significant. SPSS 16.0 and Graphpad prism 5 software were used to analyze and demonstrate the statistical significance of the assays. The significance between groups is marked on the graphs.
Results Expansion and characterization of HBMSCs Before cell seeding, adherent spindle-like HBMSCs were successfully isolated and expanded (Fig. 1A). The cellular multipotency of adipogenic and osteogenic differentiation was evidenced by positive staining with Oil Red O staining, ALP assay and alizarin red staining. The presence of lipids, extracellular calcium deposition, and ALP positive cells after adipogenic and osteogenic culture are shown in Fig. 1B – F, respectively. Surface morphology and cell attachment The surface morphology of both TiO2/ZrO2 and TiO2 coatings and cell attachment are shown in Fig. 2. Typical characteristics of plasma-sprayed micro-roughened surfaces are shown in Fig. 2A,B. Glassy surface with small protuberances and micropores could be observed on TiO2 coating surface, while more irregularly shaped protuberances and denser pores of different sizes were observed on the surface of TiO2/ZrO2 coating. When cultured on both micro-roughened Acta Biochim Biophys Sin (2014) | Volume 46 | Issue 7 | Page 575
Downloaded from http://abbs.oxfordjournals.org/ at University of Iowa Libraries/Serials Acquisitions on June 15, 2015
Osterix
GCTCTCCAGAACATCATCC TGCTTCACCACCTTCTTG CAGCCGCTTCACCTACAGC TTTTGTATTCAATCACTGTCTTGCC ACTCCCACTTCATCTGGAACC CCTGTTCAGCTCGTACTGCAT CAGAATGCTGTGTCCTCTGAA GTCAATGGAGTCCTGGCTGT TGAGGAGGAAGTTCACTATGG TTCTTTGTGCCTGCTTTGC GTCTCACTGCCTCTCACTTG CAC ACATCTCCTCCCTTCTG
Characterization of a micro-roughened TiO2/ZrO2 coating in vitro
Figure 2. Surface morphology and cell attachment Glassy surface with small protuberances and micropores could be observed on TiO2 coating surface (A), more irregularly shaped protuberances and denser pores were observed on the surface of TiO2/ZrO2 coating (B). Scanning electron microscopy of adhesion of HBMSCs on TiO2 coating (C) and TiO2/ZrO2 coating (D). HBMSCs attach onto both coatings with a well-spread spindle-like morphology and cell– cell contacts (white arrows). Acta Biochim Biophys Sin (2014) | Volume 46 | Issue 7 | Page 576
Downloaded from http://abbs.oxfordjournals.org/ at University of Iowa Libraries/Serials Acquisitions on June 15, 2015
Figure 1. Expansion and characterization of HBMSCs (A) Light microscopy images of monolayer cultures of HBMSCs at P3 show that these cells are adherent, spindle-like in shape. (B) Oil Red O staining result shows the presence of lipids after P4 HBMSCs were cultured for 14 days in adipogenic medium. (C) Alizarin red staining result shows the formation of extracellular calcium deposits after P4 HBMSCs were cultured for 21 days in osteogenic medium. (D – F) ALP staining shows the enhanced ALP activities of P4 HBMSCs at days 3, 7, and 10 after osteogenic culture. Bar ¼ 200 um.
Characterization of a micro-roughened TiO2/ZrO2 coating in vitro
coatings, HBMSCs showed a well-spread spindle-like morphology, presence of classical pseudopodia, and cell–cell contacts. No differences in cell morphologies were found on either TiO2/ZrO2 or TiO2 coating surfaces (Fig. 2C,D). Additionally, no significant difference was found in the CCK-8 assay of cell proliferation of HBMSCs on both surfaces at each time point (P . 0.05) (Fig. 3).
In vitro osteogenic differentiation of HBMSCs on coatings After osteogenic induction, Runx2, Osterix, ALP, and OPN of HBMSCs on both TiO2/ZrO2 and TiO2 coating surfaces were significantly unregulated compared with cells cultured in standard medium (Fig. 4). Although no significant
Discussion
Figure 3. Cell proliferation of HBMSCs on TiO2/ZrO2 and TiO2 coatings CCK-8 assay of HBMSCs cultured on TiO2/ZrO2 and TiO2 coatings for 0, 2, 4, 6, and 8 days shows no significant difference in cell proliferation on both surfaces at each time point (P . 0.05).
In the present study, we deposited micro-roughened TiO2/ ZrO2 (30 wt% ZrO2) coating and TiO2 coating onto Ti plates, respectively, by plasma-spray technique. Higher shear bond strength and microhardness of TiO2/ZrO2 coating were revealed when compared with TiO2 coating. Further comparative analysis of in vitro HBMSC responses showed that significantly higher cellular ALP activity and expression levels of Runx2 and Osterix at day 10 after osteogenic culture were found on TiO2/ZrO2 coating compared with TiO2 coating,
Table 2. Average shear bond strength, microhardness, and surface roughness of TiO2/ZrO2 and TiO2 coatings
TiO2/ZrO2 coating TiO2 coating
Average shear bond strength (MPa)
Average vickers microhardness (HV)
Average surface roughness (mm)
12.188 + 1.137 9.937 + 0.395
1306.0 + 192.4 825.0 + 124.0
4.413 + 0.489 4.028 + 0.507
Acta Biochim Biophys Sin (2014) | Volume 46 | Issue 7 | Page 577
Downloaded from http://abbs.oxfordjournals.org/ at University of Iowa Libraries/Serials Acquisitions on June 15, 2015
Coating characterization In assessment of the mechanical properties of both TiO2/ ZrO2 and TiO2 coatings, a statistically significant difference in shear bond strength and microhardness of the two groups was certified (Table 2). The mean shear bond strengths of both TiO2/ZrO2 and TiO2 coatings were (12.188 + 1.137) and (9.937 + 0.395) MPa, respectively (P , 0.05). The mean microhardness values of both TiO2/ZrO2 and TiO2 coatings were (1306.0 + 192.4) HV and (825.0 + 124.0) HV, respectively (P , 0.05). However, no significant difference in surface roughness was observed between the two groups (P ¼ 0.25).
difference in osteogenic-specific gene expression levels between TiO2/ZrO2 and TiO2 coating groups on early time points was found, it was worth noting that the expression of the Runx2 at day 10 and Osterix at days 7 and 10 showed a statistically significant higher level (P , 0.05) in HBMSCs on TiO2/ZrO2 coating surfaces than those on TiO2 coating surfaces, indicating higher osteogenic differentiation activity (Fig. 4A,B). To further verify the results of real-time PCR, the immunolocalization of Runx2 and OPN in HBMSCs on both TiO2/ZrO2 and TiO2 coating surfaces was conducted at day 7 after osteogenic induction. HBMSCs cultured in osteogenic medium showed a more intense fluorescence compared with cells cultured in standard medium, revealing the functional alteration and osteogenic differentiation of HBMSCs on both coating surfaces (Fig. 5). All the observation was in agreement with the results of real-time PCR analysis. For further comparing the osteogenic bioactivity of TiO2/ ZrO2 and TiO2 coating surfaces, the ALP activity of HBMSCs on both TiO2/ZrO2 and TiO2 coatings after osteogenic culture was found to be increased with elapsed time, which was in line with the gene expression profiles; the ALP activity of HBMSCs on TiO2/ZrO2 coating at day 10 showed a statistically significant higher level (P , 0.05) than those on TiO2 coating surfaces (Fig. 6). The semiquantitative ARS assay also revealed that HBMSCs on both TiO2/ZrO2 and TiO2 coatings at days 14 and 21 after osteogenic induction demonstrated increased extracellular calcium deposition compared with cells in the standard medium (Fig. 7). However, no significant difference between TiO2/ ZrO2 and TiO2 coating surfaces was observed.
Characterization of a micro-roughened TiO2/ZrO2 coating in vitro
while no statistically significant difference in cell proliferation and extracellular calcium deposition was observed. According to the results of several previous studies, plasma-sprayed composite ceramic coatings containing ZrO2 have been shown to display superior performance in reinforcing ceramic mechanical properties [12–17]. Actually, ZrO2 has been widely accepted as a superior reinforcing agent not only because it possesses a lower Young’s modulus, higher strength, and toughness than other common ceramics, but also because of its unique mechanical reinforcement through crack deflection, dispersion strengthening, and phase transformation toughening, which enabled ZrO2-based ceramics to exhibit higher strength and toughness Acta Biochim Biophys Sin (2014) | Volume 46 | Issue 7 | Page 578
compared with the original ceramics [15,25,26]. In this study, the micro-roughened TiO2/ZrO2 coating had a statistically higher shear bond strength and microhardness value compared with those of TiO2 coating. Interestingly, Kasuga et al. [27] also revealed that the strength and fracture toughness of bulk bioglass could be enhanced by adding ZrO2 as a second phase. Subsequent in vivo experiments indicated that the strength degradation rate of the bioglass added with ZrO2 powders was significantly lower than the bioglass per se [28]. The optimal content of ZrO2 incorporated as a second phase has been reported in several studies with various ceramic compositions. These results suggested that the
Downloaded from http://abbs.oxfordjournals.org/ at University of Iowa Libraries/Serials Acquisitions on June 15, 2015
Figure 4. Real-time PCR measurement of mRNA levels of HBMSCs cultured on TiO2/ZrO2 and TiO2 coatings in osteogenic medium and standard medium (A) Expression level of Runx2 in cells cultured in osteogenic medium was higher than that in cells cultured in standard medium at all time points. Cells cultured on TiO2/ZrO2 surfaces showed a higher Runx2 mRNA expression level than those on TiO2 coating in osteogenic medium at day 10 (*P , 0.05). (B) Expression level of Osterix in cells cultured in osteogenic medium was higher than that in cells cultured in standard medium at all time points. Cells cultured on TiO2/ZrO2 surfaces showed a higher Osterix mRNA expression level than those on TiO2 coating in osteogenic medium at days 7 and 10 (*P , 0.05). (C) Expression level of ALP in cells cultured in osteogenic medium was higher than that in cells cultured in standard medium at most time points (*P , 0.05). (D) Expression level of OPN in cells cultured in osteogenic medium was higher than that in cells cultured in standard medium at all time course (*P , 0.05).
Characterization of a micro-roughened TiO2/ZrO2 coating in vitro
Figure 6. ALP activities of HBMSCs on TiO2/ZrO2 and TiO2 coatings The ALP activity of HBMSCs on TiO2/ZrO2 coating at day 10 showed a statistically higher level than that on TiO2 coating surfaces. *P , 0.05.
Figure 7. Semi-quantitative alizarin red staining for extracellular mineral deposition of HBMSCs on TiO2/ZrO2 and TiO2 coatings HBMSCs cultured on TiO2/ZrO2 and TiO2 coatings in osteogenic medium exhibited statistically higher extracellular calcium deposition compared with cells cultured in standard medium at days 14 and 21. *P , 0.05.
mechanical strength of composite ceramics could be increased with an increase of ZrO2 incorporation rates. Briefly, a loading of 20–50wt% ZrO2 was required to substantially increase the mechanical properties of matrix ceramic [13,15,18,27,29,30]. Due to the different composites of the two coatings, more irregularly shaped protuberances and denser pores of different sizes were observed on the surface of TiO2/ZrO2 coating by SEM. This extensively micro-roughened surface morphology depends strongly on the physical properties and shapes of the feeding powder particles. During plasma spraying, low melting point TiO2 powder is completely melted and forms a glassy phase during fast cooling, while cubic ZrO2 powder with high melting point is only partially melted, resulting in a coating morphology comprising the observed irregularly shaped protuberances and dense pores [12,31]. The osteo-integration of dental and orthopedic implants is dependent on the attachment and proliferation of bone mesenchymal stem cells (BMSCs) on the implant surface [1,9]. These BMSCs are present in bone marrow as highly sensitive cells, undifferentiated and readily influenced by environmental factors. Previous in vivo studies have implied a functional relationship between BMSCs to the implant surface and their bone forming activity [32,33]. In vitro studies have also shown that these cells exhibit a greater initial attachment and proliferation on micro-roughened TiO2 and ZrO2 surfaces compared with smooth Ti surfaces [5,19]. Thus, it is advantageous to use HBMSCs to investigate the surface bioactivity of both TiO2/ZrO2 and TiO2 coatings and simulate the earliest process of osteo-integration in our study. Our results confirmed that the isolated HBMSCs are able to multi-differentiate into adipogenic and osteogenic lineages [9]. SEM observations also showed the attachment and pseudopodia extensions of HBMSCs on both TiO2/ZrO2 and TiO2 coatings after 24 h of culture, which would result in numerous cell–cell interactions, and allow rapid differentiation into the osteogenic lineage [4]. Acta Biochim Biophys Sin (2014) | Volume 46 | Issue 7 | Page 579
Downloaded from http://abbs.oxfordjournals.org/ at University of Iowa Libraries/Serials Acquisitions on June 15, 2015
Figure 5. Immunofluorescence for in vitro osteogenic differentiation of HBMSCs Immunofluorescence labeling of Runx2 (FITC, Green), OPN (Cy3, Red) and nucleus (DAPI, Blue) of HBMSCs on TiO2/ZrO2 (A – E) and TiO2 coatings (F –J) cultured in osteogenic/standard medium for 7 days. HBMSCs cultured on TiO2/ZrO2 coating (A: DAPI image, B: Cy3 image, C: FITC image, D: merged image) and TiO2 coating (F: DAPI image, G: Cy3 image, H: FITC image, I: merged image) in osteogenic medium exhibited a more intense fluorescence of Cy3 and FITC compared with cells cultured in standard medium (E, J: merged images).
Characterization of a micro-roughened TiO2/ZrO2 coating in vitro
Acta Biochim Biophys Sin (2014) | Volume 46 | Issue 7 | Page 580
and nano-structural properties [1,7,9,19,37]. We failed to further study the cause for the slightly enhanced osteogenic behavior of HBMSCs on TiO2/ZrO2 coating. In conclusion, the major feature of the this study resided in the facts that plasma-sprayed TiO2/ZrO2 (30 wt% ZrO2) coating may be more favorable than TiO2 coating per se in being of higher shear bond strength, microhardness, osteocompatibility, and being simple and inexpensive in manufacturing. SEM observation revealed that more irregularlyshaped protuberances and denser pores were formed on the surface of TiO2/ZrO2 coating compared with TiO2 coating. Further comparative analysis of cell proliferation and osteogenic differentiation using the HBMSCs as an in vitro osteo-integration model showed that significantly higher cellular ALP activity and expression levels of Runx2 and Osterix at day 10 after osteogenic culture were found on TiO2/ZrO2 coating compared with TiO2 coating, while no statistically significant difference of cell proliferation and extracellular calcium deposition was observed. However, the slightly enhanced biological behavior of HBMSCs on TiO2/ ZrO2 coating needs to be further investigated. The results of this study suggested that TiO2/ZrO2 coating has a promising potential for dental implant application. Further study will involve the fabrication of TiO2/ZrO2-coated implants and systemic analysis of biological responses in vivo.
Funding This work was supported by the grants from the National Natural Science Foundation of China (81371122 and 81300842).
References 1. Brammer KS, Choi C, Frandsen CJ, Oh S, Johnston G and Jin S. Comparative cell behavior on carbon-coated TiO2 nanotube surfaces for osteoblasts vs. osteo-progenitor cells. Acta Biomater 2011, 7: 2697 –2703. 2. Sugita Y, Ishizaki K, Iwasa F, Ueno T, Minamikawa H, Yamada M and Suzuki T, et al. Effects of pico-to-nanometer-thin TiO2 coating on the biological properties of microroughened titanium. Biomaterials 2011, 32: 8374 – 8384. 3. Tiainen H, Monjo M, Knychala J, Nilsen O, Lyngstadaas SP, Ellingsen JE and Haugen HJ. The effect of fluoride surface modification of ceramic TiO2 on the surface properties and biological response of osteoblastic cells in vitro. Biomed Mater 2011, 6: 045006. 4. Meretoja VV, De Ruijter AE, Peltola TO, Jansen JA and Narhi TO. Osteoblast differentiation with titania and titania-silica-coated titanium fiber meshes. Tissue Eng 2005, 11: 1489 – 1497. 5. Zhang S, Sun J, Xu Y, Qian S, Wang B, Liu F and Liu X. Biological behavior of osteoblast-like cells on titania and zirconia films deposited by cathodic arc deposition. Biointerphases 2012, 7: 60. 6. Guo J, Padilla RJ, Ambrose W, De Kok IJ and Cooper LF. The effect of hydrofluoric acid treatment of TiO2 grit blasted titanium implants on adherent osteoblast gene expression in vitro and in vivo. Biomaterials 2007, 28: 5418 – 5425.
Downloaded from http://abbs.oxfordjournals.org/ at University of Iowa Libraries/Serials Acquisitions on June 15, 2015
However, no statistically significant difference in cell proliferation during the exponential phase of growth was observed in CCK-8 assay. ALP has been widely recognized as an important early indicator for osteoblast differentiation, and ALP activity is elevated when BMSCs begin osteogenic differentiation and shows significant differences in terms of different adherent substrates [4,34]. Our results showed that the ALP activity of HBMSCs on both TiO2/ZrO2 and TiO2 coatings after osteogenic culture was up-regulated with elapsed time. In addition, the ALP activity of HBMSCs on TiO2/ZrO2 coating was higher than that on TiO2 coating at day 10, which indicate that TiO2/ZrO2 coating may lead to promotion of a more osteoblastic phenotype than TiO2 coating [1,5]. Moreover, the degree of osteogenesis was also evaluated by semiquantitative ARS assay, a simple and convenient method for detecting extracellular mineral deposition. Our results showed that the mineralization on both coatings was significantly up-regulated after being cultured in osteogenic medium. However, no significant difference in extracellular mineral deposition between TiO2/ZrO2 and TiO2 coatings was found. As specific markers of osteogenesis, the gene expression levels of Runx2, Osterix, ALP, and OPN at 3, 7, and 10 days after osteogenic induction were analyzed using real-time PCR. These genes in HBMSCs on both TiO2/ZrO2 and TiO2 coatings were significantly up-regulated with elapsed time, when compared with cells cultured in standard medium. It should be noted that expression levels of two key osteoinductive transcription factors, Runx2 and Osterix, were statistically higher at day 10 in HBMSCs on TiO2/ZrO2 coating than those on TiO2 coating. As the early key transcription factors associated with osteoblast differentiation, Runx2 and Osterix, have been shown to play a key role in the osteoblast differentiation and osteogenic-specific gene expression such as ALP, Col I, and OCN [35]. In a previous study, both Runx2 and Osterix expression levels were observed to be higher in MC3T3-E1 cells adhered to TiO2/ HF treated surfaces than those adhered to TiO2 grit-blasted surfaces at days 3 and 7 [6]. Another study also reported that HBMSCs on TiO2/HF treated surfaces displayed higher BSP expression when compared with HBMSCs on TiO2 gritblasted surfaces [36]. To further verify the results of realtime PCR, the immunolocalization of OPN and Runx2 in HBMSCs on both TiO2/ZrO2 and TiO2 coating surfaces was investigated by immunofluorescence assay at day 7 after osteogenic induction. Our results showed that HBMSCs cultured in osteogenic medium exhibited a more intense expression of OPN and Runx2 on both coatings compared with cells cultured in standard medium, indicating the functional alteration and osteogenic differentiation of HBMSCs. However, the osteogenic responses to different biocompatible coatings are still largely unknown, which may involve complicated surface properties such as surface chemistries, charge densities
Characterization of a micro-roughened TiO2/ZrO2 coating in vitro
22. Granja PL, De Jeso B, Bareille R, Rouais F, Baquey C and Barbosa MA. Mineralization of regenerated cellulose hydrogels induced by human bone marrow stromal cells. Eur Cell Mater 2005, 10: 31 – 37. 23. Jagodzinski M, Drescher M, Zeichen J, Hankemeier S, Krettek C, Bosch U and van Griensven M. Effects of cyclic longitudinal mechanical strain and dexamethasone on osteogenic differentiation of human bone marrow stromal cells. Eur Cell Mater 2004, 7: 35– 41. 24. Tan F, Naciri M, Dowling D and Al-Rubeai M. In vitro and in vivo bioactivity of CoBlast hydroxyapatite coating and the effect of impaction on its osteoconductivity. Biotechnol Adv 2012, 30: 352– 362. 25. Hannink RHJ, Kelly PM and Muddle BC. Transformation toughening in zirconia-containing ceramics. J Am Ceram Soc 2004, 83: 461– 487. 26. Pittayachawan P, McDonald A, Young A and Knowles JC. Flexural strength, fatigue life, and stress-induced phase transformation study of Y-TZP dental ceramic. J Biomed Mater Res B 2009, 88B: 366 – 377. 27. Kasuga T, Nakajima K, Uno T and Yoshida M. Preparation of zirconiatoughened bioactive glass-ceramic composite by Sinter– Hot isostatic pressing. J Am Ceram Soc 1992, 75: 1103– 1107. 28. Kasuga T, Yoshida M, Ikushima AJ, Tuchiya M and Kusakari H. Stability of zirconia-toughened bioactive glass-ceramics: in vivo study using dogs. J Mater Sci Mater Med 1993, 4: 36 –39. 29. Ioku K, Yoshimura M and Somiya S. Microstructure and mechanical properties of hydroxyapatite ceramics with zirconia dispersion prepared by postsintering. Biomaterials 1990, 11: 57 – 61. 30. Li J, Liao H and Hermansson L. Sintering of partially-stabilized zirconia and partially-stabilized zirconia – hydroxyapatite composites by hot isostatic pressing and pressureless sintering. Biomaterials 1996, 17: 1787– 1790. 31. Fu L, Aik Khor K and Peng Lim J. The evaluation of powder processing on microstructure and mechanical properties of hydroxyapatite (HA)/yttria stabilized zirconia (YSZ) composite coatings. Surf Coat Tech 2001, 140: 263 – 268. 32. Davies JE. Understanding peri-implant endosseous healing. J Dent Educ 2003, 67: 932– 949. 33. Hu Y, Cai K, Luo Z, Zhang Y, Li L, Lai M and Hou Y, et al. Regulation of the differentiation of mesenchymal stem cells in vitro and osteogenesis in vivo by microenvironmental modification of titanium alloy surfaces. Biomaterials 2012, 33: 3515– 3528. 34. Lian JB and Stein GS. Concepts of osteoblast growth and differentiation: basis for modulation of bone cell development and tissue formation. Crit Rev Oral Biol Med 1992, 3: 269 – 305. 35. Harada H, Tagashira S, Fujiwara M, Ogawa S, Katsumata T, Yamaguchi A and Komori T, et al. Cbfa1 isoforms exert functional differences in osteoblast differentiation. J Biol Chem 1999, 274: 6972 –6978. 36. Cooper LF, Zhou Y, Takebe J, Guo J, Abron A, Holme´n A and Ellingsen JE. Fluoride modification effects on osteoblast behavior and bone formation at TiO2 grit-blasted c.p. titanium endosseous implants. Biomaterials 2006, 27: 926 –936. 37. Jager M, Urselmann F, Witte F, Zanger K, Li X, Ayers DC and Krauspe R. Osteoblast differentiation onto different biometals with an endoprosthetic surface topography in vitro. J Biomed Mater Res A 2008, 86: 61 – 75.
Acta Biochim Biophys Sin (2014) | Volume 46 | Issue 7 | Page 581
Downloaded from http://abbs.oxfordjournals.org/ at University of Iowa Libraries/Serials Acquisitions on June 15, 2015
7. Itala A, Ylanen HO, Yrjans J, Heino T, Hentunen T, Hupa M and Aro HT. Characterization of microrough bioactive glass surface: surface reactions and osteoblast responses in vitro. J Biomed Mater Res 2002, 62: 404 – 411. 8. Chen CC, Huang TH, Kao CT and Ding SJ. Characterization of functionally graded hydroxyapatite/titanium composite coatings plasma-sprayed on Ti alloys. J Biomed Mater Res B 2006, 78: 146 – 152. 9. Garcia-Gareta E, Hua J, Knowles JC and Blunn GW. Comparison of mesenchymal stem cell proliferation and differentiation between biomimetic and electrochemical coatings on different topographic surfaces. J Mater Sci Mater Med 2013, 24: 199 – 210. 10. Takeuchi K, Saruwatari L, Nakamura HK, Yang JM and Ogawa T. Enhanced intrinsic biomechanical properties of osteoblastic mineralized tissue on roughened titanium surface. J Biomed Mater Res A 2005, 72: 296 – 305. 11. Wang X, Gittens RA, Song R, Tannenbaum R, Olivares-Navarrete R, Schwartz Z and Chen H, et al. Effects of structural properties of electrospun TiO2 nanofiber meshes on their osteogenic potential. Acta Biomater 2012, 8: 878 – 885. 12. Khor KA, Gu YW, Pan D and Cheang P. Microstructure and mechanical properties of plasma sprayed HA/YSZ/Ti-6Al-4V composite coatings. Biomaterials 2004, 25: 4009– 4017. 13. Chou BY and Chang E. Microstructural characterization of plasma-sprayed hydroxyapatite-10 wt% ZrO2 composite coating on titanium. Biomaterials 1999, 20: 1823– 1832. 14. Xie Y, Zheng X, Ding C, Zhai W, Chang J and Ji H. Preparation and characterization of CaO– ZrO2 – SiO2 coating for potential application in biomedicine. J Thermal Spray Technol 2009, 18: 678 – 685. 15. Ahn ES, Gleason NJ and Ying JY. The effect of zirconia reinforcing agents on the microstructure and mechanical properties of hydroxyapatite-based nanocomposites. J Am Ceram Soc 2005, 88: 3374– 3379. 16. Martorana S, Fedele A, Mazzocchi M and Bellosi A. Surface coatings of bioactive glasses on high strength ceramic composites. Appl Surf Sci 2009, 255: 6679– 6685. 17. Verne´ E, Defilippi R, Carl G, Vitale Brovarone C and Appendino P. Viscous flow sintering of bioactive glass-ceramic composites toughened by zirconia particles. J Eur Ceram Soc 2003, 23: 675 – 683. 18. Kasuga T, Yoshida M, Ikushima AJ, Tuchiya M and Kusakari H. Bioactivity of zirconia-toughened glass-ceramics. J Am Ceram Soc 1992, 75: 1884 –1888. 19. Bauer S, Park J, Faltenbacher J, Berger S, von der Mark K and Schmuki P. Size selective behavior of mesenchymal stem cells on ZrO2 and TiO2 nanotube arrays. Integr Biol (Camb) 2009, 1: 525– 532. 20. Xie Y, Liu X, Ding C and Chu PK. Bioconductivity and mechanical properties of plasma-sprayed dicalcium silicate/zirconia composite coating. Mater Sci Eng C 2005, 25: 509 – 515. 21. Lee TM, Yang CY, Chang E and Tsai RS. Comparison of plasmasprayed hydroxyapatite coatings and zirconia-reinforced hydroxyapatite composite coatings: in vivo study. J Biomed Mater Res A 2004, 71A: 652 – 660.
Original Article
Characterization of a micro-roughened TiO2/ZrO2 coating: mechanical properties and HBMSC responses in vitro Jiawen Si1, Jianjun Zhang1, Sha Liu2, Wenbin Zhang1, Dedong Yu1, Xudong Wang1, Lihe Guo2,3*, and Steve G.F. Shen1 * 1
Previous studies have shown that using ZrO2 as a second phase to bioceramics can significantly increase the bonding strength of plasma-sprayed composite material. In the present study, micro-roughened titanium dioxide/ zirconia (TiO2/ZrO2) (30 wt% ZrO2) coating and TiO2 coating were plasma-sprayed onto Ti plates. The microstructural characteristics and mechanical properties of both coatings were investigated. Furthermore, the biological behavior and osteogenic differentiation of human bone marrow mesenchymal stem cells (HBMSCs) on both TiO2/ZrO2 and TiO2 coatings were compared. The results indicated that the shear bond strength and microhardness of TiO2/ZrO2 coating were statistically higher than those of TiO2 coating. Scanning electron microscope observation revealed that more irregularly shaped protuberances and denser pores were formed on the surface of TiO2/ ZrO2 coating compared with those of TiO2 coating. Further comparative analysis of HBMSC proliferation and osteogenic differentiation on both coatings showed that significantly higher cellular alkaline phosphatase activity and expression levels of Runx2 and Osterix at day 10 after osteogenic culture were found on TiO2/ZrO2 coating compared with TiO2 coating, while no statistically significant difference in cell proliferation and extracellular calcium deposition was observed. The present study suggests that TiO2/ZrO2 coating may be favorable for dental implant applications.
Keywords plasma spraying; titanium dioxide; zirconia; mechanical property; human bone mesenchymal stem cell; osteogenesis Received: February 14, 2014
Accepted: March 30, 2014
Acta Biochim Biophys Sin (2014) | Volume 46 | Issue 7 | Page 572
Introduction Titanium and its alloys have received worldwide attention in both orthopedic and dental applications due to their superior biocompatibility and favorable clinical responses [1–3]. The use of titanium osseous implants has been an effective and essential treatment modality in dental and orthopedic reconstructive therapy [4,5]. In the past few decades, persistent efforts on surface modification technology have been made to enhance the surface properties of titanium implants based on the evidence that endosseous implant surface is one of the principal factors affecting the process of osteo-integration [6,7]. These surface modification techniques aim at retaining the key bulk properties of titanium and its alloys while modifying the material surface for (i) optimum compatibility with the biological environment, (ii) bioactivity promoting tissue– surface interactions, and (iii) suitability in terms of the physical, chemical, and electrical characteristics required for implant application [1,7,8]. Considerable biological and clinical evidence has been well established that osteoblastic differentiation is promoted on micro-roughened titanium surfaces made by several methods such as acid etching, sandblasting, plasma spraying, or a combination of these, compared with relatively smooth machined titanium surfaces [6,7,9]. A significantly enhanced osteogenic phenotype and mineral deposition in the bone matrix were also observed around the micro-roughened endosseous implant surface in vivo [10]. Titanium dioxide (TiO2), the earliest and most popular dental and orthopedic implant material, has been widely reported to display superior biocompatibility and osteointegrated properties. Micro-roughened surfaces created by
Downloaded from http://abbs.oxfordjournals.org/ at University of Iowa Libraries/Serials Acquisitions on June 15, 2015
Department of Oral and Craniomaxillofacial Science, Ninth People’s Hospital College of Stomatology, Shanghai Jiao Tong University School of Medicine, Shanghai Key Laboratory of Stomatology, Shanghai, China 2 Shanghai United Stem Cell Biotechnology Co. Ltd, Shanghai 200333, China 3 Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, China *Correspondence address. Tel: þ86-21-23271251; Fax: þ86-21-23271251; E-mail: [email protected] (G.S.). Tel: þ86-21-51623022; Fax: þ86-21-54921011; E-mail: [email protected] (L.G.)
Characterization of a micro-roughened TiO2/ZrO2 coating in vitro
Materials and Methods Coating preparation Commercially pure titanium (Cp-Ti, purity .99.85%) plates (diameter, 11 mm; height, 2 mm) and commercial grade TiO2 and ZrO2 powder (diameter, 75–37 mm) were purchased from Beijing General Research Institute of Mining and Metallurgy (Beijing, China). The TiO2/ZrO2 powder was prepared by mixing 30 g ZrO2 with 70 g of TiO2, which were then milled for 6 h at 70 rpm followed by drying in an oven at 908C for 24 h. Prior to coating, the Cp-Ti plates were sandblasted, washed ultrasonically in deionized water, and then cleaned with acetone to remove organic materials. According to the product sheet provided by the manufacturer, 0.2 mm-thick micro-roughened coatings were plasma-sprayed with TiO2/ZrO2 powder onto the Cp-Ti plates using a Praxair-3710 plasma-spray system (Praxair Ltd, Danbury, USA). The plasma power, working distance, flow rate of plasma gas (Ar/H2), and powder feeding rate were 40 kW,
80 mm, 50/6 l/min, and 30 g/min, respectively. As a control, commercial grade TiO2 powders were also plasma-sprayed onto the Cp-Ti plates in a parallel experiment. After surface preparation, all the coated Cp-Ti plates were washed in deionized water and further cleaned ultrasonically in absolute ethanol for three times and air dried.
Coating characterization Scanning electron microscopy (SEM) analysis. A scanning electron microscope (Hitachi-S450; Hitachi, Tokyo, Japan) was used to visualize the surface morphology of both TiO2/ ZrO2 and TiO2 coatings. Bond strength testing. The shear bond strength test of six randomly selected samples in each group was performed using a universal testing instrument (AG-10TA; Shimadzu, Kyoto, Japan). Prior to testing, 12 counter steel rods (diameter, 11 mm; height, 2 cm) were sandblasted and attached to the surface of both TiO2/ZrO2 and TiO2 coatings using epoxy resin glue as an adhesive agent. All the fixtures were clamped and heated in a furnace for 3 h at 1008C, followed by furnace cooling. Then shear bond strength testing was performed at a crosshead speed of 1 mm/min until failure. The shear bond strength was calculated as failure load/ coating area (MPa). Microhardness testing. The microhardness was determined using a Vickers hardness measuring tester (HXD-1000TM, Shanghai, China). Six random indentations were recorded at different points on TiO2/ZrO2 and TiO2 coatings with 50 g load for 15 s. The recorded value was converted into a Vickers hardness number (HV). Surface roughness testing. The surface roughness was assessed using a portable roughness measurement device (MarSurf M 300 C; Mahr GmbH, Go¨ttingen, Germany). The roughness of random points at six TiO2/ZrO2 coatings and six TiO2 coatings was recorded according to the manufacturer’s instruction.
Cell isolation and characterization To isolate HBMSCs, human bone marrow was obtained with written and informed consent from patients with alveolar cleft undergoing autogenous bone grafting. All patients were negative for HIV-I, hepatitis B, and hepatitis C. The appropriate use of human bone marrow was approved by the Institutional Patients and Ethics Committee. HBMSCs were prepared and harvested as reported previously [22,23]. After isolation, the HBMSCs were resuspended in a standard culture medium and cultured in 10 cm dishes. The standard culture medium was prepared with a-minimum essential medium (a-MEM; Invitrogen, Carlsbad, USA) supplemented with 10% fetal bovine serum (Invitrogen), and 1% Acta Biochim Biophys Sin (2014) | Volume 46 | Issue 7 | Page 573
Downloaded from http://abbs.oxfordjournals.org/ at University of Iowa Libraries/Serials Acquisitions on June 15, 2015
TiO2 deposition have been proved to possess enhanced osteointegrated properties [3,6,11]. These studies demonstrated that the proliferation rate and overall osteoblastic functional phenotypes of osteoblasts were significantly increased on microroughened TiO2 surfaces when compared with commercial pure Ti (cpTi) surfaces. However, the potential drawbacks of these coatings are the low mechanical properties and poor chemical stability, which may lead to delamination of the coatings and even implant failure [3,12]. Zirconia (ZrO2), due to its high chemical–thermal stability, strong mechanical strength, and stress-induced phase transformation toughening, is frequently used to reinforce other ceramics [13]. Adding ZrO2 as a second phase has been reported to significantly improve the toughness and the bonding strength of composite material [12–17]. In vitro and in vivo studies have also shown that ZrO2 ceramics display favorable biocompatibility and good osteogenic properties [18–21]. In fact, ZrO2 film produced by cathodic arc deposition on Ti has been shown to elicit enhanced cellular adhesion and alkaline phosphatase (ALP) activity compared with TiO2 [5]. In light of these findings, we hypothesized that adding ZrO2 to TiO2 ceramics may improve the mechanical properties and bioactivity of TiO2 coating on the Ti surface. In the present study, a micro-roughened TiO2/ZrO2 (30 wt% ZrO2) coating on Ti plates was fabricated with the plasma-spray technique. A TiO2 coating was deposited onto Ti plates by the same technique as a control. Both coating microstructure and physical properties were investigated. Furthermore, human bone marrow mesenchymal stem cells (HBMSCs) were seeded on the coating surfaces. The cell attachment, proliferation, in vitro osteogenic differentiation, and osteogenic-specific gene expression profile on both TiO2/ZrO2 and TiO2 coatings were investigated.
Characterization of a micro-roughened TiO2/ZrO2 coating in vitro
Cell seeding and osteogenic induction Prior to cell seeding, both TiO2/ZrO2 and TiO2 coated Cp-Ti plates were gamma sterilized and transferred to 24-well culture plates, rinsed in standard medium alone, and then left to dry overnight in a sterile hood. For immunofluorescence and assessment of cell adhesion and proliferation, P4 HBMSCs were seeded at low density (8 103 cells/well) onto the coatings. For real-time PCR assay and semi-quantitative assessment of ALP activity and calcium deposition, P4 HBMSCs cells were seeded at higher density (5 104 cells/well) onto the coatings to eliminate the potential effect of proliferation on cell differentiation. After seeding for 2 h, 1 ml of standard medium described above was added to cover all the plates. To investigate cells osteogenic differentiation, seeded cells were cultured in osteogenic medium at 24 h after seeding. To validate the culture system, P4 HBMSCs were also grown in 24-well culture plates in a parallel experiment. All cells were incubated for different periods of time with replacement of medium every 2–3 days. Assessment of cell adhesion and proliferation SEM observation. To investigate cell adhesion, P4 HBMSCs were cultured on both TiO2/ZrO2 and TiO2 coatings in standard medium for 24 h. Then HBMSCs for SEM observation were washed with phosphate buffered saline (PBS) and fixed in 2.5% (w/v) glutaraldehyde (Sigma– Aldrich) overnight. All samples were washed three times with PBS and dehydrated in a graded series of ethanol (50%, 70%, 90%, and 100%) for 30 min, respectively, and subsequently critical point-dried with a Polaron E3100 (Quorum Technologies, East Sussex, UK). After sputter coating with a Acta Biochim Biophys Sin (2014) | Volume 46 | Issue 7 | Page 574
thin layer of gold, the morphology of the adherent cells on both coatings was observed by SEM. CCK-8 assay. To investigate cell proliferation, P4 HBMSCs were cultured on both TiO2/ZrO2 and TiO2 coatings in a standard medium for 4 h, 2, 4, 6, and 8 days. Cell proliferation was assessed using a Cell Counting Kit-8 (CCK-8; Dojindo, Kumamoto, Japan). At each predetermined time point, samples were washed three times with PBS to eliminate non-viable cells. Total of 50 ml of CCK-8 solution and 500 ml standard medium were added to each sample and incubated for 3 h in the incubator. Then, 100 ml of the supernatant was transferred to a 96-well plate and measured using a plate reader at a wavelength of 450 nm. Triplicate samples were tested in each group at each incubation time and the absorbance for each of the samples was averaged.
RNA isolation and real-time PCR analysis P4 HBMSCs cultured on both TiO2/ZrO2 and TiO2 coatings in the osteogenic medium and standard medium were harvested at 0, 3, 7 and 10 days. Total RNA was extracted with RNAiso Plus reagent (TaKaRa, Dalian, China) and equivalent amounts of each RNA sample were reverse-transcribed into complementary DNA using a PrimeScript RT-PCR kit (TaKaRa) according to the product sheet provided by the manufacturer. The expression levels of Runx2, Osterix, ALP, OPN, and GAPDH at each time point were determined quantitatively on a real-time PCR machine (ABI 73000 ABI Applied Biosystems, Foster City, USA) with a SYBR Premix Ex Taq kit (TaKaRa), using GAPDH as the control for normalization. The details of primers are listed in Table 1. Data were analyzed using the comparative CT method and expressed as the fold changes [24]. Immunofluorescence analysis P4 HBMSCs cultured on both TiO2/ZrO2 and TiO2 coatings in the osteogenic medium and standard medium at day 7 were fixed with 4% paraformaldehyde solution in PBS for 20 min at room temperature (RT) and washed with PBS three times for 5 min. Samples were then permeabilized with 0.1% Triton X-100 in PBS for 15 min at RT. Nonspecific binding sites were blocked with 5% bovine serum albumin in PBS for 60 min at RT. After co-incubation with primary rabbit polyclonal anti-human osteopontin antibodies (1 : 100; Proteintech Group, Chicago, USA) and primary mouse monoclonal anti-human Runx2 antibodies (1 : 100; ProSci, Poway, USA) overnight at 48C, all the samples were then washed with PBS and co-incubated with Cy3-labeled goat anti-rabbit IgG (1:1000; Beyotime, Beijing, China) and fluorescein (FITC)-labeled goat anti-mouse IgG (1:1000; Beyotime) for 1 h at RT. At the end of incubation, the samples were counterstained with DAPI (1:5000; Beyotime)
Downloaded from http://abbs.oxfordjournals.org/ at University of Iowa Libraries/Serials Acquisitions on June 15, 2015
penicillin-streptomycin (PS) (Invitrogen). All cells were cultured at 378C with 5% CO2 and 100% humidity. After expanding to passage 4 (P4), HBMSCs were characterized by demonstrating their multipotency of adipogenic and osteogenic differentiation. For adipogenic differentiation, P4 HBMSCs were cultured under either adipogenic (standard culture medium, 1023 mM dexamethasone, 0.2 mM indomethacin, 0.5 mM 1-methyl-3-isobutylxanthine, and 1022 mg/ml insulin; all agents from Sigma–Aldrich, USA) or standard culture medium for 14 days in a 12-well culture plate. Oil Red O staining was used to visualize the presence of lipids. For osteogenic differentiation, P4 HBMSCs were cultured under either osteogenic medium (standard culture medium, 0.1 mM ascorbic acid, 10 mM b-glycerophosphate, 1025 mM dexamethasone; all agents from Sigma–Aldrich, St Louis, USA) or standard culture medium up to 21 days in 12-well culture plates. ALP staining and alizarin red staining were used to visualize cellular osteogenic differentiation and extracellular calcium deposition. All medium were changed every 3–5 days.
Characterization of a micro-roughened TiO2/ZrO2 coating in vitro
Table 1. Primer sequences used for real-time PCR analysis of osteogenic-specific gene expression
Gene
Primer sequence (50 !30 )
Accession number
GAPDH
Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
NM_002046.3
COL I ALP OPN
Runx2
to target the cellular nuclei, and then washed with PBS three times. The Cy3, FITC, and DAPI images were taken separately using a fluorescence microscope (DP71; Olympus, Tokyo, Japan) equipped with a digital image capture system (Olympus).
Biochemical assays ALP assay. The ALP activity of P4 HBMSCs cultured on both TiO2/ZrO2 and TiO2 coatings in the osteogenic medium at days 3, 7, and 10 was measured using a p-nitrophenyl phosphate (pNPP) (Sigma–Aldrich) method [24]. Briefly, the cells in each well were washed with PBS and lysed by incubation of 500 ml of 0.1% (w/v) TritonX-100 (Sigma–Aldrich) in 10 mM Tris–HCl (pH 7.4) for 2 h at 48C. Total 50 ml lysate of each sample was mixed with 50 ml pNPP (1 mg/ml) and incubated at 378C for 15 min in a 96-well culture plate. The ALP activity was quantified by measuring the absorbance at 405 nm using a plate reader. The ALP activity was normalized according to the level of total protein content at each time point using a BCA kit (Thermo Scientific, Waltham, USA). Experiments were performed in triplicate for each group. Semi-quantitative ARS assay. Extracellular calcium deposition of P4 HBMSCs cultured on both TiO2/ZrO2 and TiO2 coatings in the osteogenic medium and standard medium at day 21 was determined using a semi-quantitative Alizarin red stain (ARS) assay [24]. Briefly, cells were washed three times with PBS without calcium or magnesium prior to fixation with 4% paraformaldehyde solution in PBS for 20 min at RT. Cell layers were stained with 40 mM Alizarin red (Sigma–Aldrich) solution at pH 4.2 for 10 min and rinsed five times for 15 min with water to reduce nonspecific stain. The Alizarin red on each sample was de-stained in 10 mM sodium phosphate containing 10% cetylpyridinium chloride (Sigma–Aldrich), pH 7.0, for 15 min at RT. The reaction
NM_000088.3 J04948.1 NM_001040058 BC101549.1 BC108920.1
products were transferred to a 96-well culture plate and determined by measuring the absorbance at 562 nm using a plate reader. Experiments were performed in triplicate for each group.
Statistical analysis Data were expressed as the mean + standard deviation unless otherwise noted. Data for these measurements were analyzed using one-way analysis of variance and Student’s t-test. A P value of ,0.05 was considered statistically significant. SPSS 16.0 and Graphpad prism 5 software were used to analyze and demonstrate the statistical significance of the assays. The significance between groups is marked on the graphs.
Results Expansion and characterization of HBMSCs Before cell seeding, adherent spindle-like HBMSCs were successfully isolated and expanded (Fig. 1A). The cellular multipotency of adipogenic and osteogenic differentiation was evidenced by positive staining with Oil Red O staining, ALP assay and alizarin red staining. The presence of lipids, extracellular calcium deposition, and ALP positive cells after adipogenic and osteogenic culture are shown in Fig. 1B – F, respectively. Surface morphology and cell attachment The surface morphology of both TiO2/ZrO2 and TiO2 coatings and cell attachment are shown in Fig. 2. Typical characteristics of plasma-sprayed micro-roughened surfaces are shown in Fig. 2A,B. Glassy surface with small protuberances and micropores could be observed on TiO2 coating surface, while more irregularly shaped protuberances and denser pores of different sizes were observed on the surface of TiO2/ZrO2 coating. When cultured on both micro-roughened Acta Biochim Biophys Sin (2014) | Volume 46 | Issue 7 | Page 575
Downloaded from http://abbs.oxfordjournals.org/ at University of Iowa Libraries/Serials Acquisitions on June 15, 2015
Osterix
GCTCTCCAGAACATCATCC TGCTTCACCACCTTCTTG CAGCCGCTTCACCTACAGC TTTTGTATTCAATCACTGTCTTGCC ACTCCCACTTCATCTGGAACC CCTGTTCAGCTCGTACTGCAT CAGAATGCTGTGTCCTCTGAA GTCAATGGAGTCCTGGCTGT TGAGGAGGAAGTTCACTATGG TTCTTTGTGCCTGCTTTGC GTCTCACTGCCTCTCACTTG CAC ACATCTCCTCCCTTCTG
Characterization of a micro-roughened TiO2/ZrO2 coating in vitro
Figure 2. Surface morphology and cell attachment Glassy surface with small protuberances and micropores could be observed on TiO2 coating surface (A), more irregularly shaped protuberances and denser pores were observed on the surface of TiO2/ZrO2 coating (B). Scanning electron microscopy of adhesion of HBMSCs on TiO2 coating (C) and TiO2/ZrO2 coating (D). HBMSCs attach onto both coatings with a well-spread spindle-like morphology and cell– cell contacts (white arrows). Acta Biochim Biophys Sin (2014) | Volume 46 | Issue 7 | Page 576
Downloaded from http://abbs.oxfordjournals.org/ at University of Iowa Libraries/Serials Acquisitions on June 15, 2015
Figure 1. Expansion and characterization of HBMSCs (A) Light microscopy images of monolayer cultures of HBMSCs at P3 show that these cells are adherent, spindle-like in shape. (B) Oil Red O staining result shows the presence of lipids after P4 HBMSCs were cultured for 14 days in adipogenic medium. (C) Alizarin red staining result shows the formation of extracellular calcium deposits after P4 HBMSCs were cultured for 21 days in osteogenic medium. (D – F) ALP staining shows the enhanced ALP activities of P4 HBMSCs at days 3, 7, and 10 after osteogenic culture. Bar ¼ 200 um.
Characterization of a micro-roughened TiO2/ZrO2 coating in vitro
coatings, HBMSCs showed a well-spread spindle-like morphology, presence of classical pseudopodia, and cell–cell contacts. No differences in cell morphologies were found on either TiO2/ZrO2 or TiO2 coating surfaces (Fig. 2C,D). Additionally, no significant difference was found in the CCK-8 assay of cell proliferation of HBMSCs on both surfaces at each time point (P . 0.05) (Fig. 3).
In vitro osteogenic differentiation of HBMSCs on coatings After osteogenic induction, Runx2, Osterix, ALP, and OPN of HBMSCs on both TiO2/ZrO2 and TiO2 coating surfaces were significantly unregulated compared with cells cultured in standard medium (Fig. 4). Although no significant
Discussion
Figure 3. Cell proliferation of HBMSCs on TiO2/ZrO2 and TiO2 coatings CCK-8 assay of HBMSCs cultured on TiO2/ZrO2 and TiO2 coatings for 0, 2, 4, 6, and 8 days shows no significant difference in cell proliferation on both surfaces at each time point (P . 0.05).
In the present study, we deposited micro-roughened TiO2/ ZrO2 (30 wt% ZrO2) coating and TiO2 coating onto Ti plates, respectively, by plasma-spray technique. Higher shear bond strength and microhardness of TiO2/ZrO2 coating were revealed when compared with TiO2 coating. Further comparative analysis of in vitro HBMSC responses showed that significantly higher cellular ALP activity and expression levels of Runx2 and Osterix at day 10 after osteogenic culture were found on TiO2/ZrO2 coating compared with TiO2 coating,
Table 2. Average shear bond strength, microhardness, and surface roughness of TiO2/ZrO2 and TiO2 coatings
TiO2/ZrO2 coating TiO2 coating
Average shear bond strength (MPa)
Average vickers microhardness (HV)
Average surface roughness (mm)
12.188 + 1.137 9.937 + 0.395
1306.0 + 192.4 825.0 + 124.0
4.413 + 0.489 4.028 + 0.507
Acta Biochim Biophys Sin (2014) | Volume 46 | Issue 7 | Page 577
Downloaded from http://abbs.oxfordjournals.org/ at University of Iowa Libraries/Serials Acquisitions on June 15, 2015
Coating characterization In assessment of the mechanical properties of both TiO2/ ZrO2 and TiO2 coatings, a statistically significant difference in shear bond strength and microhardness of the two groups was certified (Table 2). The mean shear bond strengths of both TiO2/ZrO2 and TiO2 coatings were (12.188 + 1.137) and (9.937 + 0.395) MPa, respectively (P , 0.05). The mean microhardness values of both TiO2/ZrO2 and TiO2 coatings were (1306.0 + 192.4) HV and (825.0 + 124.0) HV, respectively (P , 0.05). However, no significant difference in surface roughness was observed between the two groups (P ¼ 0.25).
difference in osteogenic-specific gene expression levels between TiO2/ZrO2 and TiO2 coating groups on early time points was found, it was worth noting that the expression of the Runx2 at day 10 and Osterix at days 7 and 10 showed a statistically significant higher level (P , 0.05) in HBMSCs on TiO2/ZrO2 coating surfaces than those on TiO2 coating surfaces, indicating higher osteogenic differentiation activity (Fig. 4A,B). To further verify the results of real-time PCR, the immunolocalization of Runx2 and OPN in HBMSCs on both TiO2/ZrO2 and TiO2 coating surfaces was conducted at day 7 after osteogenic induction. HBMSCs cultured in osteogenic medium showed a more intense fluorescence compared with cells cultured in standard medium, revealing the functional alteration and osteogenic differentiation of HBMSCs on both coating surfaces (Fig. 5). All the observation was in agreement with the results of real-time PCR analysis. For further comparing the osteogenic bioactivity of TiO2/ ZrO2 and TiO2 coating surfaces, the ALP activity of HBMSCs on both TiO2/ZrO2 and TiO2 coatings after osteogenic culture was found to be increased with elapsed time, which was in line with the gene expression profiles; the ALP activity of HBMSCs on TiO2/ZrO2 coating at day 10 showed a statistically significant higher level (P , 0.05) than those on TiO2 coating surfaces (Fig. 6). The semiquantitative ARS assay also revealed that HBMSCs on both TiO2/ZrO2 and TiO2 coatings at days 14 and 21 after osteogenic induction demonstrated increased extracellular calcium deposition compared with cells in the standard medium (Fig. 7). However, no significant difference between TiO2/ ZrO2 and TiO2 coating surfaces was observed.
Characterization of a micro-roughened TiO2/ZrO2 coating in vitro
while no statistically significant difference in cell proliferation and extracellular calcium deposition was observed. According to the results of several previous studies, plasma-sprayed composite ceramic coatings containing ZrO2 have been shown to display superior performance in reinforcing ceramic mechanical properties [12–17]. Actually, ZrO2 has been widely accepted as a superior reinforcing agent not only because it possesses a lower Young’s modulus, higher strength, and toughness than other common ceramics, but also because of its unique mechanical reinforcement through crack deflection, dispersion strengthening, and phase transformation toughening, which enabled ZrO2-based ceramics to exhibit higher strength and toughness Acta Biochim Biophys Sin (2014) | Volume 46 | Issue 7 | Page 578
compared with the original ceramics [15,25,26]. In this study, the micro-roughened TiO2/ZrO2 coating had a statistically higher shear bond strength and microhardness value compared with those of TiO2 coating. Interestingly, Kasuga et al. [27] also revealed that the strength and fracture toughness of bulk bioglass could be enhanced by adding ZrO2 as a second phase. Subsequent in vivo experiments indicated that the strength degradation rate of the bioglass added with ZrO2 powders was significantly lower than the bioglass per se [28]. The optimal content of ZrO2 incorporated as a second phase has been reported in several studies with various ceramic compositions. These results suggested that the
Downloaded from http://abbs.oxfordjournals.org/ at University of Iowa Libraries/Serials Acquisitions on June 15, 2015
Figure 4. Real-time PCR measurement of mRNA levels of HBMSCs cultured on TiO2/ZrO2 and TiO2 coatings in osteogenic medium and standard medium (A) Expression level of Runx2 in cells cultured in osteogenic medium was higher than that in cells cultured in standard medium at all time points. Cells cultured on TiO2/ZrO2 surfaces showed a higher Runx2 mRNA expression level than those on TiO2 coating in osteogenic medium at day 10 (*P , 0.05). (B) Expression level of Osterix in cells cultured in osteogenic medium was higher than that in cells cultured in standard medium at all time points. Cells cultured on TiO2/ZrO2 surfaces showed a higher Osterix mRNA expression level than those on TiO2 coating in osteogenic medium at days 7 and 10 (*P , 0.05). (C) Expression level of ALP in cells cultured in osteogenic medium was higher than that in cells cultured in standard medium at most time points (*P , 0.05). (D) Expression level of OPN in cells cultured in osteogenic medium was higher than that in cells cultured in standard medium at all time course (*P , 0.05).
Characterization of a micro-roughened TiO2/ZrO2 coating in vitro
Figure 6. ALP activities of HBMSCs on TiO2/ZrO2 and TiO2 coatings The ALP activity of HBMSCs on TiO2/ZrO2 coating at day 10 showed a statistically higher level than that on TiO2 coating surfaces. *P , 0.05.
Figure 7. Semi-quantitative alizarin red staining for extracellular mineral deposition of HBMSCs on TiO2/ZrO2 and TiO2 coatings HBMSCs cultured on TiO2/ZrO2 and TiO2 coatings in osteogenic medium exhibited statistically higher extracellular calcium deposition compared with cells cultured in standard medium at days 14 and 21. *P , 0.05.
mechanical strength of composite ceramics could be increased with an increase of ZrO2 incorporation rates. Briefly, a loading of 20–50wt% ZrO2 was required to substantially increase the mechanical properties of matrix ceramic [13,15,18,27,29,30]. Due to the different composites of the two coatings, more irregularly shaped protuberances and denser pores of different sizes were observed on the surface of TiO2/ZrO2 coating by SEM. This extensively micro-roughened surface morphology depends strongly on the physical properties and shapes of the feeding powder particles. During plasma spraying, low melting point TiO2 powder is completely melted and forms a glassy phase during fast cooling, while cubic ZrO2 powder with high melting point is only partially melted, resulting in a coating morphology comprising the observed irregularly shaped protuberances and dense pores [12,31]. The osteo-integration of dental and orthopedic implants is dependent on the attachment and proliferation of bone mesenchymal stem cells (BMSCs) on the implant surface [1,9]. These BMSCs are present in bone marrow as highly sensitive cells, undifferentiated and readily influenced by environmental factors. Previous in vivo studies have implied a functional relationship between BMSCs to the implant surface and their bone forming activity [32,33]. In vitro studies have also shown that these cells exhibit a greater initial attachment and proliferation on micro-roughened TiO2 and ZrO2 surfaces compared with smooth Ti surfaces [5,19]. Thus, it is advantageous to use HBMSCs to investigate the surface bioactivity of both TiO2/ZrO2 and TiO2 coatings and simulate the earliest process of osteo-integration in our study. Our results confirmed that the isolated HBMSCs are able to multi-differentiate into adipogenic and osteogenic lineages [9]. SEM observations also showed the attachment and pseudopodia extensions of HBMSCs on both TiO2/ZrO2 and TiO2 coatings after 24 h of culture, which would result in numerous cell–cell interactions, and allow rapid differentiation into the osteogenic lineage [4]. Acta Biochim Biophys Sin (2014) | Volume 46 | Issue 7 | Page 579
Downloaded from http://abbs.oxfordjournals.org/ at University of Iowa Libraries/Serials Acquisitions on June 15, 2015
Figure 5. Immunofluorescence for in vitro osteogenic differentiation of HBMSCs Immunofluorescence labeling of Runx2 (FITC, Green), OPN (Cy3, Red) and nucleus (DAPI, Blue) of HBMSCs on TiO2/ZrO2 (A – E) and TiO2 coatings (F –J) cultured in osteogenic/standard medium for 7 days. HBMSCs cultured on TiO2/ZrO2 coating (A: DAPI image, B: Cy3 image, C: FITC image, D: merged image) and TiO2 coating (F: DAPI image, G: Cy3 image, H: FITC image, I: merged image) in osteogenic medium exhibited a more intense fluorescence of Cy3 and FITC compared with cells cultured in standard medium (E, J: merged images).
Characterization of a micro-roughened TiO2/ZrO2 coating in vitro
Acta Biochim Biophys Sin (2014) | Volume 46 | Issue 7 | Page 580
and nano-structural properties [1,7,9,19,37]. We failed to further study the cause for the slightly enhanced osteogenic behavior of HBMSCs on TiO2/ZrO2 coating. In conclusion, the major feature of the this study resided in the facts that plasma-sprayed TiO2/ZrO2 (30 wt% ZrO2) coating may be more favorable than TiO2 coating per se in being of higher shear bond strength, microhardness, osteocompatibility, and being simple and inexpensive in manufacturing. SEM observation revealed that more irregularlyshaped protuberances and denser pores were formed on the surface of TiO2/ZrO2 coating compared with TiO2 coating. Further comparative analysis of cell proliferation and osteogenic differentiation using the HBMSCs as an in vitro osteo-integration model showed that significantly higher cellular ALP activity and expression levels of Runx2 and Osterix at day 10 after osteogenic culture were found on TiO2/ZrO2 coating compared with TiO2 coating, while no statistically significant difference of cell proliferation and extracellular calcium deposition was observed. However, the slightly enhanced biological behavior of HBMSCs on TiO2/ ZrO2 coating needs to be further investigated. The results of this study suggested that TiO2/ZrO2 coating has a promising potential for dental implant application. Further study will involve the fabrication of TiO2/ZrO2-coated implants and systemic analysis of biological responses in vivo.
Funding This work was supported by the grants from the National Natural Science Foundation of China (81371122 and 81300842).
References 1. Brammer KS, Choi C, Frandsen CJ, Oh S, Johnston G and Jin S. Comparative cell behavior on carbon-coated TiO2 nanotube surfaces for osteoblasts vs. osteo-progenitor cells. Acta Biomater 2011, 7: 2697 –2703. 2. Sugita Y, Ishizaki K, Iwasa F, Ueno T, Minamikawa H, Yamada M and Suzuki T, et al. Effects of pico-to-nanometer-thin TiO2 coating on the biological properties of microroughened titanium. Biomaterials 2011, 32: 8374 – 8384. 3. Tiainen H, Monjo M, Knychala J, Nilsen O, Lyngstadaas SP, Ellingsen JE and Haugen HJ. The effect of fluoride surface modification of ceramic TiO2 on the surface properties and biological response of osteoblastic cells in vitro. Biomed Mater 2011, 6: 045006. 4. Meretoja VV, De Ruijter AE, Peltola TO, Jansen JA and Narhi TO. Osteoblast differentiation with titania and titania-silica-coated titanium fiber meshes. Tissue Eng 2005, 11: 1489 – 1497. 5. Zhang S, Sun J, Xu Y, Qian S, Wang B, Liu F and Liu X. Biological behavior of osteoblast-like cells on titania and zirconia films deposited by cathodic arc deposition. Biointerphases 2012, 7: 60. 6. Guo J, Padilla RJ, Ambrose W, De Kok IJ and Cooper LF. The effect of hydrofluoric acid treatment of TiO2 grit blasted titanium implants on adherent osteoblast gene expression in vitro and in vivo. Biomaterials 2007, 28: 5418 – 5425.
Downloaded from http://abbs.oxfordjournals.org/ at University of Iowa Libraries/Serials Acquisitions on June 15, 2015
However, no statistically significant difference in cell proliferation during the exponential phase of growth was observed in CCK-8 assay. ALP has been widely recognized as an important early indicator for osteoblast differentiation, and ALP activity is elevated when BMSCs begin osteogenic differentiation and shows significant differences in terms of different adherent substrates [4,34]. Our results showed that the ALP activity of HBMSCs on both TiO2/ZrO2 and TiO2 coatings after osteogenic culture was up-regulated with elapsed time. In addition, the ALP activity of HBMSCs on TiO2/ZrO2 coating was higher than that on TiO2 coating at day 10, which indicate that TiO2/ZrO2 coating may lead to promotion of a more osteoblastic phenotype than TiO2 coating [1,5]. Moreover, the degree of osteogenesis was also evaluated by semiquantitative ARS assay, a simple and convenient method for detecting extracellular mineral deposition. Our results showed that the mineralization on both coatings was significantly up-regulated after being cultured in osteogenic medium. However, no significant difference in extracellular mineral deposition between TiO2/ZrO2 and TiO2 coatings was found. As specific markers of osteogenesis, the gene expression levels of Runx2, Osterix, ALP, and OPN at 3, 7, and 10 days after osteogenic induction were analyzed using real-time PCR. These genes in HBMSCs on both TiO2/ZrO2 and TiO2 coatings were significantly up-regulated with elapsed time, when compared with cells cultured in standard medium. It should be noted that expression levels of two key osteoinductive transcription factors, Runx2 and Osterix, were statistically higher at day 10 in HBMSCs on TiO2/ZrO2 coating than those on TiO2 coating. As the early key transcription factors associated with osteoblast differentiation, Runx2 and Osterix, have been shown to play a key role in the osteoblast differentiation and osteogenic-specific gene expression such as ALP, Col I, and OCN [35]. In a previous study, both Runx2 and Osterix expression levels were observed to be higher in MC3T3-E1 cells adhered to TiO2/ HF treated surfaces than those adhered to TiO2 grit-blasted surfaces at days 3 and 7 [6]. Another study also reported that HBMSCs on TiO2/HF treated surfaces displayed higher BSP expression when compared with HBMSCs on TiO2 gritblasted surfaces [36]. To further verify the results of realtime PCR, the immunolocalization of OPN and Runx2 in HBMSCs on both TiO2/ZrO2 and TiO2 coating surfaces was investigated by immunofluorescence assay at day 7 after osteogenic induction. Our results showed that HBMSCs cultured in osteogenic medium exhibited a more intense expression of OPN and Runx2 on both coatings compared with cells cultured in standard medium, indicating the functional alteration and osteogenic differentiation of HBMSCs. However, the osteogenic responses to different biocompatible coatings are still largely unknown, which may involve complicated surface properties such as surface chemistries, charge densities
Characterization of a micro-roughened TiO2/ZrO2 coating in vitro
22. Granja PL, De Jeso B, Bareille R, Rouais F, Baquey C and Barbosa MA. Mineralization of regenerated cellulose hydrogels induced by human bone marrow stromal cells. Eur Cell Mater 2005, 10: 31 – 37. 23. Jagodzinski M, Drescher M, Zeichen J, Hankemeier S, Krettek C, Bosch U and van Griensven M. Effects of cyclic longitudinal mechanical strain and dexamethasone on osteogenic differentiation of human bone marrow stromal cells. Eur Cell Mater 2004, 7: 35– 41. 24. Tan F, Naciri M, Dowling D and Al-Rubeai M. In vitro and in vivo bioactivity of CoBlast hydroxyapatite coating and the effect of impaction on its osteoconductivity. Biotechnol Adv 2012, 30: 352– 362. 25. Hannink RHJ, Kelly PM and Muddle BC. Transformation toughening in zirconia-containing ceramics. J Am Ceram Soc 2004, 83: 461– 487. 26. Pittayachawan P, McDonald A, Young A and Knowles JC. Flexural strength, fatigue life, and stress-induced phase transformation study of Y-TZP dental ceramic. J Biomed Mater Res B 2009, 88B: 366 – 377. 27. Kasuga T, Nakajima K, Uno T and Yoshida M. Preparation of zirconiatoughened bioactive glass-ceramic composite by Sinter– Hot isostatic pressing. J Am Ceram Soc 1992, 75: 1103– 1107. 28. Kasuga T, Yoshida M, Ikushima AJ, Tuchiya M and Kusakari H. Stability of zirconia-toughened bioactive glass-ceramics: in vivo study using dogs. J Mater Sci Mater Med 1993, 4: 36 –39. 29. Ioku K, Yoshimura M and Somiya S. Microstructure and mechanical properties of hydroxyapatite ceramics with zirconia dispersion prepared by postsintering. Biomaterials 1990, 11: 57 – 61. 30. Li J, Liao H and Hermansson L. Sintering of partially-stabilized zirconia and partially-stabilized zirconia – hydroxyapatite composites by hot isostatic pressing and pressureless sintering. Biomaterials 1996, 17: 1787– 1790. 31. Fu L, Aik Khor K and Peng Lim J. The evaluation of powder processing on microstructure and mechanical properties of hydroxyapatite (HA)/yttria stabilized zirconia (YSZ) composite coatings. Surf Coat Tech 2001, 140: 263 – 268. 32. Davies JE. Understanding peri-implant endosseous healing. J Dent Educ 2003, 67: 932– 949. 33. Hu Y, Cai K, Luo Z, Zhang Y, Li L, Lai M and Hou Y, et al. Regulation of the differentiation of mesenchymal stem cells in vitro and osteogenesis in vivo by microenvironmental modification of titanium alloy surfaces. Biomaterials 2012, 33: 3515– 3528. 34. Lian JB and Stein GS. Concepts of osteoblast growth and differentiation: basis for modulation of bone cell development and tissue formation. Crit Rev Oral Biol Med 1992, 3: 269 – 305. 35. Harada H, Tagashira S, Fujiwara M, Ogawa S, Katsumata T, Yamaguchi A and Komori T, et al. Cbfa1 isoforms exert functional differences in osteoblast differentiation. J Biol Chem 1999, 274: 6972 –6978. 36. Cooper LF, Zhou Y, Takebe J, Guo J, Abron A, Holme´n A and Ellingsen JE. Fluoride modification effects on osteoblast behavior and bone formation at TiO2 grit-blasted c.p. titanium endosseous implants. Biomaterials 2006, 27: 926 –936. 37. Jager M, Urselmann F, Witte F, Zanger K, Li X, Ayers DC and Krauspe R. Osteoblast differentiation onto different biometals with an endoprosthetic surface topography in vitro. J Biomed Mater Res A 2008, 86: 61 – 75.
Acta Biochim Biophys Sin (2014) | Volume 46 | Issue 7 | Page 581
Downloaded from http://abbs.oxfordjournals.org/ at University of Iowa Libraries/Serials Acquisitions on June 15, 2015
7. Itala A, Ylanen HO, Yrjans J, Heino T, Hentunen T, Hupa M and Aro HT. Characterization of microrough bioactive glass surface: surface reactions and osteoblast responses in vitro. J Biomed Mater Res 2002, 62: 404 – 411. 8. Chen CC, Huang TH, Kao CT and Ding SJ. Characterization of functionally graded hydroxyapatite/titanium composite coatings plasma-sprayed on Ti alloys. J Biomed Mater Res B 2006, 78: 146 – 152. 9. Garcia-Gareta E, Hua J, Knowles JC and Blunn GW. Comparison of mesenchymal stem cell proliferation and differentiation between biomimetic and electrochemical coatings on different topographic surfaces. J Mater Sci Mater Med 2013, 24: 199 – 210. 10. Takeuchi K, Saruwatari L, Nakamura HK, Yang JM and Ogawa T. Enhanced intrinsic biomechanical properties of osteoblastic mineralized tissue on roughened titanium surface. J Biomed Mater Res A 2005, 72: 296 – 305. 11. Wang X, Gittens RA, Song R, Tannenbaum R, Olivares-Navarrete R, Schwartz Z and Chen H, et al. Effects of structural properties of electrospun TiO2 nanofiber meshes on their osteogenic potential. Acta Biomater 2012, 8: 878 – 885. 12. Khor KA, Gu YW, Pan D and Cheang P. Microstructure and mechanical properties of plasma sprayed HA/YSZ/Ti-6Al-4V composite coatings. Biomaterials 2004, 25: 4009– 4017. 13. Chou BY and Chang E. Microstructural characterization of plasma-sprayed hydroxyapatite-10 wt% ZrO2 composite coating on titanium. Biomaterials 1999, 20: 1823– 1832. 14. Xie Y, Zheng X, Ding C, Zhai W, Chang J and Ji H. Preparation and characterization of CaO– ZrO2 – SiO2 coating for potential application in biomedicine. J Thermal Spray Technol 2009, 18: 678 – 685. 15. Ahn ES, Gleason NJ and Ying JY. The effect of zirconia reinforcing agents on the microstructure and mechanical properties of hydroxyapatite-based nanocomposites. J Am Ceram Soc 2005, 88: 3374– 3379. 16. Martorana S, Fedele A, Mazzocchi M and Bellosi A. Surface coatings of bioactive glasses on high strength ceramic composites. Appl Surf Sci 2009, 255: 6679– 6685. 17. Verne´ E, Defilippi R, Carl G, Vitale Brovarone C and Appendino P. Viscous flow sintering of bioactive glass-ceramic composites toughened by zirconia particles. J Eur Ceram Soc 2003, 23: 675 – 683. 18. Kasuga T, Yoshida M, Ikushima AJ, Tuchiya M and Kusakari H. Bioactivity of zirconia-toughened glass-ceramics. J Am Ceram Soc 1992, 75: 1884 –1888. 19. Bauer S, Park J, Faltenbacher J, Berger S, von der Mark K and Schmuki P. Size selective behavior of mesenchymal stem cells on ZrO2 and TiO2 nanotube arrays. Integr Biol (Camb) 2009, 1: 525– 532. 20. Xie Y, Liu X, Ding C and Chu PK. Bioconductivity and mechanical properties of plasma-sprayed dicalcium silicate/zirconia composite coating. Mater Sci Eng C 2005, 25: 509 – 515. 21. Lee TM, Yang CY, Chang E and Tsai RS. Comparison of plasmasprayed hydroxyapatite coatings and zirconia-reinforced hydroxyapatite composite coatings: in vivo study. J Biomed Mater Res A 2004, 71A: 652 – 660.
