RAPID COMMUNICATION OFFICIAL JOURNAL

A Dominant STIM1 Mutation Causes Stormorken Syndrome ˚ A. Holme,3 Masahiro Mizobuchi,4 Doriana Misceo,1 Asbjørn Holmgren,1 † William E. Louch,2 † Pal 5 6 Raul J. Morales, Andre´ Maues De Paula, Asbjørg Stray-Pedersen,1 Robert Lyle,1 Bjørn Dalhus,7,8 Geir Christensen,2 Helge Stormorken,9 Geir E. Tjønnfjord,3,10 and Eirik Frengen1∗

www.hgvs.org

1

Department of Medical Genetics, University of Oslo and Oslo University Hospital, Oslo, Norway; 2 Institute for Experimental Medical Research, Oslo University Hospital and University of Oslo, Oslo, Norway; 3 Department of Hematology, Oslo University Hospital, Oslo, Norway; 4 Department of ˆ Gui de Chauliac, Montpellier, France; 6 Service d’Anatomie Neurology, Nakamura Memorial Hospital, Sapporo, Japan; 5 CHRU, Hopital ˆ Pathologique et Neuropathologie, Hopital de la Timone, Assistance Publique Hopitaux de Marseille, Marseille, France; 7 Department for Microbiology, Oslo University Hospital, Oslo, Norway; 8 Department for Medical Biochemistry, Oslo University Hospital, Oslo, Norway; 9 Konvallveien 4, N-1338 Sandvika, Oslo, Norway; 10 Institute of Clinical Medicine, University of Oslo, Oslo, Norway

´ Communicated by Claude Ferec Received 3 January 2014; accepted revised manuscript 4 March 2014. Published online 11 March 2014 in Wiley Online Library (www.wiley.com/humanmutation). DOI: 10.1002/humu.22544

Introduction ABSTRACT: Stormorken syndrome is a rare autosomaldominant disease with mild bleeding tendency, thrombocytopathy, thrombocytopenia, mild anemia, asplenia, tubular aggregate myopathy, miosis, headache, and ichthyosis. A heterozygous missense mutation in STIM1 exon 7 (c.910C>T; p.Arg304Trp) (NM_003156.3) was found to segregate with the disease in six Stormorken syndrome patients in four families. Upon sensing Ca2+ depletion in the endoplasmic reticulum lumen, STIM1 undergoes a conformational change enabling it to interact with and open ORAI1, a Ca2+ release-activated Ca2+ channel located in the plasma membrane. The STIM1 mutation found in Stormorken syndrome patients is located in the coiled-coil 1 domain, which might play a role in keeping STIM1 inactive. In agreement with a possible gainof-function mutation in STIM1, blood platelets from patients were in a preactivated state with high exposure of aminophospholipids on the outer surface of the plasma membrane. Resting Ca2+ levels were elevated in platelets from the patients compared with controls, and storeoperated Ca2+ entry was markedly attenuated, further supporting constitutive activity of STIM1 and ORAI1. Thus, our data are compatible with a near-maximal activation of STIM1 in Stormorken syndrome patients. We conclude that the heterozygous mutation c.910C>T causes the complex phenotype that defines this syndrome. C 2014 Wiley Periodicals, Inc. Hum Mutat 35:556–564, 2014. 

KEY WORDS: Stormorken syndrome; STIM1; SOCE; whole-exome sequencing; CRAC

Additional Supporting Information may be found in the online version of this article. †

These authors contributed equally to this work.

Contract grant sponsors: Anders Jahres fond til vitenskapens fremme; “Legatet til Henrik Homans Minde”; Southeastern Regional Health Authorities’s Technology, Platform for Structural Biology and Bioinformatics (grant no. 2012085). ∗

Correspondence to: Eirik Frengen, Department of Medical Genetics, Univer-

sity of Oslo, P.O. Box #1036, Blindern, Oslo N-0315, Norway. E-mail: eirik.frengen@ medisin.uio.no

Stormorken syndrome (MIM #185070) is a rare disease with autosomal-dominant inheritance presenting with mild bleeding tendency, thrombocytopathy, thrombocytopenia, mild anemia, asplenia, tubular aggregate myopathy (TAM), miosis, headache, and ichthyosis [Stormorken et al., 1985, 1995; Sjaastad et al., 1992; Mizobuchi et al., 2000]. To our knowledge, 10 Stormorken syndrome patients have so far been described globally. We present four families with a total of six Stormorken syndrome patients. We demonstrate that a single heterozygous missense mutation in the stromal interaction molecule 1 (STIM1) segregates with the disease in four unrelated families. STIM1 encodes for a multidomain protein (Fig. 1A) containing a single transmembrane segment separating an endoplasmic reticulum (ER) luminal N-terminal region (STIM1NT ) from a cytoplasmic C-terminal region (STIM1CT ) [Williams et al., 2001]. STIM1 is highly conserved in vertebrates [Collins and Meyer, 2011] and ubiquitously expressed. It binds the plasma membrane protein ORAI1, a Ca2+ release-activated calcium (CRAC) channel, which mediates store-operated calcium entry (SOCE) in nonexcitable cells [Putney, 1986, 2007] and myotubes [Hopf et al., 1996]. In resting condition, when the ER is Ca2+ replete, the STIM1 ER luminal EFhands bind Ca2+ and form a stable complex. Decreased luminal Ca2+ leads to dissociation of Ca2+ from the EF-hands and unfolding of the EF-hand–SAM (sterile alpha motif) complex (Fig. 1B) [Stathopulos et al., 2008; 2009; Cahalan, 2009], resulting in dimerization of STIM1NT , followed by the elongation of the coiled-coil 1 (CC1) domain, which will trigger a zipper-like dimerization of the CC1 domains [Feske and Prakriya, 2013; Zhou et al., 2013]. This elongation of STIM1 is suggested to bring a polybasic stretch in the CRAC-activating domain/STIM1-ORAI1-activating domain (CAD/SOAR) toward the plasma membrane, where it interacts with ORAI1 [Zhou et al., 2013]. Several studies have suggested that CC1 has a role in keeping resting STIM1 inactive, likely by binding and inactivating the CAD/SOAR domain [Korzeniowski et al., 2010; Yang et al., 2012; Cui et al., 2013]. The p.Arg304Trp mutation detected in Stormorken syndrome patients might interfere with this STIM1 inactivation mechanism. STIM1 heterozygous mutations have previously been detected in three families suffering from nonsyndromic TAM [B¨ohm et al., 2013], whereas STIM1 homozygous mutations have been found  C

2014 WILEY PERIODICALS, INC.

Figure 1. Schematic presentation of the STIM1 structure and function. The structure of the human STIM1 protein and its functional domains (A). The two EF-hand domains, the SAM domain, the CC1 domain and the STIM1–ORAI1-activating region (SOAR)/CRAC-activating domain (CAD). Amino acid positions are according to Soboloff et al. (2012). Known human mutations are indicated on top: H72Q, D84G, and H109R/N heterozygous ¨ mutations in patients ascertained for TAM [Bohm et al., 2013], p.E136X (c.381dup) [Picard et al., 2009], and p.R429C (c.1285C>T) [Fuchs et al., 2012] homozygous mutations in CID patients, and C.970-1G>A homozygous mutation found in a patient with Kaposi sarcoma [Byun et al., 2010]. The R304W heterozygous mutation was found in patients with Stormorken syndrome. A simplified schematic presentation of STIM1 activation upon ER Ca2+ depletion (B). Even though current knowledge suggests that resting STIM1 is a dimer, a single molecule is presented for clarity. When ER is filled with Ca2+ , the CC2 basic segment, amino acid 382–387 [Calloway et al., 2010] (shown with “+”), binds the CC1 acidic segment, amino acid 291–331 [Korzeniowski et al., 2010] (shown with “−”), keeping STIM1 inactive. When ER is Ca2+ depleted, the CC2 basic segment binds an ORAI1 acidic segment, amino acid 261–401 [Korzeniowski et al., 2010] (shown with “−”), activating the CRAC channel. Pedigrees of the families included in the study (C). Affected members have a C/T genotype, whereas the investigated healthy members show a C/C genotype. The black arrows indicate the propositus in each family. Sequence chromatograms of STIM1 exon 7 c.910C>T mutation (D). Top: wild-type C/C; bottom: mutant C/T, shown with “Y.” The asterisk (∗) indicates the position of the mutation. A cross-species alignment (E) of human STIM1 amino acids 291–322 (NP_003147.2) to the vertebrate orhtologs indicated demonstrates the high degree of conservation in the evolution (Clustal, clustal.org/). The blue arrows indicate the mutated amino acids studied by Korzeniowski et al. (2010), which abolish the intramolecular inactivation mechanism of STIM1. The purple arrow indicates the amino acid mutated in Stormorken syndrome patients (R304W). The asterisks (∗) indicate the amino acids conserved in all species shown. The colors refer to the following groups of amino acids: purple, positive; red, hydrophobic; blue, negative; green, hydrophilic. HUMAN MUTATION, Vol. 35, No. 5, 556–564, 2014

557

in six patients presenting with combined immunodeficiency (CID) [Picard et al., 2009; Byun et al., 2010; Fuchs et al., 2012]. We report a novel heterozygous mutation in STIM1, which causes a complex phenotype known as Stormorken syndrome.

Materials and Methods Materials Genomic DNA from peripheral blood was obtained from the patients, their healthy relatives, and from 257 healthy controls. Peripheral blood from F1 III-1 and F2 II-3 and one healthy control was also collected in Tempus Blood RNA Tubes and RNA extracted with Tempus 12-Port RNA Isolation Kit (Life Technologies Corporation, Carlsbad, CA). RNA to cDNA conversion was carried out with highcapacity cDNA Reverse Transcription Kit (Life Technologies).

Reference Genome Positions on the human genome and mapping of sequencing data refer to the February 2009 human reference sequence (GRCh37/hg19) produced by the Genome Reference Consortium.

mutation was checked with SIFT [Ng and Henikoff, 2001] (sift.jcvi.org/) and PolyPhen-2 [Adzhubei et al., 2010] (genetics.bwh.harvard.edu/pph/).

cDNA Study cDNA from F1 III-1, F2 II-3, and one healthy control was used to PCR amplify the STIM1 transcript between exon 5 and exon 9 (STIM1ex5 F CTCTTTGGGCCTCCTCTCTT and STIM1exon8– 9 R TATCTTCTCAGCCCCCTCCT). PCR reactions, Sanger sequencing, and analysis of the PCR products were performed as described below.

Verification of the Mutation Genomic DNA from the patients, their healthy relatives, and 257 healthy controls was used to generate PCR products with primers flanking the point mutation (STIM1ex7 F TGGAGCTGTCATTTTCCTCTTT and STIM1ex7 R GGCCTCCCAAAGTGCTAGAAT). PCR products were Sanger sequenced using an ABI 3730xl DNA analyzer and ABI BigDye dye terminator cycle-sequencing kits (Life Technologies). Sequences were analyzed with sequencing analysis and SeqScape software (Life Technologies).

Microarray Array comparative genomic hybridization (aCGH) was performed on the Agilent 244k oligo array CGH, (Agilent Technologies, Santa Clara, CA) according to the manufacture’s instruction. Arrays were scanned by Agilent scanner and analyzed by DNA Analytics software (Agilent Technologies).

Exome Capture and Sequencing Variant Calling DNA was sheared using a Covaris sonicator (Covaris, Woburn, MA) to produce fragments with an average size of 150 bp. Pairedend Illumina adapters (Illumina, Inc., San Diego, CA) were ligated to the fragments according to the manufacturer’s recommendations. Exome capture was performed with the SureSelect Human All Exon kit v2 (Agilent Technologies). The final amplified exome captured library was quantified using a Qubit Flourometer (Life Technologies) and qPCR using primers binding in adapter sequence and Power SYBR Green PCR Master Mix (Life Technologies). Illumina PhiX control kit v2.0 DNA (Illumina, Inc., San Diego, CA) was used for standard curve generation. Fragment size distribution of the input library was measured using a 2100 Bioanalyzer and Agilent High Sensitivity DNA Chip (Agilent Technologies). The exome captured library was sequenced on an Illumina HiSeq2000 with 100 bp pairedend reads. Reads that did not pass Illumina’s standard filter were removed prior to alignment. Remaining reads were aligned to the reference human genome (GRCh37/hg19), using Burrows–Wheeler Aligner tool [Li and Durbin, 2009] (bio-bwa.sourceforge.net). PCR duplicates were removed. Approximately 90% of the reads mapped uniquely to the reference sequence yielding an average of 90x coverage per targeted base. Variant calling was performed using the Genome Analysis Toolkit (GATK) [McKenna et al., 2010] (broadinstitute.org/gatk). Variants were annotated with SeattleSeq (snp.gs.washington.edu/SeattleSeqAnnotation) and ANNOVAR [Wang et al., 2010] (openbioinformatics.org/annovar). VCFtools (vcftools.sourceforge.net) were used to manipulate vcf files and The Integrative Genomic Viewer (broadinstitute.org/igv/) was used for data visualization. Pathogenicity prediction of the

558

HUMAN MUTATION, Vol. 35, No. 5, 556–564, 2014

Microsatellite Study in Family 1 The declared relationships of individuals I-1, I-2, II-2, and II-3 from family 1 were ascertained using the Elucigene QST∗ Rplus v2 (Hologic Gen-Probe Inc., San Diego, CA), which comprises a total of 22 microsatellite markers for chromosomes 13, 18, 21, X, and Y. PCR products were separated on an ABI 3730 DNA Analyzer automated sequencer and analyzed by GeneMarker v1.95 (SoftGenetics, LLC, State College, PA).

Blood Sampling and Preparation of Platelets for Flow Cytometry Whole blood was drawn from F1 II-2, F1 III-1 and F2 II-3, and healthy controls, who had taken no medication for the last 10 days. Blood was drawn and anticoagulated on sterile vacuum tubes (Becton Dickinson, San Jose, CA.) containing 1/10th volume of 0.129 M trisodium citrate. To study platelet exposure of aminophospholipids with annexin V, blood was drawn into tubes containing the irreversible thrombin inhibitor PPACK (50 μM). The blood was immediately centrifuged at 240g and room temperature for 7 min to provide platelet-rich plasma (PRP), and subsequently processed for flow cytometry. Stimulation of platelets in PRP was obtained by adding 100 μM of the PAR-1-activating peptide SFLLRN or Collagen 8.4 μg/ml with only initial stirring in an aggregometer (Chronolog model 440) at 37°C. Generally, 1 × 106 platelets were added to polystyrene tubes containing filtered phosphate-buffered saline (pH 7.4) or Tris-buffered saline containing 2.5 mM CaCl2 for experiments studying annexin V binding, at a final volume of 100 μl after addition of the fluorescent probes. The various fluorescein isothiocyanate (FITC)-labeled probes were added in final concentrations of 5 μg/ml (FITC-Y2/51 against GPIIIa; Dako A/S, Glostrup, Denmark), 5 μg/ml (FITC-AN51 against GPIb; Dako A/S), 4 mg/ml (FITC-CLB-gran 12 against [GP53] CD63; Immunotech, Marseille, France), 5 μg/ml (FITC-AK4 against P-selectin [CD62p]; Pharmingen, San Diego, CA.], 21.4 μg/ml (FITC-PAC-1, which recognizes an epitope on activated GPIIb-IIIa; The Cell Center, University of

Pennsylvania, PA), and 33.3 μg/ml (FITC–annexin V; Bender Wien, Vienna, Austria). The mixtures were incubated in the dark at room temperature for 20 min, diluted with 1 ml of the same incubation buffer, and processed for flow cytometry. Platelets labeled with the FITC-conjugated probes were analyzed in a FACScan flow cytometer (Becton Dickinson) equipped with a 15-mW air-cooled 488-nm argon laser as previously described [Holme et al., 1998]. The light scatter and fluorescence channels were set at logarithmic gain. The platelets were analyzed by the FACScan in two ways. To study the amounts of the probes (annexin V, PAC-1, P-selectin, and CD63) bound to platelets, platelets were gated on the basis of the forward- and side-scatter properties. To study platelet microparticle formation and to resolve plateletderived microparticles from background light scatter, acquisition was gated so as to include only positive events for antibody bound to GP IIIa (Y2/51). Consequently, a fluorescence threshold was set to analyze only platelets and microparticles. Microparticles and platelets were separated analytically on the basis of their characteristics in forward and side scatter. To quantify and discriminate between platelets and microparticles, the lower limit of the platelet gate was set at the left border of the forward scatter profile of unperfused platelets. The number of microparticles present was expressed as the number of particles below this limit in percent of the total number of fluorescent particles counted (i.e., platelets plus microparticles). Altogether, 10,000 positive events were analyzed each time, and the Cellquest program (Becton Dickinson) was used for data processing on an Apple computer.

Examination of SOCE In two series of experiments, platelet suspensions were loaded with indo-1 AM (10 μM for 20 min; Molecular Probes, Eugene, OR) or fluo-4 AM (20 μM for 15 min; Molecular Probes), plated on laminin-coated coverslips, and mounted on the stage of an inverted microscope. Whole-cell fluorescence was recorded from clusters of 20–40 platelets by a photomultiplier tube (Photon Technology International, Monmouth Junction, NJ). Indo-1 was excited at 350 nm, and fluorescence was collected at 405 and 485 nm; the peak emission wavelengths of the Ca2+ -bound and Ca2+ -unbound forms of the dye. Data are presented at an emission ratio (405/485). Fluo-4 was excited at 485 nm and fluorescence recorded at 535 nm. These data are presented relative to resting fluorescence (F/F0 ). ER Ca2+ depletion was effected by superfusion of the platelets with a Ca2+ -free HEPES Tyrode’s solution (in mM: 140 NaCl, 0.5 MgCl2 , 5.0 HEPES, 5.5 glucose, 0.4 NaH2 PO4 , 5.4 KCl, pH 7.4, 37°C) containing 1 μM thapsigargin, an inhibitor of the SR/ER Ca2+ ATPase (SERCA), to deplete ER Ca2+ . SOCE was induced by rapid introduction of 1 mM Ca2+ or 25 μM thrombin receptor activating peptide (TRAP).

Muscle Biopsy Muscle biopsy was performed under local anesthesia in the vastus lateralis in patient F3 II-1, after written informed consent. Specimens for light microscopy were frozen in isopentane cooled with liquid nitrogen. One fragment was fixed in glutaraldehyde, postfixed in osmium and araldite embedded for ultrastructural analysis. The following standard staining of the frozen tissue was performed according to previously described procedures [Dubowitz and Sewry, 2007]: hematoxylin and eosin, Gomori trichrome, periodic acid–Schiff, Sudan stain, and Congo Red. Histochemical stains included nicotinamide adenine dinucleotide (NADH)–tetrazolium reductase, and ATPase (at pH 9.4, 4.6, and 4.3), phosphorylase,

AMP deaminase, acid and alkaline phosphatases, Cytochrome C oxidase, and succinyl dehydrogenase. Anti-STIM1 antibody (OriGene TA306421, dilution 1:200) was used for immunohistochemical analyses. Semithin sections and electron microscopic analysis were performed for all biopsies using standard procedures.

Results Detection of the Disease-Causing Mutation in Stormorken Syndrome Patients We present six patients with Stormorken syndrome (Supp. Fig. S1, clinical and laboratory findings are summarized in Supp. Table S1 and Supp. Clinical Description S1). The patients belong to four families (Fig. 1C): the original two patients described by Stormorken et al. (1985, 1995) (family 1) [Sjaastad et al., 1992; Stormorken et al., 1985, 1995], a Norwegian male (family 2), a French male (family 3), and a mother and daughter from Japan (family 4) [Mizobuchi et al., 2000]. Because of the complex clinical presentation, we hypothesized that Stormorken syndrome was either a genomic disease affecting several genes or caused by a mutation affecting a key regulator resulting in a complex phenotype. Based on the first assumption, we performed aCGH on the index case in all four families using an Agilent 244k oligo array. The 244k array enables detection of imbalances with a resolution of approximately 20 kb; however, no pathological imbalances were found. We then sequenced the exomes of four individuals, one family trio (proband and parents in family 2) and patient F3 II-1. The only de novo variant in F2 II-3 that was also present in F3 II-1 was in STIM1 (NM 003156.3) exon 7, c.910C>T; p.Arg304Trp chromosome 11:4095850 bp; (GRCh37/hg19) (Fig. 1C and D). This variant was not detected in the dbSNP138 (ncbi.nlm.nih.gov/SNP), 1000 Genomes Project (1000genomes.org), or Exome Variant Server (evs.gs.washington.edu/EVS) databases. The resulting arginine to tryptophan substitution, p.Arg304Trp, is predicted to be detrimental for the protein function according to SIFT [Ng and Henikoff, 2001] and PolyPhen-2 [Adzhubei et al., 2010]. Sanger sequencing of the STIM1 transcript from exon 5 through exon 9 in cDNA converted from leucocyte RNA from patients F1 III1 and F2 II-3 did not detect abnormal transcript variants, and further revealed biallelic expression of STIM1 (wild-type and mutant allele) (Supp. Fig. S2). Sanger sequencing in all patients and available healthy relatives confirmed the segregation of the c.910C>T variant solely in the affected individuals (Fig. 1C and D). Although F1 I-2 was first diagnosed as a Stormorken syndrome patient [Stormorken et al., 1985], subsequent thorough examination lead us to conclude that she was misdiagnosed, as she did not exhibit several core Stormorken syndrome features, including asplenia, congenital miosis, and abnormal size and morphology of blood platelets [Stormorken et al., 1985]. F1 I-2 was not found to carry the mutation. We verified the declared relationships in the family by genotyping individuals F1 I-1, I-2, II-1, and II-2 at 22 microsatellite loci. Finally, none of the 257 healthy controls assessed by Sanger sequencing carried the c.910C>T variant, which results in a p.Arg304Trp substitution in a highly conserved amino acid in STIM1 (Fig. 1E). The same C-to-T transition at a CpG dinucleotide in STIM1 has been detected in six Stormorken syndrome patients in four unrelated families and occurred as a de novo mutation in at least two of the families (F1 and F2). We conclude that the heterozygous presence of c.910C>T in STIM1 causes the autosomal-dominant Stormorken syndrome. HUMAN MUTATION, Vol. 35, No. 5, 556–564, 2014

559

Figure 2. SOCE is impaired in blood platelets from Stormorken syndrome patients Isolated platelets were depleted of ER Ca2+ by treatment with

1 μM thapsigargin for 3 min, in the absence of extracellular Ca2+ . Representative recordings (A) of intracellular Ca2+ levels detected by indo-1 (A) show that platelets from controls exhibited prominent SOCE upon introduction of 1 mM Ca2+ (ntrials = 10, npatients = 3). Resting Ca2+ levels were elevated and SOCE was markedly reduced in platelets from Stormorken syndrome patients (ntrials = 9, npatients = 2), as indicated by representative recordings (A) and mean data (B and C). SOCE induced by rapid application of 25 μM TRAP was similarly attenuated in Stormorken syndrome patients, as detected by fluo-4 fluorescence (D, controls: ntrials = 7, npatients = 2; Stormorken: ntrials = 10, npatients = 2). Overlay histograms showing the exposure of PS detected by annexin V (E, top) and activated GPIIb-IIIa detected by PAC-1 (E, bottom) on the platelet surface of unstimulated platelets from a representative Stormorken syndrome patient (red) and a healthy control (blue). Dot plots of platelet-derived microparticles from one representative Stormorken syndrome patient (F, top) and a healthy control (F, bottom). F: Staining with annexin V FITC and PAC-1 FITC, respectively, is plotted against side scatter. F: Acquisition was gated so that only particles stained by anti-GPIIIa were included. Microparticles and platelets were separated on the basis of their characteristics in forward and side scatter. The percentage of microparticles (microparticles per 100 GPIIIa-stained particles) in the patient was 10.6% (F, top), and 3.24% in the control (F, bottom). Overlay histograms showing the exposure of GP53 (G) and activated GPIIb-IIIa (H) in platelets from patient F1 III-1 (G, top and H, top), and controls (G, bottom and H, bottom), unstimulated (blue) and after stimulation (red) with the PAR-1-activating peptide SFLLRN (100 μM). The GP53 exposure (G) and activated GPIIb-IIIa (H) are given as FL1-height of FITC–Clb–gran 12 (detecting GP53) and FITC–PAC-1 against platelet count. Overlay histograms of platelets from patient F1 III-1 showing exposure of annexin V (I, top) and P-selectin (I, bottom) of unstimulated (blue) and after stimulation with collagen 8.4 ug/ml (red). The exposure of annexin V (I, top) and P-selectin (I, bottom) are given as FL1 height of FITC–annexin V and FITC-AK4 (P-selectin [CD62p]) against platelet count, respectively.

This variant was submitted to the ClinVar database (accession number SCV000118673, ncbi.nlm.nih.gov/clinvar/).

Constitutive Activity of STIM1 and ORAI1 in Blood Platelets from Patients Because the mutation detected in our patients is located within a region of STIM1 CC1 possibly involved in maintaining STIM1 in a resting state [Korzeniowski et al., 2010; Zhou et al., 2013], the mutation might result in augmented ORAI1 activity in cells from the patients. We assessed SOCE in blood platelets isolated from three control individuals and two patients, F1 III-1 and F2 II-3, using fluorescence microscopy. Resting Ca2+ levels were significantly

560

HUMAN MUTATION, Vol. 35, No. 5, 556–564, 2014

elevated in platelets from patients (Fig. 2B), which could be explained by increased Ca2+ influx via ORAI1. We additionally assessed SOCE in platelets due to the established role of ORAI1 in this process. ER Ca2+ stores were first depleted with treatment of thapsigargin, an inhibitor of SERCA activity, for 3 min in the absence of extracellular Ca2+ . In control platelets, reintroduction of extracellular Ca2+ resulted in marked capacitive Ca2+ entry (Fig. 2A), in agreement with previous reports [Varga-Szabo et al., 2008]. In platelets from patients, SOCE was markedly reduced (Fig. 2A–C) and was in fact completely absent in approximately 70% of the platelets examined from patients (two experimental trials: seven of nine runs with indo-1, 12, of 17 runs with fluo-4). Of note, resting Ca2+ levels in platelets from patients were similar to peak levels obtained during SOCE in controls (indo-1 405/480 ratio: 0.11 ± 0.03

Figure 3. Muscle type II fibers in Stormorken syndrome patients show STIM1 positive tubular aggregates. A biopsy was taken from the vastus lateralis muscle from patient FIII 2-1: light microscopy showed increased variation in fiber size. The most important feature was the presence of tubular aggregates (arrows). This granular material was basophilic on hematoxylin and eosin (A), stained red with the Gomori trichrome method (B), showed an intense reaction for NADH–tetrazolium reductase (C), and lacked succinate dehydrogenase activity (D). They were mainly observed in type II fibers (arrows), rarely in type I fibers (arrow heads) in ATPase histochemical reaction pH 9.4 (E). Electron microscopy revealed the ultrastructure of tubular aggregates (arrows) (F). Anti-STIM1 showed strongly positive tubular aggregates (G).

vs. 0.12 ± 0.02, P = NS). Our interpretation of these findings is that near-maximal ORAI1 activity at baseline may inhibit additional activation of this channel by stimuli such as ER store depletion, which normally induces SOCE. We further investigated capacitive Ca2+ entry by treating platelets with TRAP, a potent agonist of SOCE [Aoki et al., 1998] via STIM1 and ORAI1 [Galan et al., 2009; Moreno et al., 2012]. TRAP-induced SOCE was markedly attenuated in the patients (Fig. 2D). These observations further support a gain-offunction alteration in STIM1 activity, resulting in constitutive activity of ORAI1, increased resting cytosolic Ca2+ levels, and loss of SOCE.

Stormorken Patients Exhibit Blood Platelet Defects In Vivo Patients with Stormorken syndrome came to medical attention because of the bleeding diathesis [Stormorken et al., 1985]. Since platelet activation is triggered by an increase in cytosolic Ca2+ concentration, we investigated whether constitutive STIM1 activity was associated with abnormal in vivo platelet activation in Stormorken syndrome patients. Platelet activation was examined by flow cytometry in F1 II-2, F1 III-1 and F2 II-3, and healthy controls, who had

taken no medication for the past 10 days. During platelet activation, elevation of Ca2+ at the cytoplasmic side of the plasma membrane results in a procoagulant surface with exposure of phosphatidylserine (PS) [Lhermusier et al., 2011], which can be measured as binding of annexin V. Flow cytometry of unstimulated platelets from our patients detected significantly elevated binding of annexin V compared with controls (Fig. 2E, top). In addition, increased levels of Glycoprotein (GP)53 (CD63) and P-selectin (CD62p), markers for platelet activation, and alpha granule secretion were found on the surface of unstimulated platelets. In contrast, no significant increase in activation of GPIIb-IIIa was observed on the platelets, measured as binding of the monoclonal antibody PAC-1 (Fig. 2E, bottom) [Shattil et al., 1985]. Compared with controls, unstimulated blood drawn from Stormorken syndrome patients (F1 II-2, III-1, and F2-II-3) contained significantly more microparticles (Fig. 2F), indicating platelet activation similar to that observed during activated coagulation and fibrinolysis [Wiedmer et al., 1990; Holme et al., 1994, 1995]. Upon stimulation by the protease-activated receptor 1 (PAR-1) activating peptide SFLLRN, platelets from patients exhibited additional exposure of aminophospholipids, P-selectin and GP53, and increased binding of PAC-1 (Fig. 2G and H). Increased levels of microparticles HUMAN MUTATION, Vol. 35, No. 5, 556–564, 2014

561

were also observed after such stimulation. However, platelets from patients were much less responsive to stimulation than those from healthy controls. Upon stimulation with collagen, no further significant increase in exposure of aminophospholipids, P-selectin, or microparticles could be detected (Fig. 2I), which may indicate that collagen-induced platelet activation is independent of SOCE. Taken together, these findings indicate that the blood platelets in Stormorken patients are in a preactivated state.

Muscle Histology in Patients Reveals STIM1s Positive Tubular Aggregates Muscle biopsy from the vastus lateralis of patient F3 II-1 was used for histological, histochemical, and electron microscopy analysis. We identified basophilic inclusions particularly in type II fibers. They were negative for succinyl dehydrogenase, but stained intensely with NADH–tetrazolium reductase. Electron microscopy revealed the ultrastructure of these inclusions, which were organized as tubular aggregates, strongly positive for STIM1 by immunohistochemistry (Fig. 3A–G).

Discussion Point mutations in STIM1 have previously been detected in only eight families, presenting with TAM [B¨ohm et al., 2013] or CID [Picard et al., 2009; Byun et al., 2010; Fuchs et al., 2012]. We show that a novel heterozygous STIM1 missense mutation, p.Arg304Trp, segregates with the complex clinical phenotype known as Stormorken syndrome. The bleeding tendency, which caused the ascertainment of the first Stormorken syndrome family and manifests in all patients, leads us to study blood platelet activation in our patients. Patients’ platelets were observed to be in a procoagulant state with an increased thrombotic predisposition. The platelets were in a preactivated state, which is in agreement with our results suggesting constitutive STIM1 activity and Ca2+ entry. Paradoxically, the main clinical phenotype of our patients is a mild bleeding disorder caused by a reduced platelet cohesion observed at various shear rates [Holme et al., 1995]. A similar phenotype, including platelets in a preactivated state and bleeding tendency, was observed in mice heterozygous for a Stim1 EF-hand mutation, resulting in a constitutively active protein [Grosse et al., 2007]. The p. Arg304Trp mutation is located within a stretch of acidic amino acids spanning 291–331 of STIM1 CC1 (Fig. 1A), which shares sequence similarities to the α-helix M4-extension of ORAI1 [Hou et al., 2012]. According to Korzeniowski et al. (2010), this CC1 segment binds and inactivates the CAD/SOAR domain when ER is Ca2+ replete, maintaining STIM1 in a resting state and preventing it from binding ORAI1 and activating SOCE. Specific E to A substitutions in the 291–331 stretch of CC1 (Fig. 1E) seem to result in partial constitutive SOCE activity [Korzeniowski et al., 2010]. These data are in agreement with the view that the p.Arg304Trp mutation in STIM1 impairs the inactivation domain in CC1, so that it no longer acts as a decoy to bind and inactivate the CAD/SOAR domain. The mutant STIM1 would then exacerbate ORAI1-mediated Ca2+ influx, which inhibits additional activation of ORAI1 by depletion of the ER Ca2+ store (SOCE). This assessment is further supported by the observed higher resting Ca2+ levels in platelets from our patients (Fig. 2B), and attenuated SOCE induced by ER store depletion/reintroduction of extracellular Ca2+ (Fig. 2C) or treatment with TRAP (Fig. 2D).

562

HUMAN MUTATION, Vol. 35, No. 5, 556–564, 2014

A combined small-angle X-ray scattering and crystal structure analysis of the STIM1CT and CC1-inhibitory helix (IH) domains places the region in CC1 containing p.Arg304Trp close to the CAD/SOAR domain in the inactive STIM1 [Cui et al., 2013]. In agreement with this, Zhou et al. (2013) suggest that STIM1 CC1 is folded against the CAD/SOAR in the inactive conformation. Although it is not possible to conclude whether p.Arg304Trp interacts with the IH or with the CAD/SOAR domain, the mutation could activate STIM1 by reducing the stability of the inactive form. In support of this, the removal of IH region, and implicitly its interaction with the SOAR and/or CC1 domain, leads to a large conformational change and activation of STIM1 through formation of an extended coiled-coil structure [Cui et al., 2013]. Further, this conformational transition seems to be critically dependent on the amphiphatic nature of the 317–336 region in the CC1 domain [Yu et al., 2013]. An alternative hypothesis to explain the activation of STIM1 by the p.Arg304Trp mutation is that the increased hydrophobicity of Trp relative to Arg may alter the amphipatic balance in the CC1 domain and strengthen the interaction between the α-helices in the activated, extended coiled-coil structure. The detailed molecular mechanism of the role of the R304W mutation will require a high-resolution structure of the full CC1–IH–SOAR domains in the inactive state, or the full CC1 coiled-coil domain in its extended active form. Stormorken syndrome patients commonly exhibit skeletal muscle abnormalities including myalgia, cramps, decreased endurance upon activity, and extraordinary large elevation of creatine kinase levels (Supp. Table S1). We identified tubular aggregates, strongly positive for anti-STIM1 antibody, particularly in type II fibers in a muscle biopsy from F3 II-1 (Fig. 3). These findings are strikingly similar to the tubular aggregates found in the patients reported by B¨ohm et al. (2013), whom carry mutations in the STIM1 EFhand. However, the clinical phenotype differs between the two patient groups, as does the precise deficit observed in SOCE. While both mutations result in constitutive STIM1 activity and interfere with SOCE activity, B¨ohm et al. (2013) observed increased SOCE, whereas we observed attenuated capacitive Ca2+ entry, even at high doses of TRAP. Both mutations appear to result in elevated resting Ca2+ levels, although we observed a more pronounced increase in our platelet experiments. Indeed, resting Ca2+ levels in Stormorken syndrome patients were similar to peak Ca2+ levels obtained during SOCE in controls. We interpret these findings to indicate that STIM1, and thus ORAI1, are nearly maximally activated in our patients at baseline, resulting in markedly elevated resting cytosolic (Ca2+ ). Such high cytosolic Ca2+ levels may reduce the Ca2+ concentration gradient across the cell membrane, inhibiting further Ca2+ entry upon reintroduction of extracellular Ca2+ (Fig. 2A). It would be expected that the CC1-mutated STIM1 should still be able to sense ER Ca2+ levels, which may account for small residual SOCE activity observed in some platelets, and the observation that the preactivated blood platelets in our patients can further be activated by PAR-1. Although we believe our observations of altered platelet Ca2+ homeostasis to be consistent with constitutive STIM1 activity in Stormorken syndrome, other mechanisms may also contribute to alterations in Ca2+ handling. During experimental treatment of platelets with thapsigargin, we did not observe alterations in cytosolic Ca2+ levels (data not shown). We believe that this lack of effect resulted from the fact that this agent is relatively slow acting, and that depletion of ER Ca2+ is dependent on slow Ca2+ leak. It was therefore not possible to assess ER Ca2+ content in these experiments. If ER Ca2+ content is reduced in platelets from Stormorken syndrome patients, this would likely additionally contribute to the

observed attenuation of SOCE. We have not examined Ca2+ removal pathways in our patients, and it is possible that attenuated Ca2+ extrusion contributes to the observed elevation of resting Ca2+ levels. To further examine Ca2+ homeostasis in cells from Stormorken syndrome patients, future work will employ known inhibitors of SOCE such as 2-APB and SKF-96365, and include more comprehensive experiments assessing the effects of altering extracellular Ca2+ levels. In addition to the heterozygous Stormorken syndrome mutation and the EF-hand mutations previously described [B¨ohm et al., 2013], complete STIM1 deficiency has been reported in patients who presented with a CID characterized by defect in function, but not development of lymphocytes [Picard et al., 2009; Byun et al., 2010; Fuchs et al., 2012]. The CID patients suffered from severe viral infections despite normal T, B, and NK cell numbers and immunoglobulin responses and exhibited early-onset autoimmune hemolytic anemia, immunologic thrombocytopenia, and lymphoproliferative disease. In vitro experiments performed on fibroblasts, EBV-transformed B cells or T cells, showed that SOCE activity was abolished in these patients [Picard et al., 2009; Byun et al., 2010; Fuchs et al., 2012]. Analysis performed on three of our patients (F1 II-2, F1 III-1, and F2 II-3) displayed normal B, T, and NK cell numbers, normal levels of immunoglobulins, normal responses to T cell mitogens, and antibody responses to tetanus and diphtheria vaccine. In contrast to ORAI1- and STIM1-deficient patients who have enlarged spleens, our patients have asplenia/hyposplenia [Stormorken et al., 1985; Sjaastad et al., 1992; Mizobuchi et al., 2000; Stormorken, 2002]. The spleen plays important roles in host defense such as B cell maturation and phagocytosis of microbes, and congenital asplenia is a severe health condition [Leahy et al., 2005; Koss et al., 2012]. However, the Stormorken syndrome patients have survived 300 patient years without critical infections. If knock-in mutant mouse lines expressing p.R304W mutated Stim1 show asplenia, further investigation of these mice would advance our understanding of the etiology of asplenia and give insight into how Stormorken syndrome patients survive with asplenia. In summary, the muscle phenotype of the Stormorken syndrome patients is remarkably similar to the phenotype of patients with a STIM1 EF-hand mutation. Even though constitutive STIM1 activity was documented in both patient groups, a complex multiorgan phenotype is observed in the first patient group, whereas only the muscle phenotype was seen in the latter. Constitutive STIM1 results in elevated cytoplasmic Ca2+ levels and attenuated SOCE in platelets from Stormorken syndrome patients. As a result of the increased Ca2+ levels, blood platelets are in a preactivated state, and patients present with a mild bleeding disorder caused by a reduced platelet cohesion. Future investigation of the mechanistic basis of Stormorken syndrome would give important new knowledge about the complex regulation of SOCE in different tissues.

Acknowledgments We are grateful to the families who participated in this study. We thank Professor Dominique Figarella Branger for assistance with histological analyses. We also thank the following colleagues at Department of Medical Genetics, Oslo University Hospital: Dr. Timothy Hughes for assistance with bioinformatics, Dr. Barbro Stadheim for clinical genetic evaluation of patient F1 III-1, and Mette Kroken for performing the microsatellites study on Family 1. The muscle biopsy of patient F3 II-1 was stored in the AP-HM ˆ biobank, authorization number 2008/70, Assistance Publique des Hopitaux de Marseille, France. The sequencing service was provided by the Norwegian High-Throughput Sequencing Centre, a national technology platform supported by the “Functional Genomics” and “Infrastructure” programs of the Research Council of Norway and the Southeastern Regional Health Authorities.

References Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, Bork P, Kondrashov AS, Sunyaev SR. 2010. A method and server for predicting damaging missense mutations. Nat Methods 7:248–249. Aoki T, Tomiyama Y, Honda S, Senzaki K, Tanaka A, Okubo M, Takahashi F, Takasugi H, Seki J. 1998. Difference of (Ca2+)(i) movements in platelets stimulated by thrombin and TRAP: the involvement of alpha(IIb)beta(3)-mediated TXA(2) synthesis. Thromb Haemost 79:1184–1190. B¨ohm J, Chevessier F, De Paula AM, Koch C, Attarian S, Feger C, Hantai D, Laforet P, Ghorab K, Vallat JM, Fardeau M, Figarella-Branger D, et al. 2013. Constitutive activation of the calcium sensor STIM1 causes tubular-aggregate myopathy. Am J Hum Genet 92:271–278. Byun M, Abhyankar A, Lelarge V, Plancoulaine S, Palanduz A, Telhan L, Boisson B, Picard C, Dewell S, Zhao C, Jouanguy E, Feske S, Abel L, Casanova JL. 2010. Whole-exome sequencing-based discovery of STIM1 deficiency in a child with fatal classic Kaposi sarcoma. J Exp Med 207:2307–2312. Cahalan MD. 2009. STIMulating store-operated Ca2+ entry. Nat Cell Biol 11:669–677. Calloway N, Holowka D, Baird B. 2010. A basic sequence in STIM1 promotes Ca2+ influx by interacting with the C-terminal acidic coiled coil of orai1. Biochemistry 49:1067–1071. Collins SR, Meyer T. 2011. Evolutionary origins of STIM1 and STIM2 within ancient Ca2+ signaling systems. Trends Cell Biol 21:202–211. Cui BY, Yang X, Li SW, Lin ZJ, Wang Z, Dong C, Shen YQ. 2013. The inhibitory helix controls the intramolecular conformational switching of the C-terminus of STIM1. PLoS One 8:e74735. Dubowitz V, Sewry CA. 2007. Muscel biopsy. A practical approach. London: Saunders Elsevier. Feske S, Prakriya M. 2013. Conformational dynamics of STIM1 activation. Nat Struct Mol Biol 20:918–919. Fuchs S, Rensing-Ehl A, Speckmann C, Bengsch B, Schmitt-Graeff A, Bondzio I, MaulPavicic A, Bass T, Vraetz T, Strahm B, Ankermann T, Benson M, et al. 2012. Antiviral and regulatory T cell immunity in a patient with stromal interaction molecule 1 deficiency. J Immunol 188:1523–1533. Galan C, Zbidi H, Bartegi A, Salido GM, Rosado JA. 2009. STIM1, Orai1 and hTRPC1 are important for thrombin- and ADP-induced aggregation in human platelets. Arch Biochem Biophys 490:137–144. Grosse J, Braun A, Varga-Szabo D, Beyersdorf N, Schneider B, Zeitlmann L, Hanke P, Schropp P, Muhlstedt S, Zorn C, Huber M, Schmittwolf C, et al. 2007. An EF hand mutation in Stim1 causes premature platelet activation and bleeding in mice. J Clin Invest 117:3540–3550. Holme PA, Muller F, Solum NO, Brosstad F, Froland SS, Aukrust P. 1998. Enhanced activation of platelets with abnormal release of RANTES in human immunodeficiency virus type 1 infection. FASEB J 12:79–89. Holme PA, Solum NO, Brosstad F, Egberg N, Lindahl T. 1995. Stimulated Glanzmann’s thrombasthenia platelets produce microvesicles—microvesiculation correlates better to exposure of procoagulant surface than to activation of GPIIb-IIIa. Thromb Haemost 74:1533–1540. Holme PA, Solum NO, Brosstad F, Roger M, Abdelnoor M. 1994. Demonstration of platelet-derived microvesicles in blood from patients with activated coagulation and fibrinolysis using a filtration technique and Western blotting. Thromb Haemost 72:666–671. Hopf FW, Reddy P, Hong J, Steinhard RA. 1996. A capacitative calcium current in cultured skeletal muscle cells is mediated by the calcium-specific leak channel and inhibited by dihydropyridine compounds. J Biol Chem 271:22358–22367. Hou XW, Pedi L, Diver MM, Long SB. 2012. Crystal structure of the calcium releaseactivated calcium channel Orai. Science 338:1308–1313. Korzeniowski MK, Manjarres IM, Varnai P, Balla T. 2010. Activation of STIM1–Orai1 involves an intramolecular switching mechanism. Sci Signal 3:ra82. Koss M, Bolze A, Brendolan A, Saggese M, Capellini TD, Bojilova E, Boisson B, Prall OWJ, Elliott DA, Solloway M, Lenti E, Hidaka C, et al. 2012. Congenital asplenia in mice and humans with mutations in a Pbx/Nkx2–5/p15 module. Dev Cell 22:913–926. Leahy RT, Philip RK, Gibbons RJ, Fisher C, Suri M, Reardon W. 2005. Asplenia in ATR-X syndrome: a second report. Am J Med Genet 139A:37–39. Lhermusier T, Chap H, Payrastre B. 2011. Platelet membrane phospholipid asymmetry: from the characterization of a scramblase activity to the identification of an essential protein mutated in Scott syndrome. J Thromb Haemost 9:1883– 1891. Li H, Durbin R. 2009. Fast and accurate short read alignment with Burrows–Wheeler transform. Bioinformatics 25:1754–1760. McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A, Garimella K, Altshuler D, Gabriel S, Daly M, DePristo MA. 2010. The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res 20:1297–1303.

HUMAN MUTATION, Vol. 35, No. 5, 556–564, 2014

563

Mizobuchi M, Tanaka C, Sako K, Murakami N, Nihira A, Abe A, Tateno Y, Takahashi T, Nonaka I. 2000. Muscle involvement of Stormorken’s syndrome. Rinsho Shinkeigaku 40:915–920. Moreno C, Sampieri A, Vivas O, Pena-Segura C, Vaca L. 2012. STIM1 and Orai1 mediate thrombin-induced Ca2+ influx in rat cortical astrocytes. Cell Calcium 52:457– 467. Ng PC, Henikoff S. 2001. Predicting deleterious amino acid substitutions. Genome Res 11:863–874. Picard C, Mccarl CA, Papolos A, Khalil S, Luthy K, Hivroz C, LeDeist F, Rieux-Laucat F, Rechavi G, Rao A, Fischer A, Feske S. 2009. Brief Report: STIM1 mutation associated with a syndrome of immunodeficiency and autoimmunity. New Engl J Med 360:1971–1980. Putney JW. 1986. A model for receptor-regulated calcium entry. Cell Calcium 7:1–12. Putney JW. 2007. New molecular players in capacitative Ca2+ entry. J Cell Sci 120:1959– 1965. Shattil SJ, Hoxie JA, Cunningham M, Brass LF. 1985. Changes in the platelet membrane glycoprotein–Iib-Iiia complex during platelet activation. J Biol Chem 260:1107– 1114. Sjaastad O, Aasly J, Stormorken H, Wysockabakowska MM, Horven I, Fredriksen TA. 1992. A new hereditary syndrome with a bleeding tendency, extreme miosis, spasms, dyslexia, thrombocytopathia etc—pupillometric, evaporimetric, and ophthalmological observations. Acta Ophthalmol 70:713–720. Soboloff J, Rothberg BS, Madesh M, Gill DL. 2012. STIM proteins: dynamic calcium signal transducers. Nat Rev Mol Cell Biol 13:549–565. Stathopulos PB, Zheng L, Ikura M. 2009. Stromal interaction molecule (STIM) 1 and STIM2 calcium sensing regions exhibit distinct unfolding and oligomerization kinetics. J Biol Chem 284:728–732. Stathopulos PB, Zheng L, Li GY, Plevin MJ, Ikura M. 2008. Structural and mechanistic insights into STIM1-mediated initiation of store-operated calcium entry. Cell 135:110–122.

564

HUMAN MUTATION, Vol. 35, No. 5, 556–564, 2014

Stormorken H. 2002. Stormorken’s syndrome. Tidsskr Nor Laegeforen 122: 2853–2836. Stormorken H, Holmsen H, Sund R, Sakariassen KS, Hovig T, Jellum E, Solum NO. 1995. Studies on the hemostatic defect in a complicated syndrome—an inverse Scott syndrome platelet membrane abnormality. Thromb Haemost 74:1244–1251. Stormorken H, Sjaastad O, Langslet A, Sulg I, Egge K, Diderichsen J. 1985. A new syndrome—thrombocytopathia, muscle fatigue, asplenia, miosis, migraine, dyslexia and ichthyosis. Clin Genet 28:367–374. Varga-Szabo D, Braun A, Kleinschnitz C, Bender M, Pleines I, Pham M, Renne T, Stoll G, Nieswandt B. 2008. The calcium sensor STIM1 is an essential mediator of arterial thrombosis and ischemic brain infarction. J Exp Med 205:1583–1591. Wang K, Li MY, Hakonarson H. 2010. ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data. Nucleic Acids Res 38:e164. Wiedmer T, Shattil SJ, Cunningham M, Sims PJ. 1990. Role of calcium and calpain in complement-induced vesiculation of the platelet plasma-membrane and in the exposure of the platelet factor Va receptor. Biochemistry 29:623–632. Williams RT, Manji SSM, Parker NJ, Hancock MS, Van Stekelenburg L, Eid JP, Senior PV, Kazenwadel JS, Shandala T, Saint R, Smith PJ, Dziadek MA. 2001. Identification and characterization of the STIM (stromal interaction molecule) gene family: coding for a novel class of transmembrane proteins. Biochem J 357(Pt3): 673– 685. Yang X, Jin H, Cai XY, Li SW, Shen YQ. 2012. Structural and mechanistic insights into the activation of Stromal interaction molecule 1 (STIM1). PNAS 109: 5657–5662. Yu F, Sun L, Hubrack S, Selvaraj S, Machaca K. 2013. Intramolecular shielding maintains the ER Ca(2)(+) sensor STIM1 in an inactive conformation. J Cell Sci 126:2401– 2410. Zhou YB, Seymour S, Razavi S, Meraner P, Rao A, Hogan PG. 2013. Conformational switching mechanisms underlying the activation of stromal interaction molecule 1 (STIM1). Biophys J 104:40A.