Journal of Biotechnology, 16 (1990) 49-56

49

Elsevier BIOTEC 00531

A family of expression vectors based on the rrnB P2 promoter of Escherichia coli Tamas Lukacsovich, Andras Orosz, Gabriella Baliko and Pal Venetianer Institute of Biochemistry, BiologicalResearch Center of the Hungarian Academy of Sciences, Szeged, Hungary

(Received2 November1989; accepted22 January1990)

Summary

We describe here the construction of a family of expression vectors, based on the P2 promoter of the Escherichia coli rrnB gene by removing regulatory sequences downstream of the Pribnow-box and replacing them with the lac operator. These vectors allow cloning of foreign genes in such a way that their products are synthesized either in the form of fusion proteins of different length, or without fusion partners, with or without the original translational initiation signals. One of the vectors contains a synthetic oligothreonine-coding sequence that helps to stabilize the product of the cloned gene. These vectors allow high-level regulated expression of foreign genes, even if their products are relatively short peptides. lac operator; Fusion protein; Human proinsulin; Polylinker; Oligothreonine

Introduction

The promoters of the 7 genes coding for rRNA are probably the strongest promoters of the entire Escherichia coli chromosome as attested by the fact that during exponential growth about 50-70% of all cellular transcription takes place on these genes representing less than 1% of chromosomal DNA (Nomura et al., 1984). The practical application of these promoters for the expression of foreign genes is hampered, however, by the fact that the in vivo activity of these genes is regulated by several intricate mechanisms, that adjust the level of rRNA synthesis to the conditions of growth, and that these regulatory mechanisms are not readily amenaCorrespondence to: P. Venetianer,BiologicalResearch Center, P.O. Box 521, H-6701 Szeged,Hungary.

0168-1656/90/$03.50 © 1990 ElsevierSciencePublishersB.V. (BiomedicalDivision)

50 ble to external control (Nomura et al., 1984). Here we describe the construction of a family of plasmid expression vectors that are all based on the P2 promoter of the rrnB gene, without the above-mentioned drawbacks, and we also present some examples of the application of these vectors for the regulated, high-level expression of cloned foreign genes.

Materials and Methods Enzymes, chemicals

Restriction endonucleases and T4 DNA ligase were prepared in this laboratory. BAL-31 nuclease, polynucleotide kinase, DNA-polymerase Klenow fragment and oligonucleotide linkers were the products of New England Biolabs. 32p-Labelled nucleoside triphosphates were from IZINTA (Budapest). All other chemicals were analytical grade commercial products. Strains and media

All plasmid constructs were used in the loci q g. coli JM107 host strain (Yanisch-Perron et al., 1985) and were grown in Luria broth. Recombinant DNA methods

Standard techniques were used as described in the book of Maniatis et al. (1982). Protein electrophoresis

Proteins were analyzed by SDS-PAGE according to Laemmli (1970). Sequencing

Sequences were determined by the Maxam-Gilbert technique (1977).

Results and Discussion

The construction of the prototype of the new vector family: pER23 was described in an earlier publication (Lukacsovich et al., 1987). Its structure is illustrated on Fig. 1. It contains the rrnB P2 promoter region between positions - 1 1 9 and - 4 (with respect to the transcription initiation site), thus it is not a hybrid promoter (in contrast to the rac promoter described by us earlier, Boros et al., 1986). The P1 promoter is removed, as well as the 5'-end of the transcribed part of the rrnB gene. The P2 promoter sequence is followed by a segment (from position - 4 to + 234 with respect to the transcription initiation site) of the lacZ gene. It contains the operator, the ribosome binding site and the sequence coding for the N-terminal 66 amino acids of fl-galactosidase (a-peptide). Transcription is terminated by the strong double terminators of the rrnB gene, translation by a terminator codon occurring in the rRNA-coding region 54 bp downstream of the lacZ-rrnB junction (Fig. 2). The activity of the promoter can be assessed by measuring (with an in vitro

51 85oo

0

pER~3~crnS[

[QC

h T2

~H rrnB

pgR322 ~i potytinklr~ p R

?T"/

H~or!linkeji ! rr.g F ~

pER 234 -'lrrnB I

longer N-terminot polypepfid~,

pM23 qrrn~ I "

t P

-Irma[lot /

I-

P ER23(- ATG)

P/O ]'11"2 -Irr~lSo~l rr.B- -~t- pER23(*ATG) potytinker subfitutes c+ ~H ~ ~_ p synthetic heptothre0nine-

__ TITz - e pcjlylinker rrnB

lot

rrng

Pf ~'H tinker ~ CIoI inserted

T,T~ /

10100

~0

tot N- tlt,rtminol deteted

/

Ioc frogment

_~rr nBi i~c lpolylinker I

g*/*OO

TI T2

rrnB"-- ~ pER23CH

CEBpSBgXH

-'IrrnBlio~ Isyni'hlpot)'lir, kerI rrn~

I'-pER23TA

C l B mBg114

E Ps

44200

~Or-pL

23 -[rrnal --

? P

Ioc t ,p

)

c

X

r~ T2

[ cat [polylinker[ rr~S-- F tit?it

E 6P,~X~

Fig. 1. Schematic structure of the pER23 plasmid and its derivatives. Open bars represent the elements of the expression cassette, inserted into the pBR322 plasmid (solid line) between positions 4279 and 2069. Functionally important regions are indicated by dots. The coding regions are indicated by braces, and the length of the translation products is given (aa: amino acid residue). T1, T2, terminators; ori, origin of plasmid replication; Apa, fl-lactamase gene; P2, promoter of the rrnB gene; o, lac operator. The localization of restriction sites that can be used for cloning foreign genes are indicated: P, PouII; H; HindIII; C, ClaI; E, EcoRI; B, BamHI; Ps, PstI; Bg; BglII; X; XbaI; Hp, HpaI.

complementation assay) the amount of the synthesized 84 amino acid long peptide with a-complementing activity. Synthesis can be induced by IPTG, the peak of a-peptide level is reached at 60-90 min after induction, at this stage it is at least 200-fold higher than in the repressed state. pER23 in itself can be used to synthesize the products of foreign genes in the form of fusion proteins by using the unique PvulI or HindlII sites. The versatility of this plasmid was extended by inserting a HindlII-HindlII polylinker fragment (sequence shown on Fig. 2) derived from plasmid rrlI VX (Seed, 1983) in both orientations into the HindlII site of pER23. The resulting plasmids pER234 and pER235 allow cloning of foreign genes at the unique ClaI, EcoRI, BamHI, BgllI, XbaI, and PstI restriction sites. In pER234 the polylinker sequence can be translated (if the reading frame is not shifted by the insertion) and translation stops at the same position as in pER23. In the two other reading frames translation stops within the polylinker (between the ClaI and EcoRI sites). In pER235 the in-phase stop codon is at the end of the polylinker. In the other two reading frames translation stops either at the XbaI site or 11 bp beyond the polylinker, within the rRNA sequence. It is well known that several eukaryotic proteins are very unstable in E. coli. Cloning in the form of fusion proteins where the fusion partner is a genuine E. coli protein sometimes helps, but short bacterial fragments (like the 66-amino acid long a-peptide coded by our plasmids) are not always sufficient to protect the protein from intracellular degradation. Therefore two other vector plasmids pM23 and pL23

52 Sequences of the p r o m o t e r - o p e r a t o r - t r a n s l a t i o n initiation pER23 (and pER234, pER235, pM23, pL23, pER23TA):

regions of the vectors:

TTCACTCTGTAGCGGGAAGGCGTATTATGC~TGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACC.~.. .~aCZ) 1 pER23(-ATG}:

TTGACTCTGTAGCGGGAAGGCGTATTATGC~GGAATTGTGAGCGGAT;u~.CAATTTCACACAGG~G...(~a~cZ).. PvuIIll0 pER23(+ATG]:

TTGACTCTGTAG~GGGAAGGCGTATTATGC/~GGAATTGTGAG~GGATAACAATTTCACACAGGAAACAG~-~CTG..(~ac~.. ClaI

107

pER23CIl:

TTGACTCTGTAGCGGG~GGCGTATTATGC~TGGAATTGTGAGCGGATAACAATTTcA~ACAGGAAACAG~ATA~.(p~y~inker).. CI,II

15

Sequences of fusion regions: pER23: ,,PhcProSerLysLeuAla . . . . ThrAla (lacZ). __ .TTTCCGTC ~ CT . . . . (rrnB) __ . . . . ACTGCCTGA 190 11600 1650 pER234: ..PheProSerL sLeuIle . . . . GluAlaCys.. Glu (lacZ). __ .TTTCCGTC~TC..(polylinker) ..TA60~0CT...(rrnB)..GAGTAA 190 107 1635 pER235: ..PheProSerLysLeuLeu . . . . HisArg -

(la~Z)..TTTCCGTC(~TA..(polylinker) ..CATCGATAA 190

1115

5

pM23: ..I]eAspAsp . . . . GluAlaCys . . . . Glu __ ,.(polylinker)...TA ~ C . . . ( r_r_n B ) . . . G A G T A A (lacZl . ~ m T . . 835 h 0 107 1035 pL23: ..AspLeu . . . . GluPheAla.. GluLeu (IacZI..~TCTG__ 112 i01 . . . .

(cat)..__ . ~ - C ~ , C G .40 . ( p o l y l i n k e r ) . . G A T C T C T105 AGI]

pER23TA: MetThrMet . . . . A s p T r p G • u A r g I • e T h r I • e S e r H i s A r g L y s G • n H i s A r g M e t T h r T h r T h r T h r T h r T h r T h r s e r M e t I • e S e r S e r G • n T h r ATGACCATG . . . . G A C T G G ~ A G C G G A T A A C A A T T T C A C A C A G G A A A ~ A G ~ A ~ G T A T G A ~ A ~ C A C ~ A C C A C C A C C A ~ A T A A G C T G T C A A A ~ A T G A 1 ..(lacZ) .... 48~35.. .(lac operator). ..-5 I .(synthetic). 10...(polylinker). Polylinker sequence: ~ATAAGCTGT~AAACATG~CGCGAC~GGCAACGTTGTTG~CATT~CGGAGAACTGGTAGGTATGGA~GAT(~TAC~GCT~ 1 i0 20 30 40 50 60 70

80

90

i00

-

ii0

Fig. 2. DNA and amino acid sequences of relevant regions of the vector plasmids. Promoter, operator and translation initiation codon are underlined. Relevant restriction sites are boxed. Sequences of different origin are separated by vertical bars. Numbering corresponds to the following references: lacZ, Kalnins et al. (1983); cat, Covarrubiasand Bolivar(1982); rrnB, Brosius et al. (1981). were constructed (Figs. 1 and 2), where the polylinker is preceded by regions coding for a 279- or a 409-amino acid long N-terminal bacterial protein, respectively. In pM23 all 279 amino acids are from fl-galactosidase, in pL23 the N-terminal end is fl-galactosidase (375-amino acid residues), fused to a segment (between amino acid residues 39 and 72) of the bacterial chloramphenicol acetyltransferase (CAT). In order to allow cloning of foreign genes without any fusion partner the N-terminal half of the a-peptide coding region (between the AluI site immediately preceding the translational start codon and the PvulI site) was removed from pER23 creating a new unique PvulI site. The resulting plasmid, p E R 2 3 ( - A T G ) , can be used for the cloning of any gene, starting with its own ATG, by blunt-end ligation into the PvulI site. The ribosome-binding site is provided by the vector. This is most useful for cloning chemically synthesized genes. The drawback of this vector is that the spacing of the ribosome-binding site and the A T G is not optimal. In order to circumvent this problem, we inserted a synthetic ClaI linker into the PvulI site of plasmid p E R 2 3 ( - ATG). This derivative, pER23( + ATG) can accommodate and express any coding sequence, or entire gene, lacking the translational initiator. For this purpose, the D N A to be cloned should be first ligated to ClaI linker, then cleaved with ClaI and inserted into the ClaI site of p E R 2 3 ( + A T G ) . In

53 A M

B

1

3

4

M

1

2

iiiiii~iii!i!iiiiiiii!

94. 67 43

30

30 -- ..............

20.1--

!

2o.1

Fig. 3. SDS-PAGE of total cellular protein. E. coli JM107 cells (Yanisch-Perron et al., 1985) transformed with the indicated plasmids were grown till mid-exponential phase in yeast-tryptone medium, then divided, and one-half was induced by the addition of 2 mM IPTG. After 6 h cultures were harvested and total cellular extracts were electrophoresed on (A) 10% or (B) 18% polyacrylamide gels according to Laemmli (1970). Gels were stained with Coomassie blue. The positions of appropriate molecular mass standards (in kDa) are indicated. (A) Lanes 1, 2: pER23(-ATG) carrying the Vibrio fisheri luciferase A and B subunits. Lanes 3, 4 : p M 2 3 with human proinsulin. (B) Lanes 1, 2: pER23TA with human proinsulin induction. Even-numbered lanes: without induction. Odd-numbered lanes: after IPTG induction.

such recombinants the ATG codon is derived from the ClaI linker and it is appropriately positioned to use the ribosomal binding site of the vector. Of course with synthetic DNA the ClaI linker might not be necessary if the synthetic polynucleotide contains the ATG codon and the sticky end for cloning into the ClaI site. In another derivative, plasmid pER23CH, the ~r VX polylinker was inserted between the ClaI and HindIII sites of pER23(+ATG). This vector allows the cloning of DNA fragments at EcoRI, BamHI, PstI, BglII, XbaI or HindIII sites, however in these cases the ribosome-binding site on the vector is located too far from the insert, thus expression can occur only if the inserted fragment contains its own signals for translation. The family of vectors described here has been used in this and other laboratories for the expression of several eukaryotic and bacterial genes [human tumor necrosis factor, Mai et al., personal communication; synthetic human insulin A- and B-chain, Simoncsits et al., personal communication; vasoactive intestinal peptide, Simoncsits et al. (1988), BspI modification methylase, this laboratory; AIDS(HIV) virus processing protease, Giam and Boros (1988)]. Some examples are shown on Fig. 3. In the case of human proinsulin (human proinsulin cDNA was cloned in this

54 laboratory. E. Csordas-Toth, I. Torok and I. Boros, unpublished) efficient production of fusion protein was obtained with plasmids pM23 and pL23. On the other hand, there was no accumulation of the predicted short fusion peptide or the proinsulin, with plasmids pER23 or pER235. With pulse-labelling, the synthesis of the appropriate proteins could be demonstrated (data not shown) but there was no visible accumulation. As the fusion proteins of pM23 and pL23 were very large, with only a minor fraction being the required human proinsulin, we tried to adopt the method suggested by Sung et al. (1986) to our vectors. These authors reported that a short monotonous oligopeptide (consisting of 7 threonines, or glutamines as an N-terminal fusion partner) was able to stabilize human proinsulin in the bacterial cell. With our pER23(+ATG) vector and a synthetic oligothreonine coding sequence upstream of the proinsulin gene, this approach did not work (data not shown). However, when the oligothreonine-coding synthetic DNA was sandwiched between a very short N-terminal piece of the/3-galactosidase gene and the human proinsulin, the fusion product was accumulated in good yield (Fig. 3). As in this recombinant clone the proinsulin-coding region was preceded by a ClaI site, it could be removed and replaced by any other coding sequence with appropriate ends. Thus this plasmid, pER23TA (Figs. 1 and 2), represents an additional member of the vector family where foreign genes can be fused to a short (36 amino acids) N-terminal peptide, containing a stabilizing heptathreonine region. It must be added, that this plasmid (see Fig. 2) has a slightly shortened second operator, and therefore a more efficient repression system, than the previously described other plasmids. The family of expression vectors described here represents a helpful new tool for the practitioners of recombinant DNA technology. The principle applied here is not new, Brosius and Holy (1984) described that the promoter of the rrnB gene can be made regulatable by the lac operator, and it can be used to express protein-coding genes. Our basic vector pER23 differs from their constructs that uses a synthetic lac operator in two important features: (1) it contains a longer upstream sequence from P2, (2) the sequence downstream of the Pribnow-box is also slightly different. Probably these two factors are responsible for the fact that the rRNA promoter of pER23 appears to be stronger than the tac promoter (Lukacsovich et al., 1989), and also for the more efficient repression than that was observed by Brosius and Holy. In addition, the other derivatives described here offer a wide choice of vectors for various applications. Finally, a cautionary note for the users of these plasmids. Owing to the very strength of expression, these vectors can be stably maintained only in the repressed state. The use of a lacI q host is absolutely essential. Cultures should preferably be induced in midlog phase. Once induced, cultures should not be further passaged, or used for plasmid preparation.

Acknowledgements This work was made possible by the financial help of the National Committee of Technological Development and the Gedeon Richter Pharmaceutical Company.

55 T h a n k s are d u e to Mrs. I. A n t o n a n d E. D e m e t e r for t e c h n i c a l a s s i s t a n c e , to D r . A . S i m o n c s i t s ( I n s t i t u t e o f G e n e t i c s , B i o l o g i c a l R e s e a r c h C e n t e r ) for o l i g o d e o x y n u c l e o t i d e s y n t h e s i s a n d T a m a s G a a l ( G e d e o n R i c h t e r ) for t e s t i n g s o m e o f o u r r e c o m b i n a n t s in p i l o t p l a n t p r o d u c t i o n .

References Boros, I., Lukacsovich, T., Baliko, G. and Venetianer, P. (1986) Expression vectors based on the rac fusion promoter. Gene 42, 97-100. Brosius, J., Dull, T.J., Sleeter, D.D. and Noller, H.F. (1981) Gene organization and primary structure of a ribosomal operon from Escherichia coli. J. Mol. Biol. 148, 107-127. Brosius, J. and Holy, A. (1984) Regulation of ribosomal RNA promoters with a synthetic lac operator. Proc. Natl. Acad. Sci. U.S.A. 81, 6929-6933. Covarrubias, L. and Bolivar, F. (1982) Construction and characterization of new cloning vehicles. VI. Plasmid pBR329, a new derivative of pBR328 lacking the 482 base-pair inverted duplication. Gene 17, 79-89. Giam, C.-Z. and Boros, I. (1988) In vivo and in vitro autoprocessing of human immunodeficiency virus protease expressed in Escherichia coli. J. Biol. Chem. 263, 14617-14620. Kalnins, A., Otto, K., Rtither, U. and Miiller-Hill, B. (1983) Sequence of the lacZ gene of Escherichia coll. EMBO J. 2, 593-597. Laemmli, U.K. (1970) Cleavage of structural proteins during assembly of the head of bacteriophage T4. Nature 227, 680-685. Lukacsovich, T., Boros, I. and Venetianer, P. (1987) New regulatory features of the promoters of an E. coli rRNA gene. J. Bacteriol. 169, 272-277. Lukacsovich, T., Gaal, T. and Venetianer, P. (1989) The structural basis of the high in vivo strength of the rRNA P2 promoter of Escherichia coli. Gene 78, 189-194. Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning. Cold Spring Harbor Laboratories, Cold Spring Harbor, NY, U.S.A. Maxam, A.M. and Gilbert, W. (1977) A new method for sequencing DNA. Proc. Natl. Acad. Sci. U.S.A. 74, 560-564. Nomura, M., Gourse, R. and Baughman, R. (1984) Regulation of the synthesis of ribosomes and ribosomal components. Annu. Rev. Biochem. 53, 75-117. Seed, B. (1983) Purification of genomic sequences from bacteriophage libraries by recombination and selection in vivo. Nucl. Acids Res. 11, 2427-2446. Simoncsits, A., Tj~Srnhammar, M.-L., Kalman, M., Cserpan, I., Gafvelin, G. and Bartfai, T. (1988) Synthesis, cloning and expression in Escherichia coli of artificial genes coding for biologically active elongated precursors of the vasoactive intestinal polypeptide. Eur. J. Biochem. 178, 343-350. Sung, W.L., Yao, F.-L., Zahab, D.M. and Narang, S.A. (1986) Short synthetic oligodeoxyribonucleotide leader sequences enhance accumulation of human proinsulin synthesized in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 83, 561-565. Yanisch-Perron, C., Vieira, J. and Messing, J. (1985) Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13 mpl8 and pUC19 vectors. Gene 33, 103-119.