Biochimie (1991) 73, 457-470 © Soci6t6 francaise de biochimie et biologie moldculaire / Elsevier, Paris

457

The promoter of the recA gene of Escherichia coli JM Weisemann*, GM Weinstock** Department of Biochemistry and Molecular Biology, University of Texas Medical School, 6431 Fannin Street, Houston, TX 77225, USA

(Received 25 January 1991; accepted 18 February 1991)

Summary The growth defect of a lambda phage carrying a recA-lacZ fusion was used to select mutations that reduced recA expression. Nine single base changes in the recA promoter were isolated that reduced both induced and basal (repressed) levels of expression. Deletion analysis of the promoter region and mapping of transcripts indicated that there is one main promoter responsible for both basal and induced expression. Some of the mutants displayed a lowered induction ratio, raising the possibility that there is a second, weak promoter that is not regulated by the SOS response. When one of the mutants was examined, it showed normal affinity for LexA repressor binding to the operator site. Binding of RNA polymerase to this mutant promoter, however, was much reduced. Further binding experiments suggested that LexA does not block RNA polymerase binding to the recA promoter, but inhibits a later step in initiation. -

-

SOS response / gone expression / promoter mutants / transcriptional control / LexA repressor Introduction T h e recA promoter was defined by identifying fragments of the gene that could bind RNA polymerase and function in transcription in vitro [1, 2]. In addition, sequencing of the gene uncovered a region of strong homology to the promoter consensus sequence [3]. The only difference found was a one base change in the -35 region (C to T at -30; fig 1). It has been shown that a completely consensus promoter is not as strong as a promoter differing at one position [4]. Thus the single change from consensus m recA may actually strengthen the promoter. Finally, sequencing of the 5' end of the transcript made in vitro showed that there was a major transcript with the 5' end pppAACAGAAC, verifying the location of the promoter [2]. In this experiment a minor transcript, starting at the second A, was also detected. Consistent with this similarity to the consensus promoter sequence, the recA gene is highly expressed in vivo when it is not repressed by the LexA protein. The repression of recA by LexA protein had also been demonstrated in vitro [5, 6]. These studies showed that LexA recognizes a site in recA that lies between the -10 and -35 hexamers of the promoter (fig 1).

*Present address: Plant Molecular Biology Laboratory, Building 006, BARC-West, Beltsville, MD 20705 USA **Correspondence and reprints

Even when repressed, the level of gene expression is high enough to maintain a pool of about 1000 RecA protein monomers per cell [7, 8]. When induced, the level of RecA increases by as much as 20-fold [7-9]. A.

mRNA5' -35 LexABindingSite 10 en~ ACTTGAT/(CT'6"TA'TGAGCA:I:AC'~,'(~TATAATTGCTTCAACAG A A C A T A ~ III I II I COO G CG G TA ShineDalgamo Start 1 2 GACTATCCGGTATTACCCGGCATGACAGGAGTAAAA ATG GCT ATC

-35hexamer .lO hexamer E. col/consensus promoter: TTGACA--17bp-TATAAT'-5/gbp'-A/G recA promoter: T T G ~ T A - - 1 6 b p - ~ A T , iPI~T-'?bp-'A Consensus LexA binding site ("SOS Box"): C T G T a t a t a t a t a C A G

LexA bindingsiteinthe recA gene: C T G T a t g a g c a t a C A G

Fig 1. A) Sites of mutations in the recA gene. The -35 and -10 regions of the promoter, the LexA binding site, the 5' end of the mRNA mapped in vitro, the Shine-Dalgamo site and the initiation codon (Start) are labelled on the sequence. The coding sequence for the N-terminus of the RecA protein is shown, numbered from the N-terminal alanine codon. Mutations are shown below the sequence. B) Comparison of consensus sequences for E coli promoters and LexA binding sites to those in the recA gene.

458

JM Weisemann, GM Weinstock

The ability to produce high levels of R e c A as part o f the SOS response is important to the cell. Also important is to maintain a significant level of basal (uninduced) expression. The recA453 allele is a p r o m o t e r mutation (R Devoret, personal c o m m u n i cation) that reduces expression o f the recA gene. The recA453 mutant is able to perform recombination, but is U V sensitive and displays reduced U V induction o f the SOS response and no UV-induced m u t a g e n e s i s [ 10, 1 1]. Thus, recombination occurs at low levels o f RecA but induction of the SOS response and R e c A overproduction do not, severely reduce survival. A fairly high basal level o f recA expression thus appears to be especially important for processes involving activation of R e c A protein, H o w is this level o f basal expression maintained? Is it due to a second LexA-independent promoter, as seen with some other LexA-regulated genes, such as uw'B [ 12]? Or is it due to incomplete repression by L e x A ? Are there other factors, perhaps other proteins, involved in the regulation of recA? W e describe the analysis o f mutations that have altered the D N A sequence o f the recA promoter. The effects of these mutations should indicate D N A sequences important for recA transcription and perhaps the existence of alternative promoters.

Media and chemicals L, MacConkey, and M63 minimal media were described previously [13, 14]. Ampicillin was used at 150 lttg]ml, chloramphenicol at 25 l.tg/ml, rifampicin at 100 l.tg/ml, and mitomycin C at 1 lag/ml. The indicator 5-bromo-4-chloro-3indolyl-13-D-galactoside (XG) was used to score LacZ + cells and phage [ 13].

Bacwrial growth and genetic manipulations Standard techniques [13, 14] were used for ~, growth, ~, induction, and construction of ! lysogens. Crosses between ~, phages and plasmids, in which recombinants were identified by their Lac phenotype, were performed by preparing a ~, plate stock on a strain harboring the plasmid and then plating the resulting lysate on a Alac strain on L agar containing XG.

Assay of ff~galactosidase activity Assays were performed on duplicate samples as described in [13, 14] with 2 drops each of CHCh and 0.1% sodium dodecyl sulfate per 2 mi of reaction mixture to permeabilize the cells. The intracellular specific activity was calculated as described in [ 14] by the t'oilowing formula: specific activity = 1000 X [ OI)4,.om ( 1.75 X ODsso)l/(T x V x ODt,oo), where T is the length of the assay in min, and V is the volume of the culture used per ml of the assay mixture.

Consu'uction of recombh~ant DNA molecules in vitro Materials and methods

Bacteria. bacwriophages, and plasmids Bacteria, bacteriophages, and plasmids ture listed in table !. The deletion ArecA1398 in strain GE643 was constructed by replacing the internal Ncol-EcoRl fragment of recA with the lacZ gene and then deleting from the Sstll site located 5' to the recA promoter to the Pvull site in iacZ. The resulting deletion is from the Sstll site to EcoRl with a short insert (! 10bp) from the lacZ gene; it removes the recA promoter and coding sequences through codon 259. The deletion ArecA1397, which is carried on plasmid pGE390, is a deletion from the Sstll site through codon 352, the last codon of recA. This was isolated by first creating a Bglll restriction site at codon 352, the last codon in recA, by oligonucleotide mutagenesis. The resulting mutant was digested with Sstll and Bglll and the DNA ends were blunted and ligated to create the deletion. Plasmid pGE430 was made by digesting pGE255 with Sstll and Sinai followed by treatment with T4 DNA polymerase and religation. Plasmid pGE440 was made by inserting the 800 base-pair BamH! fragment from pGE300 into the operon fusion vector pMLBI010. Plasmid pGE300 was derived from plasmid pGE287 by insertion of a Sinai fragment bearing a Kan r marker into the Sstll site 5' to recA. Plasmid pGE287 was constructed by inserting an EcoRl fragment with the 7acZ gene into the EcoRl site at codon 35 in recA in plasmid pGE249. Piasmid pGE440 is thus essentially an insertion of the BamHlSstll fragment 5' to recA into an operon fusion vector. Operon fusions were constructed by inserting the BamHl fragment from the protein fusions into the BamHl site of pMLB 1010.

Parental plasmid DNA prepared by a rapid, small-scale procedure [15] was digested with the appropriate restriction enzymes using the conditions specified by the supplier. The digestions were stopped either by heat treatment (65°C) or by successive extractions with phenol followed by CHCI3. Samples were then mixed, precipitated with ethanol, dried, and suspended in 10--50 [tl of ligase buffer (10 mM Tris-HCl pH 8.0, 10 mM MgCI2, 10 mM DTT, I mM ATP). DNA ligase was added and the mixture was usually incubated at 25°C for 60 rain. Varying amounts of this ligation mixture were used to transform competent cells [ 13]. When phage g DNA was used, the ligation mixture was packaged into phage particles as described previously [ 13].

DNA sequencing and analysis of sequences The DNA sequence of mutant recA-lacZ fusions was determined by the chain termination sequencing method [16]. The templates used in all cases were single-stranded DNA made from pBR322-derived plasmids that contained the intergenic origin of replication region (IG region) of phage M13. Growth L,f strains and extraction of single-stranded DNA from phage particles was as described in [ 17]. Mutations isolated in ~, phages were crossed from the phages into plasmid pGE246 for DNA sequence determination. This plasmid carries the sequences flanking ~P(recA-lacZ)l(Hyb) but has been deleted for the recA portion of the fusion: the deletion extends from the Sstll site upstream from the recA promoter to the ClaI site in iacZ. The cross was pelformed by infecting the M l3-sensitive strain CA7027, harboring plasmid pGE246, with the phage fl derivative IR 1 [ 18] and plating it on L agar. The mutant ~,GE190 phages were then spotted on these

The recA promoter

459

Table I. Bacteria, bacteriophages and plasmids. Name

Description a

Reference

Bacteria CA7027 GEl52 GE439 GE642 GE643 GE2265 JL797

HfrH A(argF-lac)U169 A(ara-leu) thi thr-I leu-6 his-4(Oc) strAl supE galK2 sulAl l lexA51(Def) D(argF-lac)U169 CA7027 A(malB)l GE2265 ArecA1398 srl::TnlO GE 152 ArecA1398 srl::TnlO thr-I leu-6 his-4(Oc) argE3 ilv(Ts) galK2 strAl supE mtl ara sulAl l A(argF-lac)U169 GE2265 lexA 71::Tn5/F'::Tn3 laclq lacZAMl5

T Silhavy [29] [29] [29] [29] [29] [30]

Bacteriophages IR i M 13mp 10 Ml3mpl0recA ~,GE 190

fl derivative lacZo~ ~P(recA-lacZoO125(Hyb) ~,cl(Ind-) ~p(recA-lacZ) 1(Hyb)

[ ! 8] [42] This work [9]

Plasmids pMLBI010 pJWL70 pJWL85 pGE226 pGE320 pGE390 pGE245 pGE246 pGE249 pGE255 pGE430 pGE489 pGE490 pGE287 pGE300 pGE216 pGE440 pGE442

pBR322 A(teO trp" BA'-AW2OS-Iac'OZY' pBR322 lacUV5-1exA + pBR322 lacUVS-lexA84 pBR327 A(HindIII-AvaI) recA+ pGE226 recA1270 Insertion of Sstll-NcoI fragment from pGE255 into pGE226 pGE226 ArecA1397 O(recA-lacZ)l (Hyb) M 13 IG region pGE245 A(recA-lacZ)3 Sstll-Clal deletion pGE226 fecAl40 EcoRl linker inserted at Ncol site in recA pGE245 recA1270 pGE245 recA1270 recAAl4 pGE245 fecAl270 recA1251 pGE245 recA1270 recA1252 pGE249 O(recA-lacZ)2(Hyb) pGE287 kan pBR322 A( teO O(recA-lacZ+ ) l lacY' pGE216 recA DI 3 pGE216 recA1270

[43] [3O] [30] [29] This work This work [29] [29] [29] This work This work This work This work This work This work

[9] This work This work

a O indicates a fusion between two genes; (Hyb) indicates that the fusion makes a hybrid protein.

cells, and the plate was incubated overnight at 37°C. During this incubation, some of the 2~phages recombined with pGE246 to produce a plasmid carrying the mutant fusion. This plasmid was then packaged into an IR1 phage particle. Recombinants were isolated by scraping phage from the ~ spots into 2 ml of phage buffer and heating this lysate at 65°C for 30 rain to inactivate cells. The lysate (1 to 10 l.tl) was then used to infect the Ir MI3 s strain GE439 (100 laD, and Ampr Tetr LacZ + transductants were selected on L agar containing ampicillin, tetracycline, and XG. ince strain GE439 is lr M I3 s, only those plasmids packaged into IR1 particles were recovered. Furthermore, since the starting plasmid, pGE246, gives a LacZhenotype, only plasmids that had received the fusion from the phage gave LacZ+ transduetants. The desired transductants were then purified, and their structure was verified by restriction enzyme analysis before sequencing. Comparison of DNA sequences with the E coli consensus promoter sequence was conducted using a computer program provided by WR McClure [ 19].

Construction of doubly mutant recA promoters The recA./acZ protein fusion ~(recA-lacZ)125(Hyb) contains the first 308 codons of recA. This was introduced from the phage in which it was originally isolated [20] into plasmid pGE246 to form plasmid pGE27 I. The fusion was cloned from plasmid pGE271 into Ml3mpl0 to create a recA-lacZot protein fusion. Single-stranded DNA from this M I3 phage was used as a template for site-directed mutagenesis. Three oligonucleotides: recA1251: 5'-ATACAGTATCGAGTG'ITITGTAGAAATrG; recA1252: 5'-ATACAGTATCAGGTGIqTI'GTAGAAATTG; recA1270: 5'-GTTCTGTTGAAGCAATTAC__ACTGTATGCTC, were made using an Applied Biosystems 380A DNA synthesizer. The bases causing mutations in these sequences are underlined. Oligonucleotide directed mutagenesis was carded out essentially as described in [211, using uracilcontaining DNA templates [221. A preliminary screen of the

460

JM Weisemann, GM Weinstock

isolates was carried out by blotting phage lysates on nitrocellulose, hybridizing with 32P-labelled oligonucleotides, and washing at successively "higher temperatures [21]. The DNA changes were confirmed by sequencing. An NcoI-SstlI fragment containing the mutations was used to replace the wild-type fragment in pGE245 to give plasmids pGE489 and pGE490. Mapping of recA mRNA The DNA probe was a 297 base-pair Sstll-Ncol fragment 32p. labelled at the Ncol 5' end (fig 2). Labelling and isolation of the fragment was performed as described in [231. RNA was prepared according to previous methods [241. Cells were grown in M63 minimal glucose medium at 37°C to an ODs~ of about 0.4. They were spun down, resuspended in 10 mM Tris-HC! pH 7.3, 10 mM KCI, 5 mM MgCI2, added to boiling lysis buffer (200 mM NaCI, 200 mM Tris-HCI pH 7.9, 40 mM EDTA, 1% SDS), and boiled for 2 min. The cell lysate was phenol extracted twwice at 60°C and precipitated with ethanol. The S I nuclease mapping procedure was as before [25]. The DNA probe and the RNA were mixed, precipitated, and resuspended in 30 lal hybridization buffer (80% formamide, 20 mM PIPES, 0.4 M NaCI). Hybridization was carried out for 10 min at 75°C followed by about 8 h at 54-56°C. 270 ~tl of S 1 buffer (30 mM sodium acetate pH 4.6, 50 mM NaCI, I mM ZnCI~, 5% glycerol) was added along with either S I or Mung Bean nuclease. The reactions were run at 37°C and were stopped by addition of ammonium acetate (0.5 M), EDTA (10 mM), and 20 ~tg tRNA. Samples were then precipitated with ethanol, dried, and resuspended in loading solution (80% formamide, 20 mM NaOH, 1 mM EDTA, bromophenol blue, xylene cyanol) and run on a 7% polyacrylamide denaturing (8 M urea) gel. The standards used on the gels were sequencing reactions performed using the M l3mpl0recA as a template and for the primer a 5'-labelled oligonucleotide with the same 5' end (at the Ncol site) as the probe used for mapping.

Sstll

-800bp E co/i DNA

5'

I

N¢ol I

recA mRNA

Ii-

i

......... recAcooingsequence

\\

................

•,,SSIII

"".1

m,,.,

NCOl

,..

p

Labelled SstlI.Ncol DNA fragment 5'-PO

Protein binding at the recA promoter The DNA used was an Sstll-Ncol fragment from either pGE226 or pGE320 labelled and isolated as described for the nuclease mapping experiments. LexA protein was a gift from John Little, University of Arizona. The methods used were based on previous techniques [26--28]. Samples were run on 5% polyacrylamide gels (4.925% acrylamide, 0.075% bisacrylamide) in 50 mM "Iris, 50 mM borate, 2.5 mM Na2EDTA. Gels were prerun 1-2 h at 12 V/cm and run for about 2 h at the same voltage.

Results Isolation o f recA promoter mutations We previously described a selection for mutations that decreases expression of the recA gene [29]. The mutants were selected using a recA-lacZ protein fusion containing the promoter and the first 47 codons of recA fused to a 117 bp open reading frame from the S end of the phage Mu chromosome, which is in turn fused to codon 8 of lacZ. The fusion is regulated in the same manner as recA, but produces a hybrid protein with [~-galactosidase activity. This hybrid protein has 47 amino acids from RecA at its N terminus followed by 39 amino acids from Mu and 1015 amino acids of 13-galactosidase. When the fusion was present in a phage Z, vector, the phage grew normally in wild-type E coil strains, but growth was severely reduced in iexA(Def) strains. Apparently high-level production of the hybrid protein interfered with phage growth. The rare plaques found on lexA(Def) strains were formed by phages with mutations that reduced production of the hybrid protein. Using this selection, nine mutations that altered the recA promoter were isolated (fig 1). Six mutations were m the -35 hexamer and three were in the -10 hexamer. The recA promoter has a D N A sequence with almost perfect homology to the consensus E coli promoter sequence [3]. The nine promoter mutations isolated in the above selection were all single base changes in the highly conserved hexamers around positions -10 and -35, and all reduced the homology to the consensus sequence.

,ii, 5,. 32p

Fig 2. Map of the recA regulatory region. The region of the E coil chromosome that contains the recA gene is shown. In most of the gene fusions used in this study, about 900 bp of E coil DNA are present upstream from recA. An SstII site is about 100 bp upstream from the recA promoter, The SsdI-NcoI DNA fragment used for mapping the 5' end of recA mRNA and the LexA and RNA polymerase binding studies are also shown. The 5' end of the strand of this fragment that is complementary to the mRNA was labelled. The recA promoter sequence is represented by the black box above the P.

Expression o f recA promoter mutants In order to examine the effect of the mutations on the level of expression of the recA gene, the phages carrying the wild-type and mutant recA-lacZ alleles were used to iysogenize wild-type and lexA(Def) strains and the levels of ~-galactosidase activity were measured (table II). Activity in the lexA + strain indicates the basal level of expression when recA is repressed by LexA, and activity in the lexA(Def) strain is that of the non-repressed recA gene. As

The recA promoter expected with mutations that are changes away from the consensus promoter sequence, all the mutants displayed reduced expression. In the lexA(Def) strain expression ranged from 2 to 45% of the wild-type. While expression in the lexA + host was also reduced, the range of variation was more restricted (17 to 46% of wild-type). Comparison of the induction ratios (lexA(Def)/lexA +) showed three types of behavior. The mutants with the highest levels of expression (fecAl272 and fecAl253) had almost wild-type induction ratios. Those with intermediate levels of expression (recA1271, recA1255, fecAl254, and recA1251) showed reduced induction ratios. The three mutants with the lowest activity (recA1252, recA1256, and fecAl270) had induction ratios of only 1.3 to 2.2. The reduction in expression caused by each mutation was thus not the same in the induced and repressed states. The basal level of b-galactosidase activity appeared to reach a lower limit of about 40 units, approximately 20% of the wild-type basal level. Because the fusions were carried on phages, and used to construct single copy lysogens, some of the observed expression could be due to transcription originating within the vector and proceeding into the cloned E cell fragment. To test this, recA-lacZ fusions were crossed from phages into the recA gene in the chromosome so that there would be no vector DNA sequences upstream of recA. When this was performed, the levels of expression were the same as those observed when the phages were at the ~, att site (not shown), demonstrating that there is no expression of the fusion due to the vector. We conclude that the lower limit of recA expression is an intrinsic part of the gene and not an artifact due to the vector.

461

Double mutants of the recA promoter The 9 mutations described above served to identify the DNA sequence that is the main promoter sequence for the recA gene. One explanation for the relatively high basal level and apparent lack of induction of some promoter mutants was the existence of a second promoter. This promoter might provide a low level of expression which was not subject to LexA repression and might be responsible for the bulk of the expression seen in the most reduced mutants. A prediction of this hypothesis is that expression of double mutants of the main promoter shouid be similar to the lowest single mutants. In both cases expression is hypothesized to originate from a second unchanged promoter. To test this idea, two double mutants were constructed by means of site-directed mutagenesis: recA1251 recA1270 and recA1252 recA1270. The recA1251 recA1270 strain combined the mutation that resulted in the lowest activity and lowest induction ratio (recA1270) with a mutation which gave intermediate expression and an intermediate induction ratio (recA1251). The recA1252 recA1270 strain combined two mutations that both gave low activity and low induction ratio. As shown in table III, the combination of mutations did not lower transcriptional activity significantly below that found with the mutant recA1270 alone. The double mutants showed a basal level of about 20% of wild-type while the induced level was 1-2%. The recA1251 recA1270 mutant had about half the activity of recA1270; the recA1252 recA1270 mutant was about the same as recA1270. The fact that the double mutants did not show significantly reduced expression when compared to the

Table II. Effect of recA promoter mutations on expression of a recA-lacZ fusion. Lysogens of GE2265 and GEl52 were

grown for approximately 20 generations in M63 medium supplemented with amino acids. The lysogens carried ~,GE190 (wildtype) or derivatives of this phage with promoter mutations. Samples were taken while cultures were growing exponentially and assayed for [3-galactosidase activity. Values given are an average of 3 separate sampling points.

fl.galactosidase b recA Allele

Promoter sequencea

wild-type recA 1272 recA1253 recA 1271 recA1255 recA1254 recA1251 recA1252 recA 1256 recA1270

ttgata- 16-tataat ttgata- 16-tataGt ttTata-16-tataat ttgata- 16-Cataat ttgGta-16-tataat ttCata- 16-tataat tCgata-16-tataat Ctgata-16-tataat ttgTAC-15-tataat ttgata-16-tGtaat

lexA+ 229 (100) 105 (46) 57 (25) 78 (34) 40 (17) 53 (23) 44 (19) 58 (25) 56 (24) 56 24)

lexA (Def) 4296 (100) 1937 (45) 914 (21) 694 (16) 482 (11) 422 (9.8) 391 (9.1) 130 (3.0) 99 (2.3) 73 (1.7)

Induction ratio lexA(Def)/lexA + 19 18 16 9 12 8 9 2.2 1.8 1.3

aSequence differences from wild-type are shown in bold, capital letters; bNumbers in parentheses represent the percent expression with respect to wild-type

462

JM Weisemann, GM Weinstock

Table IIL Effect of double mutations in the recA promoter on expression of a recA-lacZ fusion. Cultures were grown and assayed as shown in table II. Numbers in parentheses are the percent of activity relative to the wild-type strain. fl-galactosidase recA allele

recA allele

Promoter sequence

wild-type recA 1251 recA1252 recA 1270 recA 1251 recA1270 recA 1252 tvt'A 1270

ttgata- 16-tataat tCgata- 16-tataat Ctgata-16-tataat ttgata- 16-tGtaat tCgata- 16-tGtaat Ctgata- 16-tGtaat

lowest single mutants is evidence that a large part of the basal expression in the mutants was due to another promoter. On the other hand, both double mutants contained the fecAl270 mutation and it was possible that some unusual property of this mutation was responsible for the observed effects. Deletions at the recA promoter

To determine whether there was another promoter that contributed to recA expression, a number of deletions were made in the region upstream from the recA structural gene. This region included about 900 bp of E coil DNA (fig 2). The deleted fragments were in lacZ protein and operon fusion vectors and 13-galactosidase activity was measured (fig 3). These experiments were performed with fusions carried on multicopy plasmids, rather than as single copies in the bacterial chromosome. When the fecAl270 allele was tested in a protein fusion (plasmid pGE255), there was lov; a,c~ivity and little induction, similar to the phenotype observed as a single copy in the host chromosome. Plasmid pGE430 was derived from pGE255 by deleting the DNA fragment from the Sinai site at the end of the insert to the Sstll site 5' to recA. About 800 bp of E coli DNA upstream from recA was deleted by this procedure. Comparison of plasmids pGE430 and pGE255, which both have the recA1270 allele, showed that this region 5' to the Sstll site had no effect on expression. Deletions downstream from the promoter affect the translation start site of recA, and thus it was necessary to investigate these as operon fusions. In the operon fusions, translation initiation is provided by lacZ. As shown in figure 3, the level of expression from fecAl270 in an operon fusion (plasmid pGE442) was higher than from the protein fusion. This may reflect the different translation initiation sites or the fact that the ~l-galactosidase is not a hybrid protein in the operon fusion, rather than differences in transcriptional activity. In any case, this mutant showed its

lexA+

lexA (Def)

229 (100) 44 (19) 58 (25) 56 (24) 34 (15) 58 (25)

4296 (100) 391 (9.1) 130 (3.0) 73 (1.7) 36 (0.8) 67 ( 1.6)

characteristic phenotype of low expression and poor induction when compared to wild-type recA in an operon fusion (plasmid pGE216). Expression from the mutant recA1270 fusion was higher than the background level of expression due to readthrough transcription seen with the vector alone (plasmid pMLB1010). In contrast, plasmid pGE440, carrying the mutation A13, had a level of activity similar to that of the operon fusion vector alone. The deletion in this plasmid extends from the SstlI site to the start of iacZ, and is thus missing all of the promoter and recA structural gene. In AI3 the 800 bp upstream segment from E coil is fused to the lacZ gene in an operon fusion. This result confirms the observation from the protein fusion, namely that there is no promoter upstream from the SstlI site. Genotype or Deletion

Map of deletion

Plasmid

p-~lacto~lue .nlu lexA, lexA(Oet)

Protein Fusions: I

I

~ ~m1" I .. ~

recA1~70

pGF.265

4OO

61s

fecal270/ A10

pGE430

394

540

Vector

pMLB1010

401

384

w.t.

pGE216

6523

N~

fecal270

pGE442

1358

1794

Als

pQE440

SSe

sgs

Operon Fusions: I

I

~

I

I r- ~

I

I

I:

Fig 3. Effect of deletions on expression of recA-lacZ fusions. Strains GE2265 and GEl52 were transformed with the indicated plasmids. Cultures were grown in L broth + ampicillin and assayed as described in Methods. The map " shows the DNA fragment of figure 2. The vertical line at the position of the S represents the Ssdl restriction site; '.he two small boxes at the position of the P represent the recA promoter; solid black box, recA structural gene; gray box, Mu S sequence.

The recA promoter

463

A number of other deletions were constructed in the region between the SstlI site and the structural gene (data not shown). No consistent pattern emerged from this analysis and it was not possible to localize a second promoter outside of the main promoter region. This analysis was complicated by the use of plasmids. Some potential difficulties stem from the variability of copy number in comparing different deletions, as well as readthrough transcription effects and the possibility that recA may not be regulated the same on a plasmid as in the bacterial chromosome. Our primary conclusion is that if there is a second promoter, it is near the main recA promoter. Mapping the 5' end of in viva recA transcripts Mapping of recA transcripts synthesized in viu'o had previously shown that there was a single transcript with a start coinciding with the first adenosine after the -10 region [2]. If a secondary promoter was used in viva, the transcript might be seen by mapping the 5' end of recA mRNA made in viva. An alternative start site would be especially obvious if it was used in the severe promoter-down mutants. It might also be possible that different start sites could be used under repressed and induced conditions. RNA was isolated from a wild-type strain (GE2265), a iexA(Def) strain (GEl52), and from strains deleted for recA but containing plasmids carrying the wild-type recA gene (pGE226) or the mutant recA1270 gene (pGE320). The RNA was hybridized with a 297 bp SstlI-NcoI DNA fragment labelled at the NcoI end (fig 2). This Ncol site is at codon 35 in the recA gene. The RNA-DNA hybrids were then treated with either S I nuclease or Mung Bean nuclease (figs 4 and 5). The result in each experiment was a group of protected bands; there was never a distinct single protected band. When S I nuclease was used (not shown), two main clusters of bands were seen on gels: one centered around the position identified as the in vitro start site (fig 5B, Group I), and a second cluster of bands about four bases shorter than the first (Group II). With Mung Bean nuclease there was a more distinct pattern of individual bands, but there were still two main groups at about the same position as seen with S 1 (figs 4 and 5). The reason for the multiple bands seen in these experiments is not known. It could be due to mRNA degradation either in the cell or during the extraction, it could be due to some property of the nucleases or the reaction conditions, or it could actually represent alternative start sites. Because of differences between gels in the way protected fragments ran relative to the standards, the 5' ends of the fragments could not be matched precisely with specific locations in the sequence.

ACGT

123456

. ~

7

~

i'U ,. ~

.lol

Fig 4. Mapping of recA mRNA. Eighty ~g of total cellular RNA was hybridized with the SstlI-NcoI DNA probe (40 000 cpm) and digested with 297 units of Mung Bean nuclease for 1 h at 37°C. A, C, G, T: DNA sequence lanes. Lanes I-3: strain GE642 lexA + ; Lanes 4-7: strain GE643 lexA (Def); lanes 1, 4:pGE226 recA+; lanes 2, 5:pGE320 recA1270 ; lanes 3, 6:pGE390 ArecA; lane 7: undigested probe (4000 cpm). For all of the RNA preparations from recA+ or recA1270 strains almost the same pattern of bands was obtained. This meant that transcription initiated at the same site whether the gene was in single copy in the chromosome or carried on ~ plasmid, whether it was repressed or induced, or whether it was the wildtype or the mutant. The only difference observed for the mutant was that the protected bands in group II tended to be darker than those in group I, the reverse of the wild-type pattern (fig 5). To rule out the possibility that there could be transcription starting from the 5' side of the Sstll site, a probe was used that covered the whole cloned E coli fragment 5' of the NcoI site (EcoRI - NcoI). This did not reveal any start site upstream of the Sstll site (not shown). This was consistent with the deletion analysis, which showed that the removal of DNA 5' to the SstlI site resulted in no change in the expression of recA1270.

464

JM Weisemann, GM Weinstock

ACGT 1 2 3 4 5 6 7

There was no clear indication in these experiments that there was a second transcription start site. All transcripts observed mapped as starting in the same region (within about 20 nucleotides). This confirmed the conclusions of the deletion experiments: that there is no distant second recA promoter. Effect o f LexA concentration on recA expression in vivo

2:2

• 10

I

B

~

GCTT~T&TTG~'T&TCCGG

I

I Z

t

I ZZ

Fig 5. Mapping of mRNA from the recA gene in the E coli chromosome or carried on a plasmid. A) Total cellular RNA was hybridized with the SstlI-Ncol DNA probe (30 000 cpm) and digested with 400 units of Mung Bean nuclease for 1 h at 37°C. A,C,G,T: DNA sequence lanes; lane 1: strain GE2265 lexA + recA +/100 ~tg RNA; lane 2: strain GEl52 lexA (Def) ArecA +/20 ~tg RNA; lane 3: strain GE642 lexA + DrecA/lO0 ~tg RNA; lane 4: strain GE642 lexA + carrying pGE226 recA +/30 ~tg RNA; lane 5: strain GE643 lexA (Def) carrying pGE226 recA+/20 l,tg RNA; lane 6: strain GE642 lexA+ carrying pGE320 fecal270/30 ~tg RNA; lane 7: strain GE643 lexA (Def) carrying pGE320 recA1270/30 ~tg RNA. B) DNA sequence at the start of the transcripts. Boxed sequence is the -10 region. I and II are the regions in which the protected bands occur.

A second explanation for the apparent lack of induction of some of the mutants was that LexA binding had been affected by the mutations. In order to test this in vivo, the phages carrying the mutant recA-lacZ genes were introduced into a strain containing a plasmid with the lexA gene under control of a lac promoter. The amount of LexA protein in the cell could thus be increased by adding the gratuitous lac inducer isopropylthiogalactoside (IPTG). Two plasmid constructions were tested: pJWL70 which carries the wild-type lexA structural gene and pJWL85 which carries the mutant lexA84 gene [30]. The product of the lexA84 gene is deleted for 17 amino acids and is less efficient at repressing wild-type recA.. Several questions were asked. Can LexA repress the mutant recA genes? If normal levels of LexA have no effect, can increased levels reduce expression? Will mutant and wild-type recA genes respond in the same way to different LexA proteins (LexA + versus LexA84)? First it was noted that in these strains LexA did repress all the mutant recA genes, although to varying extents (table IV). These results differ from those found with the GE2265 and G E l 5 2 lysogens Table IV. Effect of LexA overproduction on expression of recA promoter mutants. Lysogens of JL797 were grown in L broth with ampicillin for approximately six h, Samples were taken while cells were growing exponentially and assayed for 13-galactosidase activity. Plasmids pJWLT0 and pJWL85 carry lea:A genes under lac control. No IPTG was added however, since repression of these genes is incomplete. Numbers in parentheses are the percent expression with the lexA plasmid relative to the lexA (Def) strain JL797 [J-galactosidase activity

In some of the experiments there was a background of less prominent bands especially at the position of A-T base-pairs. In particular there appeared to be a signal at a run of four A-T base-pairs just 5' to the -35 region. However, the signal from this region was weak compared to that found in groups I and II (fig 5).

recA allele

JL797 lexA (Def)

wild-type recA1272 recA1271 recA 1251 recA1252 recA1256 recA1270

4019 2105 395 440 83 194 104

JL7971pJWL70 lexA+

102 42 42 23 19 44 20

(2.5) (2.0) (ll) (5.2) (23) (23) (19)

JL797/pJWL85 lexA84

879 399 129 79 24 55 30

(22) (19) (33) (18) (29) (28) (29)

The recA promoter (table II). While in the earlier case some mutants appeared to be uninducible, in this case all displayed some inducibility. This could be due to strain differences, especially the difference in the lexA(Def) alleles: the product of lexASl(Def) (the allele in GEl52) may be more functional than that of lexA71::Tn5, the allele in JL797 [31]. It was also found that the presence of the lexA plasmid may have more general effects on gene expression. Activity of a tyrT-lacZ fusion, which is not regulated by lexA, was also reduced by about 40% in strain JL797 when pJVvq_.,70 was introduced (not shown). Another factor affecting the results reported in these two tables was the growth medium. For all the strains tested, expression of the recA-lacZ fusion was at least 2-fold higher in minimal media than in rich (LB) media. As seen in figure 6 there were several types of responses by the recA-lacZ fusions to an increase in LexA concentration. The wild-type fusion displayed a steep drop in activity as the concentration of IPTG

120 i00 =

80

60

6 20

f/

0

I

I0 -6

I

i0-5

I

I0 -4

I

i0-a

465

was increased from 10-6 to 10-3 M. Some of the mutants also displayed a steady decline, but with a much flatter slope (recA1272, recA1271). The activity of recA1256 was affected only by the highest levels of IPTG. The mutants recA1252, recA1251 and recA1270 were reduced to their lowest level simply by the presence of the lexA plasmid and their activity altered very little with increasing IPTG. In general, the effect depended on the promoter strength: stronger promoters (those that had the highest unrepressed activity) required more LexA in order to be turned off. The exceptions were recA1251, which was repressed more than expected, and recA1256, which was less repressed. The recA1256 mutant is interesting because it is a deletion in the -35 region that reduces the spacing between the two hexamers and might change the relative position of binding of LexA and RNA polymerase. Finally, there were differences in the responses to wild-type LexA and to the mutant LexA84. In the presence of pJWL85, with no added IPTG, all recAlacZ fusions were repressed to about the same extent (table IV). This is in contrast to the effect found with pJWL70. Wild-type recA and some of the mutants (recA1272 and recA1251) were far more strongly repressed by wild-type LexA than by LexA84. The other group of mutants (recA1271, recA1252, recA1256, and recA1270) were repressed equally well by both LexA and LexA84. This could be due to differences in binding affinity to the mutant sites or to a difference in the mechanism by which the mutant LexA blocks transcription. Alternatively the wildtype LexA, but not LexA84, may in some way enhance the expression from the mutant promoters. The response to increases in IPTG concentration was similar in the case of both pJWL70 and pJWL85 (figs 6 and 7). At very high concentrations of IPTG all the fusions in both strains were shut down to about the same level: in these experiments the lowest level of ~-galactosidase activity was around 12 units. As a comparison, the measured activity of an ochre mutation (recA1265) in a fusion in a wild-type host was less than one unit. Thus the lower limit to recA expression is significantly above the background of the assay.

I0-2

[IPTG] M Fig 6. Effect of increasing amounts of LexA on expression of recA-lacZ fusions. Strain JL797 containing the plasmid pJWL70 (lexA+) and the recA-lacZ fusion with the indicated mutant allele were grown in L broth for several hours, diluted into L broth with IPTG, incubated another 4 hours, and assayed for ~-galactosidase activity. D wild-type; o recA1270; recA1251; [] recA1256; [] recA1271; [] recA1256; • recA1252.

In vitro binding of LexA and RNA polymerase to recA The binding of LexA protein to the operator of the wild-type recA gene and the mutant recA1270 gene was examined by electrophoretic mobility shift assays in polyacrylamide gels. 32P-labelled DNA fragments from either the wild-type recA or mutant recA1270 genes were titrated with increasing amounts of LexA protein. The same pattem of binding was observed for both (fig 8). Furthermore the addition of unlabelled

466

JM Weisemann, GM Weinstock 1000

A

m 800 tl

"o ii

600

m o m

400

mm

cp

200

;.Y 0

10 .6

10"

10"

' -3

10

10

-2

[IPTG] M 80

B

iim

¢: :1

um

m

60

40

u m

mm

t~

?

major part of the bound wild-type fragment was in one band, the mutant showed three closely spaced bands at approximately the same position as the bound wild-type band. When samples were not treated with hepaxin, most of the wild-type DNA fragment appeared in the same position as the heparin-resistant band (fig 9A, lane 2) with additional bands running slightly behind or in front of this band. For the mutant, a large part of the radioactivity was spread throughout the lane, indicating that the complexes might be dissociating during the running of the gel (fig 9A, lane 5). At 4°C (fig 9B) the complexes formed between RNA polymerase and the wild-type fragment without heparin treatment were similar to those seen at 37°C. The amount of heparin-resistant complex was slightly reduced. In the case of the mutant fragment, complexes under either condition were undetectable. In another experiment radioactive counts of DNA retained in each band were determined (fig 10 and table V). Under conditions in which about 60% of the wild-type recA fragment was bound by RNA polymerase, only about 10% of the mutant fragment was bound. Nonspecific binding (samples not treated with heparin - lanes 3, 5, 9, 11) was similar in extent for both fragments, although the pattern for the mutant was more diffuse. Preincubation with

20

¢Q.

2 3 45 1 ""

0

I

10 -6

I

10 -5

I

10

6 7 8 9101112

I

-4

10

-3

10

-2

[IPTG] M

Fig 7. Effect of increasing amounts of LexA84 on expression of recA-lacZ fusions, Strains and conditions were the same as for figure 6, except that the plasmid used was pJWL85, which carries the mutant lexA84 gene instead of wild-type lexA. A: ~z wild-type; n recAl?72; ~7 recA1271; B: o fecal270;