MGG
Mol Gen Genet (1992) 232:117-125
© Springer-Verlag 1992
The promoter region of the Escherichia coil pepD gene: deletion analysis and control by phosphate concentration Bernhard Henrich, Heike Backes, Jiirgen R. Klein, and Roland Plapp Universit/it Kaiserslautern, Fachbereich Biologie,Abteilung Mikrobiologie,Postfach 3049, W-6750 Kaiserslautern, FRG ReceivedJune 21, 1991 / Accepted October 11, 1991 Summary. A series of deletions removing progressively larger parts of the 5' flanking region of the Escherichia coli pepD gene was constructed. After fusing the resulting promoter fragments to the chromosomal malPQ operon, their activities were determined by assaying for amylomaltase, the product of the malQ gene. Transcription from the pepD promoter region in exponentially growing cells was estimated to be about 5 times less efficient than transcription from the induced lac promoter. Approximately 115 bp preceding the translation start site of the pepD gene are important for regular promoter functioning, whereas the more distal sequences could be deleted without any significant effects. In bacterial cultures containing limiting amounts of inorganic phosphate, the rate of de novo synthesis of peptidase D, simultaneously with the derepression of alkaline phosphatase, increased about fivefold as a consequence of phosphate starvation. This regulation was shown to occur at the transcriptional level by the use of chromosomal pepD promoter-malPQ fusions. The inducibility by phosphate limitation was conserved in all of the deletion clones in which the pepD promoter region was still functional. As demonstrated by the use of phoB, R, and M mutants, the modulation ofpepD expression is independent of the genetic system controlling the pho regulon. Key words: Peptidase D - p e p D promoter Deletion analysis - Phosphate limitation - p e p D regulation
Introduction
Escherichia coli possesses a series of peptide-hydrolyzing enzymes with partly overlapping substrate specificities (Lazdunski 1989). One of them, peptidase D, is encoded by the pepD gene which we recently identified in a plasmid library by complementation analysis (Klein et al. 1986). Subcloning and sequencing of the respective Offprint requests to: B. Henrich
D N A fragment revealed an open reading flame coding for the 53 kDapepD product (Henrich et al. 1990). These sequence data were combined with the sequences of the adjacent gpt, phoE, and proBA genes to give a continuous 8.7 kb stretch of DNA sequence which was localized to the 5.7 min position on the circular E. coli map (Henrich and Plapp 1991). Using transcript mapping we identified two species of monocistronic pepD m R N A with a common 3' end and different 5' ends about 32 nucleotides apart. However, the possibility that one or both of the transcripts detected arose by cleavage of a longer m R N A species has not yet been ruled out (Henrich et al. 1990). Peptidases are not only involved in the utilization of peptide substrates supplied in the medium but also play an essential role in the breakdown of intracellular proteins, particularly under conditions of nutritional starvation (Simmonds and Fruton 1949; Yen etal. 1980). In E. coli, the metabolic imbalance caused by limitation of nutrients in the environment, is rapidly compensated for by modulating the expression of specific sets of genes which are integrated in so-called global regulatory networks (Gottesman 1984). Thus, starvation-induced degradation of cellular proteins may be due partly to elevated expression of peptidase genes. In fact, regulation by phosphate or oxygen limitation has already been demonstrated for aminopeptidase N of E. coli (Gharbi et al. 1985) and aminotripeptidase T of Salmonella typhimurium (Strauch et al. 1985). In this communication we report the location of functional elements that are indispensable for effecting pepD promoter function, and we provide evidence for a modulation ofpepD expression at the transcriptional level by the concentration of inorganic phosphate. Materials and methods
Bacterial strains, phage and plasmids. The E. coli KI2 strains used are listed in Table 1. Phage M 13mpl 8 (Norrander et al. 1983) was obtained from Pharmacia LKB,
118 Table 1. Bacterial strains
Strain
Genotype
Source or reference
JMI09
Yanisch-Perron et al. (1985)
NK5526 BW3414 BW3637 BW3627 BW3699 C600
recA1 endA1 gyrA96 thi hsdR17 supE44 relA1 2- A(lac-proAB) IF' traD36 proAB lacl°ZAM15] hisG: :TnlO IN (rrnD-rrnE)l Alac-169 Alac-169 phoB52 Alac-169 phoR68 A lac-169 phoR68 phoM451 F- thi thr leu lacY tonA supE
pop2239
C600 AmalA510
pop2239a pop2239b pop2239c pop22391 pop22392 pop22393 pop22394 pop22395 pop22396 pop22397 C6008
pop2239malPpA534: :pepDp" pop2239malPpA534 : :pcpOp b pop2239malPp A 5 34 : :pep Dp c pop2239rnalPpA534: :pepDp 1 pop2239malPpA534: :pepDp 2 pop2239malPpA534: :pepDp3 pop2239malPpA534: :pepDp4 pop2239malPpA534: :pepDp5 pop2239malPpA534: :pepDp6
C6009
pop2239a
pop2239 malPp A5 34 : :pep Dp 7 C600 malPpA534: :pepDp s C600 malPp A534 : :pepDp 9 pop2239 malPpA534: :pepDp d
N. Kleckner Wanner (1986) B. Wanner B. Wanner B. Wanner Appleyard (1954) Raibaud et al. (1984) This work This work This work This work This work This work This work This work This work This work This work This work This work
The notation malPpA534 designates the malPQ promoter, inactivated by a 120 bp deletion (Vidal-Ingigliardiand Raibaud 1985). Fragments of the pepD promoter region (pepDp) that were inserted in front of the malPQ operon (Figs. 1, 2) are denoted by superscripts. The superscript numbers refer to EcoRI-PstI fragments containing the deletions 1-9 (Fig. 1)
Freiburg. The construction of plasmids p J K l l and pJK13, containing the pepD gene, has been described previously (Klein et al. 1986). The vector pOM41, designed to integrate DNA fragments into the bacterial chromosome (Vidal-Ingigliardi and Raibaud 1985), was kindly supplied by O. Raibaud, Institut Pasteur, Paris. Media, enzymes and reagents. AP medium corresponds
to basal medium A-P as described by Torriani (1960), supplemented with thiamine (1 rag/1 final concentration) and 0.4% of either glucose or glycerol. M63BI medium was prepared as described by Miller (1972), with 1 mg of thiamine per 1. LB medium contained 10 g tryptone, 5 g yeast extract and 5 g NaC1 per 1. X-gal-IPTG plates contained LB medium, 1.5% agar, 0.04% 5-bromo-4chloro-3-indolyl /~-D-galactoside (X-gal) and 0.5mM isopropyl fl-D-thiogalactoside (IPTG). Restriction and DNA modifying enzymes were purchased from Boehringer Mannheim, Mannheim and Pharmacia LKB, Freiburg. Reagents for DNA sequence analysis were from Pharmacia LKB. Merthiolate, p-nitrophenyl phosphate and o-nitrophenyl-/%D-galactoside were obtained from Sigma, Mfinchen; 4-amino-2,3-dimethyl-l-phenyl-3-pyrazolin-5-one and 2,4-dichlorphenol were from Merck, Darmstadt. Glucose oxidase (grade II) from Aspergillus niger and peroxidase (grade II) from horse radish were
from Boehringer Mannheim, and fl-alanyl-L-alanine was purchased from Bachem, Heidelberg. Growth conditions and cell disruption. Cultures of E. coli were routinely incubated at 37°C and 230 rpm in a rotating water bath. To determine specific activities of amylomaltase, bacteria were grown in 1.5 ml of M63B1 medium supplemented with 0.4% glycerol. At a n 0 D 6 o o of about 0.5 the cells were centrifuged, washed in 0.1 M sodium phosphate buffer (pH 7.0), resuspended in 0.3 ml of the same buffer, and subsequently disrupted by ultrasonication. Debris was removed by centrifugation for 20 rain at 4°C and 12000×g, and the supernatants, after determination of their protein contents by the method of Lowry et al. (1951), were stored at - 7 0 ° C. To follow the activities of various enzymes in the presence of limiting amounts of inorganic phosphate (Pi), cells were grown overnight in AP-glucose medium (for the determination of peptidase D and alkaline phosphatase) or in AP-glycerol medium (for the determination of amylomaltase), both supplemented with 0.75 % bactopeptone. The cells were washed and subsequently subcultured in the same medium containing 0.25% bactopeptone. At different times, further enzyme synthesis was instantaneously blocked in 40 ml (peptidase D, alkaline phosphatase) or 20 ml (amylomaltase) aliquots of the cultures by the addition of merthiolate (0.1 mg/ml final concentration), and the killed cells were collected by centrifugation at 2° C, washed once with an appropriate buffer (0.1 M TRIS-HC1 pH 9.0, 0.1 mM COC12 for peptidase D and alkaline phosphatase; 0.1 M sodium phosphate buffer pH 7.0 for amylomaltase), and stored at - 7 0 ° C. To disrupt the bacteria, the cells were resuspended in 0.8 ml (peptidase D and alkaline phosphatase) or 0.5 ml (amylomaltase) of the respective buffer and shaken with 1:100 volume of toluene at 37°C for 30rain. Toluenized cell suspensions were stored at - 70° C. To estimate the efficiency of/~-galactosidase ~-complementation in cells infected with various derivatives of phage M13mpl 8, overnight cultures of strain JM109 were diluted 50-fold in 30 ml of LB medium containing 1 mM IPTG. After infection with about 10 l° phages, the bacteria were vigorously agitated at 37° C for 3 h, harvested by centrifugation, and resuspended in 1.5 ml of Z buffer (Miller 1972). Cells were disrupted by the addition of 60 ~tl CHCls and 30 gl 0.1% sodium dodecylsulfate to these suspensions. Recombinant D N A and sequencing techniques. Preparation of plasmid DNA and isolation of restriction fragments from polyacrylamide gels were performed by the procedures of Maniatis et al. (1982). Restriction endonucleases and other nucleic acid-modifying enzymes were used as recommended by the suppliers. Double- and single-stranded phage M13 DNA was prepared according to Messing et al. (1981). DNA fragments, contained in appropriate M13 derivatives, were sequenced by the dideoxy chain-termination method as described previously (Henrich et al. 1989).
119
Construction of phage M13mpfus and generation of deletions. A 321 bp HinfI fragment including the pepD promoter region (Fig. 2), was isolated from plasmid pJK13 and, after filling-in the ends with the Klenow fragment of D N A polymerase I, was inserted into the unique HincII site of phage M13mpl8 replicative form (RF) DNA. RF D N A of the resulting phage M13Hinf321, carrying the amino-terminus of the pepD gene in the orientation of lac transcription, was linearized with HindIII, the ends were filled-in, and a 354 bp fragment was isolated by subsequent BamHI digestion. This fragment was ligated with HincII BamHI-digested RF D N A of an M13 derivative, M13mp18d, which, due to the deletion of a 230 bp fragment from M13mp18 RF D N A by NarI EcoRI restriction, filling-in the ends and religation, lacks the lac promoter-operator region. After transfection of strain JM109 with the mixture, the recombinant phage M13mpfus was detected by its ability to form very pale blue plaques on X-gal-IPTG plates. It contains the 5' fanking region up to nucleotide - 1 5 3 and 57 aminoterminal codons of the pepD gene fused by a linker sequence of 45 nucleotides to codons 6-146 of the lacZ gene. M13mpfus RF DNA, after digestion with SaeI and BamHI, was used to generate a set of ordered deletions extending into the pepD promoter region by the exonuclease III method of Henikoff (1984). Of the deletion derivatives, 96 were further characterized by electrophoresis of EcoRI HindIII-digested RF DNA. Transfer of DNA fragments to the chromosome. EcoRIPstI fragments, 329-282 bp in length, were isolated from M13mpfus and from nine of its deletion derivatives. They retained 144-97 bp of the original pepD upstream sequence (Fig. 1) and 171 amino-terminal nucleotides of the pepD gene. In addition, a 603 bp KpnI-HaeIII fragment (fragment a in Fig. 2), a 409 bp BglII-HaeIII fragment (fragment b), a 321 bp HinfI fragment (fragment c), and an 85 bp HinfI-HincII fragment (fragment d) were individually isolated from plasmid p J K l l . After filling-in and removal of 5' and 3' protrusions, respectively, these fragments were cloned into the filled-in EcoRI site of the vector pOM41. All of them, except those containing deletions 8 and 9 (Fig. 1), appeared to contain functional promoter sites since they gave rise to tetracycline resistant (Tet r) transformants (Vidal-Ingigliardi and Raibaud 1985). Following the procedure of Raibaud et al. (1984) for fusing any DNA fragment to the malPQ genes of E. coli, we used the malA510 strain pop2239 to integrate promoter-containing fragments and the mal + strain C600 to integrate promoterfree fragments into the chromosome. Enzyme assays. Peptidase D was assayed in 0.66 ml reaction volumes by incubating 350 gl of toluenized cell suspensions at 37 ° C in the presence of 0.1 M TRIS-HC1 pH 9.0, 0.1 mM COC12,and 7.27 mg/ml fi-alanyl-L-alanine as a specific substrate (Kirsh et al. 1978). After 10, 25 and 40 min, 0.2 ml samples were removed, heated at 90°C for 5 min, and centrifuged for 15 min at 12000 x g and 4 ° C. L-alanine, the product of the reaction, was determined in 180 gl aliquots of the superna-
tants exactly as described by Williamson (1985). We defined the unit of peptidase D activity as that amount of enzyme which liberates i nmol of L-alanine per min under the conditions described. Alkaline phosphatase activities were measured according to Torriani (1960) in total reaction volumes of 0.4 ml containing 20 gl of toluenized cell suspension and p-nitrophenyl phosphate as a chromogenic substrate. The unit of alkaline phosphatase activity was defined as that amount of enzyme which liberates 1 gmol of p-nitrophenol per min (Lazdunski et al. 1975). The activity of amylomaltase contained in 50-200 ~tl samples of toluenized cell suspension, or in 125 gl of extracts obtained by sonication, was assayed in total reaction volumes of 0.25 ml in the presence of maltose as a substrate and maltoheptaose as a primer (Schwartz 1967). Aliquots (50 gl), removed after 10, 20, and 30 min, were diluted fivefold in water, heated at 95 ° C for 2 min and transferred to ice. To determine the amount of glucose liberated, the samples were combined with 0.25 ml of glucose reagent containing 0.5 mM 4amino-2, 3-dimethyl- 1-phenyl- 3-pyrazolin- 5-one, 0.6 mM 2,4-dichlorphenol, 12 units/ml glucose oxidase, and 6 units/ml peroxidase in 0.2 M TRIS, 0.2 M NaH2PO4 pH 8.0. After a 25 rain incubation at 37 ° C, the optical densities of the mixtures, read at 510 nm, were used to calculate the amounts of amylomaltase expressed as nmol of glucose liberated per min (Raibaud et al. 1985). fi-Galactosidase activities were determined as described by Miller (1972) using either M13-infected cells disrupted by CHC13/SDS treatment or toluenized cell suspensions. Cell debris was removed from the samples prior to OD measurement at 420 nm, by centrifugation for 15 min at 12000 xg.
Determination of Pi. The concentration of Pi in cultures of E. coli was measured according to the ascorbic acid method of Chen et al. (1956), using samples from which the cells had been removed by centrifugation.
Results
Generation of deletions in the pepD promoter region In order to identify the functional regions of the pepD promoter, we initially constructed an in-frame fusion between the amino-terminal parts of the genes pepD and lacZ using an M13 derivative from which the lac promoter had been eliminated. Starting at the unique BarnHI site of the final construct M13mpfus, unidirectional overlapping deletions, extending into the putative pepD promoter region, were generated using exonuclease III. The exact end points of selected deletions, sized by restriction analysis of double-stranded phage DNA, were mapped by nucleotide sequence analysis (Fig. 1). ThepepD'-lacZ' fusion in Ml3mpfus, which is subject to transcriptional control by the pepD promoter region (fragment c, Fig. 2), however, showed only 6% of the e-complementing activity measured in the presence of
120 fragment c
!
}
fragment d r
7o
I
Hinf
I
~
2/-35a
1/-35a 1/-35b
2/_10b HinclI
1/-10o 1/-1013- mRNA1
2/-103
[___.lb.
mRNA2
SD
#`~CG~GTCTTT~TA~G~ACTG~CT~Tr`~CTGAC~CG~GATAAAGTGGTATT~TCAAA~TC~A~CCT~T~TTGT~TT _GACAACAT~ ~CT GCTAACCCTGTGACCTGCAATACTGTTTTGCGGGTGATCGACAAGGAGACTTAACGTG. ..... CTTTTTACGCACTGCCTCTCCCTGA~CGGGATA.~A.,~TGGTATTCTCAAAC~T~'~TCTCGCAAGCCTGTCTTGTGTT GACAACATT ~ ~C TGCTAACCCTGTGACCTGCAATACTGTTTTGCGGGTGATCGACAAGGAGACTTAACGTGo ................ CTCTCCCTGACGCGGGATA.kAGTGGTATTCTCA.AAC~*T~TCT CGCAAGCCTGTCTTGTGTT ~CAACATTTTCT GCTA.~CCCTGTGACCTGCAATACTGTTTTGCGGGTGATCGAC.dk.AGGAGACTTAAC~T~. • • . , ............. TCTCCCTGACGCGGGATA/~GTGGTATTCTCAAAC~T,~.TCTCGCAAGCCTGTCTTGTGTT , ................. ,TCCCTGACGCGGGATAAAGTGGTATTCTCAAAC~T~CTCGCAAGCCTGTCTTGTGTT ! ....................... CGCGGGATAAAGTGGTATTCTCAAAC~TATCTCGCAAGCCTGTCTTGTGTT ........................... GGGATAAAGTGGTATTCTCAAAC~T~TCTCGCAAGCCT GTCTTGTGTT ........................... GGATAAAGTGGTATTCTCAAACAT~TCTCGCAAGCCTGTCTTGTGTT ....................................... TC~C~TATCTCGCAAGCCTGTCTTGTGTT ............................ , ........... AAACAT~L-TCT CGCAAGCCTGTCTTGTGTT
ECAACAT~TCTGCTAACCCTGTGACCTGCAATACTGTTTTGCGGGTGATCGACAAGGAGACTTAAC~TG. J.CAACAT:'~TTCTGCTAACCCTGTGACCTGCAATACTGTTTTGCGGGTGATCGACAAGGAGACTTAAC~TG ACAACATT ~ T C T GCTAACCCTGTGACCTGC.I.ATACTGTTTTGCGGGTGATCGACAAGGAGACTTAAC~T~. ACAACATT ~ T C T GCTAACCCTGTGACCTGCAA.TACTGTTTTGCGGGTGATCGACA.kGGAGACTTAACG~G. ACAACAT~TCT GCTAACCCTGTGACCTGCA.kTACTGTTTTGCGGGTGATCGACA.AGGAGACTTAACGTG. ACAACATt'~T~CTGCTAACCCTGTGACCTGCAATACTGTTTTGCGGGTGATCGACAAGGAGACTT A A C ~ T ~ . . ACAACATT~ ~CT GCTAACCCTGTGACCTGCAATACTGTTTTGCGGGTGATCGACAAGGAGACTTAAC~'z~..
Q. x3
I53 144 129 128 126 119 116 115 99 97
Fig. 1. pepD promoter fragments retained in deletion mutants of phage M13mpfus. The lengths of the authentic sequences retained upstream of the pepD start codon in the individual deletion clones are given at the right. Bases in bold with angled arrowsshow the 5' endpoints of the two species of pepD transcripts (mRNA1, mRNA2) detected by S1 mapping and primer extension (Henrich et al. 1990). The position of the HinclI site used to separate the
two putative start sites ofpepD transcription (right end of fragment d) and the left end of the 321 bp Hinfl fragment (fragment c) are also indicated. The pepD initiation codon is marked by an open arrow. Putative -35 and -10 regions are denoted 1/-35a 1/-10a and 1/-35b l/-10b for promoter site I and 2/-35a 2 / 10a and 2 / - 10b for promoter site 2. SD, potential ribosome binding sequence (Shine and Dalgarno 1974)
A
tion clones (1-9, Fig. 1), and o f individually isolated HinfI, BgIII-HaeIII and KpnI-HaeIII fragments (c, b and a, Fig. 2), containing progressively larger parts of the intergenic region between the gpt and pepD genes (Henrich et al./989). To evaluate the strength of the predicted pepD promoter sites, we measured the specific activities o f the malQ product, amylomaltase, in exponentially growing fusion clones, containing the entire pepD promoter region (fragments a, b, c, Fig. 2). The efficiency o f transcription initiation in the pepD promoter region was found to be 4-5 times lower than that of the authentic malP promoter under inducing conditions (i.e. in the presence of 0.4% maltose; Table 2). The maIP promoter in turn is almost as strong as the induced lac promoter or about 4 times weaker than the induced trp promoter (VidaMngigliardi and Raibaud 1985). This indicates that, at least under conditions of nutritional excess, the efficiency of transcription initiation in the pepD promoter region is rather low. We also fused an 85 bp HinfI-HincII fragment which contains only the m R N A start site 1 (fragment d, Fig. 1), to the chromosomal malPQ genes. The resulting clones produced similar levels of amylomaltase as the clones containing both of the predicted m R N A initiation sites (Table 2).
BglE
-z,O0
-300
Mol Gen Genet (1992) 232:117-125
© Springer-Verlag 1992
The promoter region of the Escherichia coil pepD gene: deletion analysis and control by phosphate concentration Bernhard Henrich, Heike Backes, Jiirgen R. Klein, and Roland Plapp Universit/it Kaiserslautern, Fachbereich Biologie,Abteilung Mikrobiologie,Postfach 3049, W-6750 Kaiserslautern, FRG ReceivedJune 21, 1991 / Accepted October 11, 1991 Summary. A series of deletions removing progressively larger parts of the 5' flanking region of the Escherichia coli pepD gene was constructed. After fusing the resulting promoter fragments to the chromosomal malPQ operon, their activities were determined by assaying for amylomaltase, the product of the malQ gene. Transcription from the pepD promoter region in exponentially growing cells was estimated to be about 5 times less efficient than transcription from the induced lac promoter. Approximately 115 bp preceding the translation start site of the pepD gene are important for regular promoter functioning, whereas the more distal sequences could be deleted without any significant effects. In bacterial cultures containing limiting amounts of inorganic phosphate, the rate of de novo synthesis of peptidase D, simultaneously with the derepression of alkaline phosphatase, increased about fivefold as a consequence of phosphate starvation. This regulation was shown to occur at the transcriptional level by the use of chromosomal pepD promoter-malPQ fusions. The inducibility by phosphate limitation was conserved in all of the deletion clones in which the pepD promoter region was still functional. As demonstrated by the use of phoB, R, and M mutants, the modulation ofpepD expression is independent of the genetic system controlling the pho regulon. Key words: Peptidase D - p e p D promoter Deletion analysis - Phosphate limitation - p e p D regulation
Introduction
Escherichia coli possesses a series of peptide-hydrolyzing enzymes with partly overlapping substrate specificities (Lazdunski 1989). One of them, peptidase D, is encoded by the pepD gene which we recently identified in a plasmid library by complementation analysis (Klein et al. 1986). Subcloning and sequencing of the respective Offprint requests to: B. Henrich
D N A fragment revealed an open reading flame coding for the 53 kDapepD product (Henrich et al. 1990). These sequence data were combined with the sequences of the adjacent gpt, phoE, and proBA genes to give a continuous 8.7 kb stretch of DNA sequence which was localized to the 5.7 min position on the circular E. coli map (Henrich and Plapp 1991). Using transcript mapping we identified two species of monocistronic pepD m R N A with a common 3' end and different 5' ends about 32 nucleotides apart. However, the possibility that one or both of the transcripts detected arose by cleavage of a longer m R N A species has not yet been ruled out (Henrich et al. 1990). Peptidases are not only involved in the utilization of peptide substrates supplied in the medium but also play an essential role in the breakdown of intracellular proteins, particularly under conditions of nutritional starvation (Simmonds and Fruton 1949; Yen etal. 1980). In E. coli, the metabolic imbalance caused by limitation of nutrients in the environment, is rapidly compensated for by modulating the expression of specific sets of genes which are integrated in so-called global regulatory networks (Gottesman 1984). Thus, starvation-induced degradation of cellular proteins may be due partly to elevated expression of peptidase genes. In fact, regulation by phosphate or oxygen limitation has already been demonstrated for aminopeptidase N of E. coli (Gharbi et al. 1985) and aminotripeptidase T of Salmonella typhimurium (Strauch et al. 1985). In this communication we report the location of functional elements that are indispensable for effecting pepD promoter function, and we provide evidence for a modulation ofpepD expression at the transcriptional level by the concentration of inorganic phosphate. Materials and methods
Bacterial strains, phage and plasmids. The E. coli KI2 strains used are listed in Table 1. Phage M 13mpl 8 (Norrander et al. 1983) was obtained from Pharmacia LKB,
118 Table 1. Bacterial strains
Strain
Genotype
Source or reference
JMI09
Yanisch-Perron et al. (1985)
NK5526 BW3414 BW3637 BW3627 BW3699 C600
recA1 endA1 gyrA96 thi hsdR17 supE44 relA1 2- A(lac-proAB) IF' traD36 proAB lacl°ZAM15] hisG: :TnlO IN (rrnD-rrnE)l Alac-169 Alac-169 phoB52 Alac-169 phoR68 A lac-169 phoR68 phoM451 F- thi thr leu lacY tonA supE
pop2239
C600 AmalA510
pop2239a pop2239b pop2239c pop22391 pop22392 pop22393 pop22394 pop22395 pop22396 pop22397 C6008
pop2239malPpA534: :pepDp" pop2239malPpA534 : :pcpOp b pop2239malPp A 5 34 : :pep Dp c pop2239rnalPpA534: :pepDp 1 pop2239malPpA534: :pepDp 2 pop2239malPpA534: :pepDp3 pop2239malPpA534: :pepDp4 pop2239malPpA534: :pepDp5 pop2239malPpA534: :pepDp6
C6009
pop2239a
pop2239 malPp A5 34 : :pep Dp 7 C600 malPpA534: :pepDp s C600 malPp A534 : :pepDp 9 pop2239 malPpA534: :pepDp d
N. Kleckner Wanner (1986) B. Wanner B. Wanner B. Wanner Appleyard (1954) Raibaud et al. (1984) This work This work This work This work This work This work This work This work This work This work This work This work This work
The notation malPpA534 designates the malPQ promoter, inactivated by a 120 bp deletion (Vidal-Ingigliardiand Raibaud 1985). Fragments of the pepD promoter region (pepDp) that were inserted in front of the malPQ operon (Figs. 1, 2) are denoted by superscripts. The superscript numbers refer to EcoRI-PstI fragments containing the deletions 1-9 (Fig. 1)
Freiburg. The construction of plasmids p J K l l and pJK13, containing the pepD gene, has been described previously (Klein et al. 1986). The vector pOM41, designed to integrate DNA fragments into the bacterial chromosome (Vidal-Ingigliardi and Raibaud 1985), was kindly supplied by O. Raibaud, Institut Pasteur, Paris. Media, enzymes and reagents. AP medium corresponds
to basal medium A-P as described by Torriani (1960), supplemented with thiamine (1 rag/1 final concentration) and 0.4% of either glucose or glycerol. M63BI medium was prepared as described by Miller (1972), with 1 mg of thiamine per 1. LB medium contained 10 g tryptone, 5 g yeast extract and 5 g NaC1 per 1. X-gal-IPTG plates contained LB medium, 1.5% agar, 0.04% 5-bromo-4chloro-3-indolyl /~-D-galactoside (X-gal) and 0.5mM isopropyl fl-D-thiogalactoside (IPTG). Restriction and DNA modifying enzymes were purchased from Boehringer Mannheim, Mannheim and Pharmacia LKB, Freiburg. Reagents for DNA sequence analysis were from Pharmacia LKB. Merthiolate, p-nitrophenyl phosphate and o-nitrophenyl-/%D-galactoside were obtained from Sigma, Mfinchen; 4-amino-2,3-dimethyl-l-phenyl-3-pyrazolin-5-one and 2,4-dichlorphenol were from Merck, Darmstadt. Glucose oxidase (grade II) from Aspergillus niger and peroxidase (grade II) from horse radish were
from Boehringer Mannheim, and fl-alanyl-L-alanine was purchased from Bachem, Heidelberg. Growth conditions and cell disruption. Cultures of E. coli were routinely incubated at 37°C and 230 rpm in a rotating water bath. To determine specific activities of amylomaltase, bacteria were grown in 1.5 ml of M63B1 medium supplemented with 0.4% glycerol. At a n 0 D 6 o o of about 0.5 the cells were centrifuged, washed in 0.1 M sodium phosphate buffer (pH 7.0), resuspended in 0.3 ml of the same buffer, and subsequently disrupted by ultrasonication. Debris was removed by centrifugation for 20 rain at 4°C and 12000×g, and the supernatants, after determination of their protein contents by the method of Lowry et al. (1951), were stored at - 7 0 ° C. To follow the activities of various enzymes in the presence of limiting amounts of inorganic phosphate (Pi), cells were grown overnight in AP-glucose medium (for the determination of peptidase D and alkaline phosphatase) or in AP-glycerol medium (for the determination of amylomaltase), both supplemented with 0.75 % bactopeptone. The cells were washed and subsequently subcultured in the same medium containing 0.25% bactopeptone. At different times, further enzyme synthesis was instantaneously blocked in 40 ml (peptidase D, alkaline phosphatase) or 20 ml (amylomaltase) aliquots of the cultures by the addition of merthiolate (0.1 mg/ml final concentration), and the killed cells were collected by centrifugation at 2° C, washed once with an appropriate buffer (0.1 M TRIS-HC1 pH 9.0, 0.1 mM COC12 for peptidase D and alkaline phosphatase; 0.1 M sodium phosphate buffer pH 7.0 for amylomaltase), and stored at - 7 0 ° C. To disrupt the bacteria, the cells were resuspended in 0.8 ml (peptidase D and alkaline phosphatase) or 0.5 ml (amylomaltase) of the respective buffer and shaken with 1:100 volume of toluene at 37°C for 30rain. Toluenized cell suspensions were stored at - 70° C. To estimate the efficiency of/~-galactosidase ~-complementation in cells infected with various derivatives of phage M13mpl 8, overnight cultures of strain JM109 were diluted 50-fold in 30 ml of LB medium containing 1 mM IPTG. After infection with about 10 l° phages, the bacteria were vigorously agitated at 37° C for 3 h, harvested by centrifugation, and resuspended in 1.5 ml of Z buffer (Miller 1972). Cells were disrupted by the addition of 60 ~tl CHCls and 30 gl 0.1% sodium dodecylsulfate to these suspensions. Recombinant D N A and sequencing techniques. Preparation of plasmid DNA and isolation of restriction fragments from polyacrylamide gels were performed by the procedures of Maniatis et al. (1982). Restriction endonucleases and other nucleic acid-modifying enzymes were used as recommended by the suppliers. Double- and single-stranded phage M13 DNA was prepared according to Messing et al. (1981). DNA fragments, contained in appropriate M13 derivatives, were sequenced by the dideoxy chain-termination method as described previously (Henrich et al. 1989).
119
Construction of phage M13mpfus and generation of deletions. A 321 bp HinfI fragment including the pepD promoter region (Fig. 2), was isolated from plasmid pJK13 and, after filling-in the ends with the Klenow fragment of D N A polymerase I, was inserted into the unique HincII site of phage M13mpl8 replicative form (RF) DNA. RF D N A of the resulting phage M13Hinf321, carrying the amino-terminus of the pepD gene in the orientation of lac transcription, was linearized with HindIII, the ends were filled-in, and a 354 bp fragment was isolated by subsequent BamHI digestion. This fragment was ligated with HincII BamHI-digested RF D N A of an M13 derivative, M13mp18d, which, due to the deletion of a 230 bp fragment from M13mp18 RF D N A by NarI EcoRI restriction, filling-in the ends and religation, lacks the lac promoter-operator region. After transfection of strain JM109 with the mixture, the recombinant phage M13mpfus was detected by its ability to form very pale blue plaques on X-gal-IPTG plates. It contains the 5' fanking region up to nucleotide - 1 5 3 and 57 aminoterminal codons of the pepD gene fused by a linker sequence of 45 nucleotides to codons 6-146 of the lacZ gene. M13mpfus RF DNA, after digestion with SaeI and BamHI, was used to generate a set of ordered deletions extending into the pepD promoter region by the exonuclease III method of Henikoff (1984). Of the deletion derivatives, 96 were further characterized by electrophoresis of EcoRI HindIII-digested RF DNA. Transfer of DNA fragments to the chromosome. EcoRIPstI fragments, 329-282 bp in length, were isolated from M13mpfus and from nine of its deletion derivatives. They retained 144-97 bp of the original pepD upstream sequence (Fig. 1) and 171 amino-terminal nucleotides of the pepD gene. In addition, a 603 bp KpnI-HaeIII fragment (fragment a in Fig. 2), a 409 bp BglII-HaeIII fragment (fragment b), a 321 bp HinfI fragment (fragment c), and an 85 bp HinfI-HincII fragment (fragment d) were individually isolated from plasmid p J K l l . After filling-in and removal of 5' and 3' protrusions, respectively, these fragments were cloned into the filled-in EcoRI site of the vector pOM41. All of them, except those containing deletions 8 and 9 (Fig. 1), appeared to contain functional promoter sites since they gave rise to tetracycline resistant (Tet r) transformants (Vidal-Ingigliardi and Raibaud 1985). Following the procedure of Raibaud et al. (1984) for fusing any DNA fragment to the malPQ genes of E. coli, we used the malA510 strain pop2239 to integrate promoter-containing fragments and the mal + strain C600 to integrate promoterfree fragments into the chromosome. Enzyme assays. Peptidase D was assayed in 0.66 ml reaction volumes by incubating 350 gl of toluenized cell suspensions at 37 ° C in the presence of 0.1 M TRIS-HC1 pH 9.0, 0.1 mM COC12,and 7.27 mg/ml fi-alanyl-L-alanine as a specific substrate (Kirsh et al. 1978). After 10, 25 and 40 min, 0.2 ml samples were removed, heated at 90°C for 5 min, and centrifuged for 15 min at 12000 x g and 4 ° C. L-alanine, the product of the reaction, was determined in 180 gl aliquots of the superna-
tants exactly as described by Williamson (1985). We defined the unit of peptidase D activity as that amount of enzyme which liberates i nmol of L-alanine per min under the conditions described. Alkaline phosphatase activities were measured according to Torriani (1960) in total reaction volumes of 0.4 ml containing 20 gl of toluenized cell suspension and p-nitrophenyl phosphate as a chromogenic substrate. The unit of alkaline phosphatase activity was defined as that amount of enzyme which liberates 1 gmol of p-nitrophenol per min (Lazdunski et al. 1975). The activity of amylomaltase contained in 50-200 ~tl samples of toluenized cell suspension, or in 125 gl of extracts obtained by sonication, was assayed in total reaction volumes of 0.25 ml in the presence of maltose as a substrate and maltoheptaose as a primer (Schwartz 1967). Aliquots (50 gl), removed after 10, 20, and 30 min, were diluted fivefold in water, heated at 95 ° C for 2 min and transferred to ice. To determine the amount of glucose liberated, the samples were combined with 0.25 ml of glucose reagent containing 0.5 mM 4amino-2, 3-dimethyl- 1-phenyl- 3-pyrazolin- 5-one, 0.6 mM 2,4-dichlorphenol, 12 units/ml glucose oxidase, and 6 units/ml peroxidase in 0.2 M TRIS, 0.2 M NaH2PO4 pH 8.0. After a 25 rain incubation at 37 ° C, the optical densities of the mixtures, read at 510 nm, were used to calculate the amounts of amylomaltase expressed as nmol of glucose liberated per min (Raibaud et al. 1985). fi-Galactosidase activities were determined as described by Miller (1972) using either M13-infected cells disrupted by CHC13/SDS treatment or toluenized cell suspensions. Cell debris was removed from the samples prior to OD measurement at 420 nm, by centrifugation for 15 min at 12000 xg.
Determination of Pi. The concentration of Pi in cultures of E. coli was measured according to the ascorbic acid method of Chen et al. (1956), using samples from which the cells had been removed by centrifugation.
Results
Generation of deletions in the pepD promoter region In order to identify the functional regions of the pepD promoter, we initially constructed an in-frame fusion between the amino-terminal parts of the genes pepD and lacZ using an M13 derivative from which the lac promoter had been eliminated. Starting at the unique BarnHI site of the final construct M13mpfus, unidirectional overlapping deletions, extending into the putative pepD promoter region, were generated using exonuclease III. The exact end points of selected deletions, sized by restriction analysis of double-stranded phage DNA, were mapped by nucleotide sequence analysis (Fig. 1). ThepepD'-lacZ' fusion in Ml3mpfus, which is subject to transcriptional control by the pepD promoter region (fragment c, Fig. 2), however, showed only 6% of the e-complementing activity measured in the presence of
120 fragment c
!
}
fragment d r
7o
I
Hinf
I
~
2/-35a
1/-35a 1/-35b
2/_10b HinclI
1/-10o 1/-1013- mRNA1
2/-103
[___.lb.
mRNA2
SD
#`~CG~GTCTTT~TA~G~ACTG~CT~Tr`~CTGAC~CG~GATAAAGTGGTATT~TCAAA~TC~A~CCT~T~TTGT~TT _GACAACAT~ ~CT GCTAACCCTGTGACCTGCAATACTGTTTTGCGGGTGATCGACAAGGAGACTTAACGTG. ..... CTTTTTACGCACTGCCTCTCCCTGA~CGGGATA.~A.,~TGGTATTCTCAAAC~T~'~TCTCGCAAGCCTGTCTTGTGTT GACAACATT ~ ~C TGCTAACCCTGTGACCTGCAATACTGTTTTGCGGGTGATCGACAAGGAGACTTAACGTGo ................ CTCTCCCTGACGCGGGATA.kAGTGGTATTCTCA.AAC~*T~TCT CGCAAGCCTGTCTTGTGTT ~CAACATTTTCT GCTA.~CCCTGTGACCTGCAATACTGTTTTGCGGGTGATCGAC.dk.AGGAGACTTAAC~T~. • • . , ............. TCTCCCTGACGCGGGATA/~GTGGTATTCTCAAAC~T,~.TCTCGCAAGCCTGTCTTGTGTT , ................. ,TCCCTGACGCGGGATAAAGTGGTATTCTCAAAC~T~CTCGCAAGCCTGTCTTGTGTT ! ....................... CGCGGGATAAAGTGGTATTCTCAAAC~TATCTCGCAAGCCTGTCTTGTGTT ........................... GGGATAAAGTGGTATTCTCAAAC~T~TCTCGCAAGCCT GTCTTGTGTT ........................... GGATAAAGTGGTATTCTCAAACAT~TCTCGCAAGCCTGTCTTGTGTT ....................................... TC~C~TATCTCGCAAGCCTGTCTTGTGTT ............................ , ........... AAACAT~L-TCT CGCAAGCCTGTCTTGTGTT
ECAACAT~TCTGCTAACCCTGTGACCTGCAATACTGTTTTGCGGGTGATCGACAAGGAGACTTAAC~TG. J.CAACAT:'~TTCTGCTAACCCTGTGACCTGCAATACTGTTTTGCGGGTGATCGACAAGGAGACTTAAC~TG ACAACATT ~ T C T GCTAACCCTGTGACCTGC.I.ATACTGTTTTGCGGGTGATCGACAAGGAGACTTAAC~T~. ACAACATT ~ T C T GCTAACCCTGTGACCTGCAA.TACTGTTTTGCGGGTGATCGACA.kGGAGACTTAACG~G. ACAACAT~TCT GCTAACCCTGTGACCTGCA.kTACTGTTTTGCGGGTGATCGACA.AGGAGACTTAACGTG. ACAACATt'~T~CTGCTAACCCTGTGACCTGCAATACTGTTTTGCGGGTGATCGACAAGGAGACTT A A C ~ T ~ . . ACAACATT~ ~CT GCTAACCCTGTGACCTGCAATACTGTTTTGCGGGTGATCGACAAGGAGACTTAAC~'z~..
Q. x3
I53 144 129 128 126 119 116 115 99 97
Fig. 1. pepD promoter fragments retained in deletion mutants of phage M13mpfus. The lengths of the authentic sequences retained upstream of the pepD start codon in the individual deletion clones are given at the right. Bases in bold with angled arrowsshow the 5' endpoints of the two species of pepD transcripts (mRNA1, mRNA2) detected by S1 mapping and primer extension (Henrich et al. 1990). The position of the HinclI site used to separate the
two putative start sites ofpepD transcription (right end of fragment d) and the left end of the 321 bp Hinfl fragment (fragment c) are also indicated. The pepD initiation codon is marked by an open arrow. Putative -35 and -10 regions are denoted 1/-35a 1/-10a and 1/-35b l/-10b for promoter site I and 2/-35a 2 / 10a and 2 / - 10b for promoter site 2. SD, potential ribosome binding sequence (Shine and Dalgarno 1974)
A
tion clones (1-9, Fig. 1), and o f individually isolated HinfI, BgIII-HaeIII and KpnI-HaeIII fragments (c, b and a, Fig. 2), containing progressively larger parts of the intergenic region between the gpt and pepD genes (Henrich et al./989). To evaluate the strength of the predicted pepD promoter sites, we measured the specific activities o f the malQ product, amylomaltase, in exponentially growing fusion clones, containing the entire pepD promoter region (fragments a, b, c, Fig. 2). The efficiency o f transcription initiation in the pepD promoter region was found to be 4-5 times lower than that of the authentic malP promoter under inducing conditions (i.e. in the presence of 0.4% maltose; Table 2). The maIP promoter in turn is almost as strong as the induced lac promoter or about 4 times weaker than the induced trp promoter (VidaMngigliardi and Raibaud 1985). This indicates that, at least under conditions of nutritional excess, the efficiency of transcription initiation in the pepD promoter region is rather low. We also fused an 85 bp HinfI-HincII fragment which contains only the m R N A start site 1 (fragment d, Fig. 1), to the chromosomal malPQ genes. The resulting clones produced similar levels of amylomaltase as the clones containing both of the predicted m R N A initiation sites (Table 2).
BglE
-z,O0
-300
