Cytokine 71 (2015) 278–282

Contents lists available at ScienceDirect

Cytokine journal homepage: www.journals.elsevier.com/cytokine

Evaluation of IFN-c polymorphism +874 T/A in patients with recurrent tonsillitis by PCR Real Time Mismatch Amplification Mutation Assay (MAMA Real Time PCR) Massimiliano Bergallo a,⇑,1, Stefano Gambarino b,1, Elisa Loiacono a, Luca Vergano a, Ilaria Galliano a, Paola Montanari a, Sara Astegiano c, Paolo Tavormina d, Pier-Angelo Tovo a a

Department of Public Health and Pediatrics, University of Turin, Italy Serology Unit OIRM S. Anna Hospital of Turin, Turin, Italy c Istituto Zooprofilattico Sperimentale del Piemonte, Liguria e Valle D’Aosta, Turin, Italy d Unit of Otorhinolaryngology, Pediatric Hospital ‘‘Regina Margherita S. Anna’’, Torino, Italy b

a r t i c l e

i n f o

Article history: Received 18 August 2014 Received in revised form 27 October 2014 Accepted 10 November 2014

Keywords: IFN-c polymorphisms ARMS-PCR MAMA-PCR Tonsillectomy Gene expression

a b s t r a c t Interferon gamma (IFN-c) is an important cytokine that plays a crucial role in the balance between normal and pathological immune response. Defect of IFN-c can give a predisposition to infectious disease, autoimmune pathologies and tumours. Different polymorphisms in this gene have been described, in particular the single nucleotide polymorphism (SNP) + 874 ⁄ T/A that may affect IFN-c gene expression. Several techniques can be used for the detection of SNPs. In this work two PCR Real Time assays were developed, an Amplification Refractory Mutation System (ARMS) and a Mismatch Amplification Mutation Assay (MAMA). Twenty-seven samples from patients (tonsillectomy) and 85 from donor’s blood bank were considered. As a result, 78/85 controls (91.7%) and 25/27 patients (92.6%) were heterozygosis, considering the ARMS-PCR; 55/85 (64.7%) and 14/27 (51.9%) were heterozygosis using MAMA-PCR assay. Fourteen of 85 (16.5%) and 8/27 (29.6%) were homozygosis A, 16/85 (18.8%) and 5/27 (18.5%) presented homozygosis T, taking into account the MAMA-PCR. There are statistically difference between the two assay with p < 0.0001 at Chi-square test. Our preliminary data suggest that tonsillectomy patients had a statistical trend to possess the low IFN-c polymorphism when compared with control subject (p = 0.3) but is not statistically significant. In conclusion the Real time MAMA-PCR assay has several advantages over other SNP identification techniques such as rapidity, reliability, easily to perform in one working day and applicable in clinical molecular diagnostic laboratories, although sequencing remains the gold standard. Ó 2014 Elsevier Ltd. All rights reserved.

1. Introduction Interferon gamma (IFN-c) is a key T helper (type-1) cytokine produced by natural killer cells and T cells and plays a crucial role in the balance between normal and pathological immune response [1]. Individuals defective in the genes for IFN-c or IFN-c receptor have been shown to be predisposed to bacterial and viral ⇑ Corresponding author at: Department of Public Health and Pediatrics, Piazza Polonia 94, 10136 Turin, Italy. E-mail addresses: [email protected] (M. Bergallo), stefano. [email protected] (S. Gambarino), [email protected] (E. Loiacono), [email protected] (L. Vergano), [email protected] (I. Galliano), [email protected] (P. Montanari), [email protected] (S. Astegiano), [email protected] (P. Tavormina), [email protected] (P.-A. Tovo). 1 MB and SG equally contributed to this paper. http://dx.doi.org/10.1016/j.cyto.2014.11.012 1043-4666/Ó 2014 Elsevier Ltd. All rights reserved.

infections, such as Mycobacterium tuberculosis [1,2], hepatitis B and C virus [3], Parvovirus B19 [4], BK virus [5], Cytomegalovirus [6]; to asthma [7] and severe respiratory syncytial virus infections [8]; to autoimmune disease, including Hashimoto’s Thyroiditis and Graves’ Disease [9], rheumatoid arthritis [10], systemic lupus erythematosus [11]; to neoplasia such as breast cancer [12]. Different polymorphisms in the gene of IFN-c have been described in literature; among these, however, the most important is the single nucleotide polymorphism (SNP) T to A, at the 50 end of the CA repeated region in the first intron (+T874A), that may affect IFN-c gene expression as it coincides with a putative NF-kB binding site [13]. Different techniques can be used to detect this SNP, such as Restriction Fragment Length Polymorphism (RFLP), Cleavase Fragment Length Polymorphism (CFLP), Single-Strand Conformational Polymorphism (SSCP) analysis, and sequencing [14]; however,

M. Bergallo et al. / Cytokine 71 (2015) 278–282

these procedures are labour intensive and time consuming; finally other techniques include allele-specific probes (Allele Specific Oligonucleotide (ASO) probe) [15] and allele-specific forward primers (Amplification Refractory Mutation Systems (ARMS)) [16]. Allelespecific forward primers are preferred when fine quantifications are required, as their specificity can be directly regulated by the annealing temperature of the reaction [17]. In the ARMS-PCR assay, the specificity of forward primers is given by the terminal 30 nucleotide; discrimination power can be improved using allele-specific forward primers with an added mismatched nucleotide located near the 30 terminal region (Mismatch Amplification Mutation Assay (MAMA)) called also taqMAMA PCR [17]. Recurrent tonsillitis is one of the most common otorhinolaryngologic disorders seen in paediatric age group. Treatment of recurrent tonsillitis is mainly based on administration of antibiotics or tonsillectomy [18]. The recurrent tonsillitis illness is orchestrated by the sequential elaboration of proinflammatory cytokines, including tumour necrosis factor a (TNFa), and interferon c (IFNc), and it is probable that the severity of illness is related to the overproduction of those cytokines or, conversely, the underproduction of anti-inflammatory cytokines such as transforming growth factor (TGF)-b and IL-10 [19]. In that regard, polymorphisms in the regulator regions of genes for cytokine production have been described and can influence the protein production. The present study was designed to determine if there are similar associations between polymorphism +T874A IFN-c gene and frequency of tonsillitis with tonsillectomy in infants. For this reason we developed a MAMA Real Time PCR assay, in order to identify homozygosis or heterozygosis for the SNP +T874A of the IFN-c gene. 2. Material and methods 2.1. Specimens and DNA extraction Tonsil specimens from 27 patients, who underwent tonsillectomy at the University-Hospital OIRM-S. Anna of Turin, and 85 whole blood controls from donor’s blood bank of the same University-Hospital, were considered for the development of the two ARMS Real Time PCR assay. Specimens were processed for nucleic acid extraction using the automated NucliSens easyMAG platform (Biomerieux, Marcy l’Etoile, France), according to the manufacturer’s instructions.

279

the template, the frequency of extension is very low and the effective number of sequence copies available for amplification is greatly reduced. In the case of the MAMA assay, the presence of an additional mismatch at the 30 end makes the Taq polymerase unable to extend the primer; therefore, the absence of the specific PCR product reveals a deviation from the wild-type DNA sequence. 2.3. Optimization of ARMS and MAMA Real Time PCR assay For the optimization of the two Real time TaqMan PCR protocols, different concentrations of primers and probe were tested: 900 nM, 500 nM, 200 nM for primers and 250 nM, 150 nM and 100 nM for the probe. The assays were performed with the 7500 Real Time PCR System (Applied Biosystems). Specimens were subjected to a duplex TaqMan PCR for the detection of the housekeeping gene human beta-actin, as internal control. To confirm the results obtained with the Real Time PCR, sequencing procedure was performed. The specimens were amplified with primers IFNc 1 (TTGGGTTCTCTTGGCTGTTA) and IFN-c 2 (CCCCCAATGGTACAGGTTTC), obtaining an amplicon of 947 bp within the IFN-c gene. The amplification mix contained 6 ll of GoTaqÒ HotStart Polymerase buffer 5 (Promega), 200 lM of each dNTP, 6 mM of MgCl2, 1 unit of GoTaqÒ HotStart Polymerase (Promega), 20 pmol of primers. The resulting amplicons were run on agarose gel (2% w/v) by electrophoresis, the gel was observed using the Gel Doc™ (Bio-Rad Laboratories S.r.l., Milan, Italy) and the bands were purified using the NucleospinÒ Extract II (Macherey–Nagel, Düren, Germany). The purified PCR products were sequenced using the BigDyeÒ Terminator v1.1 Cycle Sequencing Kit (Applied Biosystem). Briefly, a mix containing 8 ll of Terminator Ready reaction mix, 20 ng of PCR product, 3.2 pmol of primers and deionized water just enough to have a final volume of 20 ll, was made. Then, the Cycle sequencing was carried out on 9700 Thermal Cycler (Applied Biosystem) with an initial denaturation step at 96 °C for 1 min, followed by 25 cycles of 96 °C for 10 s, 50 °C for 5 s and 60 °C for 4 min. Subsequently, the Cycle Sequencing product was purified by Ethanol/EDTA/Sodium Acetate precipitation and loaded onto the ABI PRISM 31 Genetic Analyzer (Applied Biosystem). Forward and reverse sequences were aligned with the ClustalX software and then compared to IFN-c wilde type sequences. 2.4. Statistical analysis

2.2. Design of ARMS and MAMA Real Time PCR assay For the development of the ARMS Real Time PCR assay, the conserved reverse primer and two allele-specific polymorphism detection primers were modified from Gao et al. [3] and adapted for a Real Time PCR designing a probe with the commercial software Primer Express 3.0 (Applied Biosystems, Monza, Italy). Each allele-specific primer carries a specific nucleotide, T or A, for the SNP and for classical genotypes, respectively, at the 30 end (ARMS primer F-T:TT ATTCTTACAACACAAAATCAAATCT; ARMS primer F-A: T TATTCTTACAACACAAAATCAAATCA; common primer R: CCCCCAATGGTACA GGTTTC; common probe: FAM-CATCTACTGTG CCTTCCTGTAG GGT-TAMRA). For the development of the MAMA Real Time PCR assay, the same reverse primer and probe of the ARMS PCR were used; the allele-specific forward primers were different for the addition of a nucleotide alteration C at the third nucleotide from the 30 end of both (MAMA primer F-T: TTATTCTTACAACACAAAATCAAACCT; MAMA primer F-A: TTATTCTTACAACACAAAATCAAACCA; common primer R and common probe above mentioned). In the ARMS PCR assay, the primer pair is designed so that one of the 30 ends coincides with a SNP; when the primer mismatches

For statistical analysis, the Chi square test and Mann–Whitney test were performed using a commercial software (GraphPad Prism 5 San Diego, California, USA); a p-value