Journal of Virological Methods 202 (2014) 106–111
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Short communication
A new nanoPCR molecular assay for detection of porcine bocavirus Xiaoling Wang a , Aiquan Bai b,∗∗ , Jing Zhang a , Miaomiao Kong a , Yuchao Cui a , Xingjie Ma a , Xia Ai c , Qinghai Tang d,∗ ∗ ∗ , Shangjin Cui a,∗ a Division of Swine Infectious Diseases, State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute of Chinese Academy of Agricultural Sciences, China b Foshan University, Foshan, Guandong, China c College of Animal Science and Veterinary Medicine, Tianjin Agricultural University, Tianjin, China d Nanyang Normal University, 1638 Wolong Road, Nanyang 473061, China
a b s t r a c t Article history: Received 3 October 2013 Received in revised form 24 February 2014 Accepted 27 February 2014 Available online 15 March 2014 Keywords: Detection Epidemic characterization NanoPCR NS1 gene PBoV
Nanoparticle-assisted polymerase chain reaction (nanoPCR) is a novel method for the rapid amplification of DNA and has been used for the detection of virus. For detection of porcine bocavirus (PBoV), a sensitive and specific nanoPCR assay was developed with a pair of primers that were designed based on NS1 gene sequences available in GenBank. Under the optimized conditions of the PBoV nanoPCR assay, the nanoPCR assay was 100-fold more sensitive than a conventional PCR assay. The lower detection limit of the nanoPCR assay was about 6.70 × 101 copies. The nanoPCR assay amplified the specific 482-bp fragment of the PBoV NS1 recombinant plasmid but did not produce any product with genomic DNA or cDNA of porcine parvovirus, porcine circovirus type II, porcine reproductive and respiratory syndrome virus, pseudorabies virus, classic swine fever virus, Encephalomyocarditis virus, Porcine Teschovirus or African swine fever virus plasmid. Of 65 clinical samples collected from diseased pigs, 73.8% and 86.2% were determined to be PBoV positive by PBoV conventional PCR and PBoV nanoPCR assay, respectively. Of 36 clinical samples from healthy pigs, 27.8% and 44.4% were PBoV positive by PBoV conventional PCR and PBoV nanoPCR assay, respectively. The nanoPCR assay will be useful for diagnosing PBoV and for studying its epidemiology and pathology. © 2014 Elsevier B.V. All rights reserved.
1. Introduction The Bocavirus genome is not segmented and contains a positiveor negative-sense, single-stranded DNA of 4000–6000 nucleotides (Allander et al., 2005). Like other members of the Parvoviridae family, bocaviruses contain NS1 and NP1 non-structural (NS) proteins and VP1/VP2 structural proteins. Known bocaviruses include bovine parvovirus (BPV), minute virus of canine (MVC), porcine bocavirus (PBoV), gorilla bocavirus (GBoV), and human bocaviruses 1–4 (Anderson, 2007; Claude et al., 2004 and Kapoor et al., 2009). In 2005, Allander et al. reported the detection of a new human parvovirus in children with acute respiratory tract infections. The new virus, which showed 42–43% amino acid identity to the
∗ Corresponding author at: 427 Maduan Street, Nangang District, Harbin 150001, Heilongjiang, China. Tel.: +86 18946066093; fax: +86 451 51997166. ∗∗ Corresponding author at: Institute of Science and Technology, Foshan, Guandong, China. ∗ ∗ ∗Co-corresponding author. E-mail addresses: [email protected] (A. Bai), [email protected] (Q. Tang), [email protected], [email protected] (S. Cui). http://dx.doi.org/10.1016/j.jviromet.2014.02.029 0166-0934/© 2014 Elsevier B.V. All rights reserved.
nearest neighbors (MVC and BPV) in both major ORFs that encode the NS1 and VP1 proteins, was assigned to the genus Bocavirus and was provisionally named human Bocavirus (HBoV) (Allander et al., 2005). Recently, HBoV2, HBoV3, and HBoV4 have been discovered and all have been assigned to the genus Bocavirus (Kapoor et al., 2009 and Arthur et al., 2009). These human bocaviruses have been associated with respiratory and enteric infections in humans, but their causal relationship with these infections has not been proven by experiments with animals (Allander et al., 2005; Cheng et al., 2008; Arthur et al., 2009; Kapoor et al., 2009; Tozer et al., 2009; Karalar et al., 2010). With the recent development of random amplification methods and high-throughput sequencing, an increasing number of new viral pathogens have been identified in samples originating from humans and animals (Allander et al., 2001 Finkbeiner et al., 2009; Li et al., 2009), and one of these new pathogens is porcine bocavirus. Porcine bocavirus was first described in 2009; it was isolated from feces of swine with postweaning multisystemic wasting syndrome (PMWS) in Sweden and was designated as porcine boca-like virus (PBo-likeV) (Blomstrom et al., 2009). PBo-likeV has also been identified in China and was named porcine bocavirus (PBoV) (Zhai
X. Wang et al. / Journal of Virological Methods 202 (2014) 106–111
et al., 2010 and Zeng et al., 2011) or porcine bocavirus 1 (Shan et al., 2011a, Zhang et al., 2011). A tentative classification of the newly discovered porcine bocaviruses was proposed by Zhang et al. (2011) grouping the six reported porcine bocaviruses into four species: PoBoV1 (porcine boca-like virus or PBoLV), PoBoV2 (porcine parvovirus 4 or PPV4), PoBoV3 (PBoV1/PBoV2), and PoBoV4 (6V/7V). A study using sequence-independent single primer amplification discovered a new group of further porcine bocaviruses designated PBoV1, PBoV2, 6V, and 7V that formed phylogenetically separate clusters (Cheng et al., 2010). Subsequent studies indicated a high prevalence of this novel PBoV in weaning piglets with respiratory tract symptoms (Blomstrom et al., 2009). PBoV has also been detected in healthy pigs in China (Zhang et al., 2011). PBoV has been successfully isolated (McKillen et al., 2011), and conventional PCR, real-time PCR, and LAMP assays have been developed to detect PBoV (Bin Li et al., 2011 and Bin Li et al., 2012). A nanoPCR assay, however, has not been developed for PBoV. Relative to conventional PCR assay, nanoPCR assay has the potential for increased sensitivity and specificity. In addition, real-time PCR assays require expensive instruments, and LAMP assays are easily contaminated. NanoPCR is an advanced form of PCR in which solid gold nanometal particles (1–100 nm) form colloidal nanofluids, which increase thermal conductivity. Therefore, PCR assays with nanofluids attain the target temperature more quickly than PCR assays with original liquids, and this reduces the time at non-target temperatures and thereby reduces non-specific amplification and increases specific amplification (Li and Rothberg, 2004; Ma et al., 2013). NanoPCR is also less prone than LAMP to false positive results from amplicon contamination. In addition, the nanoPCR assay does not require specialized instruments beyond standard PCR equipment, i.e., it can be conducted in standard molecular biology laboratories (Ma et al., 2013). The NS1 protein of PBoV is encoded by the NS1 gene and is produced in the early phase of PBoV replication, before structural protein synthesis. NS1 is a major NS protein and it is of great importance for porcine bocavirus. As expected, the functions of NS1 proteins are similar among different viruses. In addition, the NS1 gene was used for the development of conventional PCR for detection of PBoV. Consequently, NS1 was chosen as a specific gene to distinguish PBoV from other viruses. In this study, a highly sensitive and specific nanoPCR assay targeting the NS1 gene was established for the rapid detection of PBoV in clinical samples.
107
sera, spleen, liver, brain, heart, kidney, lungs, lymph nodes, and tonsils from healthy pigs (36 samples) and from diseased pigs (65 samples). Samples from diseased pigs were mostly collected from piglets that experienced diarrhea and death. 2.2. Preparation of template DNA and RNA were extracted from the above reference viruses and tissue homogenates (spleen, liver, brain, heart, kidney, lungs, lymph nodes, and tonsils) or sera of clinical samples using the TIANamp Virus genomic DNA/RNA kit (Beijing Tiangen Biotech Company, Beijing, China), according to the manufacturer’s instructions. The extracted DNA was eluted in a total volume of 50 L of RNase-free ddH2 O and stored at −20 ◦ C until used. cDNA synthesis reaction was performed with the TranScript First strand cDNA Synthesis SuperMix (Beijing TransGen Biotech Company) in accordance with the manufacturer’s instructions. 2.3. Establishment of the PBoV conventional PCR assay 2.3.1. Design of primers and construction of recombinant plasmid DNA The full sequence of PBoV was retrieved from the Porcine bocavirus pig/ZJD/China/2006 (GenBank accession numbers: HM053693 and HM053694). Primer premier 5 software was used to design primers that would amplify the NS1 gene, with a fragment length of 482 bp (Table 1). The complete coding sequences of the NS1 gene was cloned into the plasmid vector pUC57 as the standard plasmid. The resulting pUC57-PBoV-NS1 construction was amplified in Escherichia coli DH5␣, and the recombinant plasmid pUC57-PBoV-NS1 was purified with the AxyPrepTM Plasmid Miniprep Kit (AXYGEN Biotechnology Company, Hangzhou, China) and quantified using UV spectroscopy (6.70 × 1010 DNA copies/L). The plasmids were kept at −20 ◦ C until used. 2.3.2. Establishment of the PBoV conventional PCR assay The PBoV conventional PCR assay was performed in a 12-L reaction mixture containing 1 L of extracted DNA or standard plasmid, 11 L of conventional PCR Master Mix containing 6 L of 2× GC buffer, 1.0 L of each of forward and reverse primer (10 M), 0.2 L of Ex Taq DNA polymerase (5 U/L), 1.0 L of dNTP, and ddH2 O up to 12 L. The PCR was conducted as follows: 5 min at 94 ◦ C; followed by 30 cycles of 94 ◦ C for 30 s, 58 ◦ C for 30 s, and 72 ◦ C for 40 s; and a final elongation for 7 min at 72 ◦ C.
2. Materials and methods
2.4. Establishment of the PBoV nanoPCR assay
2.1. Viruses and sample preparation
2.4.1. Design of primers and construction of recombinant plasmid DNA Primers were designed and the recombinant plasmid DNA was constructed as described in Section 2.3.1.
The plasmid vector pUC57 was purchased from TaKaRa Biotechnology Company, Dalian, China, and the following viruses were obtained from the Harbin Veterinary Research Institute of Chinese Academy of Agricultural Sciences: porcine parvovirus (PPV, strain BQ-C), porcine circovirus type II (PCV2, strain SH), porcine reproductive and respiratory syndrome virus (PRRSV, strain HB), pseudorabies virus (PRV, strains SC), classic swine fever virus (CSFV), Encephalomyocarditis virus (EMCV), porcine Teschovirus (PTV), and African swine fever virus (ASFV). The Nano PCR Kit (NPK02) was purchased from GREDBIO (Weihai, China). Animal experiments were approved by the Harbin Veterinary Research Institute of the Chinese Academy of Agricultural Sciences, and animal experiments were performed in accordance with animal ethics guidelines and approved protocols. The Animal Ethics Committee approval number was Heilongjiang-SQ 2013-2046. A total of 101 clinical samples were collected from pig farms in China located in Hebei, Heilongjiang, etc. The samples mainly included
2.4.2. Optimization of the PBoV nanoPCR assay Experiments were performed to optimize the annealing temperature, primer volume, and plasmid DNA volume for the PBoV nanoPCR assay. The annealing temperatures in the PCR thermocycler (Eppendorf, Mastercycler-Gradient, Germany) ranged from 53 ◦ C to 62◦ C, the primer volume ranged from 0.4 L to 1.4 L, and the plasmid DNA volume ranged from 0.2 L to 1.4 L in increments of 0.2 L. The products were visualized on 2% agarose gels. 2.4.3. Sensitivity of PBoV nanoPCR To compare the sensitivity of nanoPCR and conventional PCR, 10-fold serial dilutions of the recombinant plasmid pUC57-PBoVNS1 (ranging from 6.70 × 1010 to 6.70 × 100 copies/L) were used as template. In another comparison, field samples of DNA from nine
108
X. Wang et al. / Journal of Virological Methods 202 (2014) 106–111
Table 1 Sequences of primers designed to detect the NS1 gene of PBoV by nanoPCR. Gene
Primer sequence (5 –3 )
Tm (◦ C)
Product (bp)
Enzyme site
NS1
F: GCCGAATTCATGAAGTGCTACGCTCTGG R: GCCGTCGACGCTAGACGCTCGCTTCGTC F: AGTCCTACGCCATCAGCAGCATC R: TCCCGCCTGCCAGGGATTGT
64.0 69.9 61.3 61.6
2112
EcoRI SalI
NS1
482
Underline: enzyme sites; F: forward primer; R: reverse primer.
pigs whose PBoV volume were different were also used as template. Each dilution and DNA sample was tested by nanoPCR and conventional PCR, and ddH2 O was used as the negative control. PCR products were subjected to electrophoresis on a 2% agarose gel.
2.4.4. Specificity of PBoV nanoPCR To assess the specificity of nanoPCR, the DNA or cDNA of PPV, PCV2, PRRSV, PRV, CSFV, EMCV, PTV and ASFV were subjected separately to the PBoV nanoPCR assay. The recombinant plasmid pUC57-PBoV-NS1 was used as a positive control, and DNA extracted from SPF swine tissues was used as a negative control. PCR products were subjected to electrophoresis on a 2% agarose gel.
2.6. DNA sequencing and the characterization of PBoV epidemics in China Several positive PBoV nanoPCR products generated from the clinical samples collected from Hebei (named PBoV-HB) were purified using the AxyPrepTM DNA Gel Extraction Kit (AXYGEN Biotechnology Company, Hangzhou, China) and sent to TaKaRa Company for sequencing. The aim was to determine the specificity of PBoV nanoPCR and the prevalence of PBoV in China. DNA Star software and BLAST searching of GenBank were used to determine the sequence consistency with the accessed PBoV-NS1 gene sequences in GenBank. MEGA5.1 software was used for alignment and construction of the phylogenetic tree. 3. Results
2.5. Detection of PBoV in clinical samples
3.1. Optimization of the PBoV nanoPCR assay
The viral DNA from the 101 samples was subjected to the PBoV nanoPCR assay and to the PBoV conventional PCR assay. Parts of the positive products from the samples were sequenced.
3.1.1. Optimization of the annealing temperature For optimization, the recombinant plasmid pUC57-PBoV-NS1 was used as a template, and the annealing temperatures in the
Fig. 1. Optimization of the PBoV nanoPCR assay. (a) Optimization of the annealing temperature. The numbers on the left indicate the sizes of the DL2000 DNA Marker, and the numbers on the right indicate the sizes of the products. The annealing temperature ranged from 53 ◦ C to 62 ◦ C. 1: DL2000; 2: negative control; 3: 53 ◦ C; 4: 54 ◦ C; 5: 55 ◦ C; 6: 56 ◦ C; 7: 57 ◦ C; 8: 58 ◦ C; 9: 59 ◦ C; 10: 60 ◦ C; 11: 61 ◦ C; 12: 62 ◦ C. (b) Optimization of the primer concentration. The primer volume ranged from 0.4 L to 1.4 L. 1: DL2000; 2: negative control; 3: 0.4 L; 4: 0.6 L; 5: 0.8 L; 6: 1.0 L; 7: 1.2 L; 8: 1.4 L. (c) Optimization of the plasmid DNA concentration. The plasmid DNA volume was 0.2–1.4 L. 1: DL2000; 2: negative control; 3: 0.2 L; 4: 0.4 L; 5: 0.6 L; 6: 0.8 L; 7: 1.0 L; 8: 1.2 L; 9: 1.4 L.
X. Wang et al. / Journal of Virological Methods 202 (2014) 106–111
109
Fig. 3. Specificity of the PBoV nanoPCR. The specificity of the PBoV nanoPCR assay was determined by testing the DNA or cDNA of PBoV NS1 recombinant plasmid DNA and eight other viruses using PBoV NS1 primers. 1: DL2000; 2: negative control; 3: positive control; 4: PPV; 5: PCV-2; 6: PRRSV; 7: PRV; 8: CSFV; 9: EMCV; 10: PTV; 11: ASFV. Fig. 2. Comparison of the PBoV nanoPCR assay and the PBoV conventional PCR assay for detection of PBoV NS1 plasmid DNA in a dilution series (A) and for detection of PBoV NS1 in field samples (from nine pigs containing different levels of the virus) (B). Gels in a and c are from the PBoV nanoPCR assay, and gels in b and d are from the PBoV conventional PCR assay. In A, 1: DL2000; 2: negative control; 3: 6.70 × 1010 copies/L; 4: 6.70 × 109 copies/L; 5: 6.70 × 108 copies/L; 6: 6.70 × 107 copies/L; 7: 6.70 × 106 copies/L; 8: 6.70 × 105 copies/L; 9: 6.70 × 104 copies/L; 10: 6.70 × 103 copies/L; 11: 6.70 × 102 copies/L; 12: 6.70 × 101 copies/L; 13: 6.70 × 100 copies/L. In B, 1: DL2000; 2: negative control; 3: 2804 ng/L; 4: 1941 ng/L; 5: 532 ng/L; 6: 216 ng/L; 7: 142 ng/L; 8: 41.6 ng/L; 9: 25.6 ng/L; 10: 19.8 ng/L; 11: 6.3 ng/L.
PCR thermocycler ranged from 53 to 62 ◦ C. The best results were obtained with temperatures between 55 ◦ C and 58 ◦ C (Fig. 1a). Because a higher annealing temperature is conducive to better specificity, 58 ◦ C was chosen as the annealing temperature. 3.1.2. Optimization of the primer concentrations To optimize the primer concentrations, the optimized annealing temperature of 58 ◦ C was used, and primer volumes in the PCR thermocycler ranged from 0.4 L to 1.4 L in increments of 0.2 L. Amplification was best at 0.8 L (Fig. 1b), and 0.8 L was chosen as the primer volume. 3.1.3. Optimization of the plasmid DNA concentrations To optimize the plasmid DNA concentrations, the optimized annealing temperature and primer volume were used, and plasmid DNA volume in the PCR thermocycler ranged from 0.2 L to 1.4 L in increments of 0.2 L. Results were not significantly affected by plasmid DNA volume (Fig. 1c), and 0.8 L (as recommended in the NPK02 Kit) was chosen as the plasmid DNA volume. Under the optimized conditions, the PBoV nanoPCR assay was performed in a 12-L reaction mixture containing 0.8 L of extracted DNA or standard plasmid, 11.2 L of nanoPCR Master Mix containing 6 L of 2× nano buffer, 0.8 L each of forward and reverse primer (10 M), 0.2 L of Taq DNA polymerase (5 U/L), and ddH2 O up to 12 L. The PCR conditions were 5 min at 94 ◦ C; followed by 30 cycles of 94 ◦ C for 30 s, 58 ◦ C for 30 s, and 72 ◦ C for 40 s; and a final elongation for 7 min at 72 ◦ C. 3.2. Sensitivity of the PBoV nanoPCR assay The sensitivity of the PBoV nanoPCR assay was compared with that of conventional PCR by testing 10-fold serial dilutions of the recombinant DNA plasmid (6.70 × 1010 to 6.70 × 100 copies/L) and DNA field samples obtained from nine pigs from the clinical samples containing different concentrations of PBoV. With the serially diluted plasmid, the detection limit was 6.70 × 101 copies/L for the PBoV nanoPCR and 6.70 × 103 copies/L for the conventional PCR (Fig. 2A). With the field samples, the lowest
concentration detected was 19.8 ng/L for the nanoPCR assay and 41.6 ng/L for the conventional PCR assay (Fig. 2B). 3.3. Specificity of the PBoV nanoPCR assay The specificity of PBoV nanoPCR assay was determined by testing the DNA or cDNA of eight other viruses using the PBoV NS1 primers. PBoV plasmid DNA and SPF swine DNA served as positive and negative controls, respectively. The nanoPCR assay amplified PBoV plasmid DNA but none of the other eight viruses (Fig. 3). 3.4. Detection of PBoV in clinical samples Of the 65 clinical samples collected from diseased pigs, 73.8% (48 of 65) and 86.2% (56 of 65) were determined to be PBoV positive by PBoV conventional PCR assay and PBoV nanoPCR assay, respectively. Of the 36 clinical samples collected from symptomless pigs, 27.8% (10 of 36) and 44.4% (16 of 36) were determined to be PBoV positive by PBoV conventional PCR assay and PBoV nanoPCR assay, respectively. Based on all samples, 57.4% (58 of 101) and 71.3% (72 of 101) were determined to be PBoV positive by PBoV conventional PCR assay PBoV nanoPCR assay, respectively (Table 2). These results suggest that PBoV plays an important role in the occurrence of diarrhea and death of piglets. The specific role needs further investigation. 3.5. DNA sequencing and analysis The sequence analysis revealed high similarity (>99%) between the products obtained with the nanoPCR amplification of the NS1 gene of PBoV (the objective sequences) and the reference sequence of PBoV. The result indicated PBoV nanoPCR is specificity. A phylogenetic tree was constructed by the neighbor-joining (NJ) method, and the robustness of the phylogenetic analysis was determined by bootstrap analysis with 500 replications (Fig. 4). The phylogenetic tree analysis demonstrated that the sequences of the NS1 gene obtained in the current research were part of a cluster that included porcine bocavirus in China and that was closely related to porcine bocavirus 2. 4. Discussion Bocaviruses are emerging pathogens that cause various diseases in both humans and animals. In particular, these viruses are associated with respiratory and gastrointestinal diseases in the young of humans and other animals. PBoV was discovered
110
X. Wang et al. / Journal of Virological Methods 202 (2014) 106–111
Table 2 Detection of PBoV in 101 clinical samples (collected from healthy and diseased pigs on commercial farms in China) by conventional PCR and by nanoPCR. Condition of pig
No. of clinical samples
No. of PBoV-positive samples by conventional PCR
Positive (%)
No. of PBoV-positive samples by nanoPCR
Positive (%)
Healthy Diseased Total
36 65 101
10 48 58
27.8 73.8 57.4
16 56 72
44.4 86.2 71.3
in 2009 in Swedish pigs with PMWS and is closely related to other bocaviruses (Blomstrom et al., 2009). In China, PBoV was subsequently detected in 38.7% of pigs with PMWS (Zhai et al., 2010). In Sweden, PBoV was detected in 88% of pigs with PMWS and in 46% of pigs without PMWS (Blomstrom et al., 2010). It follows that PBoV is now considered a serious threat to the pig industry in China, Sweden, and elsewhere, and the possible role of
PBoV in swine disease is currently under intensive investigation. The development of a rapid and reliable method for its detection would aid future studies of this emerging pathogen. Conventional PCR, real-time PCR, and LAMP assays have been previously established for the detection of PBoV. Conventional PCR, however, is relatively slow and insensitive, real-time PCR requires expensive instruments, and LAMP assays are easily contaminated.
Fig. 4. Phylogenetic tree based on NS1 gene nucleotide sequences from GenBank and PBoV-HB-NS1. Maximum likelihood bootstrap scores, which represent confidence coefficients, are shown above the branches. The figure also indicate that sequences from China in 2006 were not obtained from diseased piglets but those from China in 2010 (the seven sequences that are circled and colored) were obtained from diseased piglets. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)
X. Wang et al. / Journal of Virological Methods 202 (2014) 106–111
Before the current research, nanoPCR assay had not been used to detect PBoV. In this study, a nanoPCR assay that targets the NS1 gene was developed for detection of PBoV. Because it uses nanofluids, this assay is more rapid than conventional PCR. The PBoV nanoPCR assay was determined to be 100-times more sensitive than conventional PCR. The nanoPCR assay was also specific in that it did not amplify eight other porcine viruses. In addition to confirming that the nanoPCR assay is more sensitive than the conventional PCR assay for detection of PBoV, the data from the clinical samples demonstrated that PBoV is widespread in China. As shown in the phylogenetic tree, porcine bocavirus can be divided into two genotypes (genotype I and genotype II), and genotype I can be further divided into three clusters: a Chinese cluster (A), a European cluster (B) and an American cluster (C). At the same time, the sequences of the NS1 gene obtained in the current research were grouped in a cluster that belonged to genotype II and included porcine bocavirus in China. The phylogenetic tree indicates that piglet diarrhea in China was not associated with porcine bocaviruses before 2006, but has been associated with porcine bocaviruses since 2010. Porcine bocaviruses are a major threat to pig industry in China and elsewhere. Because of its low homology and it is troublesome to develop a vaccine to comprehensively control PBoV. 5. Conclusion A rapid, sensitive, and specific nanoPCR assay was developed for detection of PBoV. This assay should be useful for both clinical diagnosis and for the study of PBoV epidemiology and pathology. Acknowledgements This work was supported by National Natural Science Foundation of China (Nos. 31001069, 31172349, and 31172341), the Chinese State Key Laboratory of Veterinary Biotechnology Fund (NKLVBP 201108), the National High-tech R&D Program (8632011AA10A208/2011AA10A200), the Excellent Youth Foundation of Heilongjiang Scientific Committee (No. JC201216), and the National Science and Technology Achievement Transformation Project (No. 2012GB23260557). References Allander, T., Tammi, M.T., Eriksson, M., Bjerkner, A., Tiveljung-Lindell, A., 2005. Cloning of a human parvovirus by molecular screening of respiratory tract samples. Proc. Natl. Acad. Sci. U.S.A. 102, 12891–12896. Allander, T., Emerson, S.U., Engle, R.E., Purcell, R.H., Bukh, J., 2001. A virus discovery method incorporating DNase treatment and its application to the identification of two bovine parvovirus species. Proc. Natl. Acad. Sci. U.S.A. 98, 11609–11614. Anderson, L.J., 2007. Human bocavirus: a new viral pathogen. Clin. Infect. Dis. 44, 911–912.
111
Arthur, J.L., Higgins, G.D., Davidson, G.P., Givney, R.C., Ratcliff, R.M., 2009. A novel bocavirus associated with acute gastroenteritis in Australian children. PLoS Pathog. 5, e1000391. Blomstrom, A.L., Belak, S., Fossum, C., McKillen, J., Allan, G., Wallgren, P., Berg, M., 2009. Detection of a novel porcine boca-like virus in the background of porcine circovirus type 2 induced postweaning multisystemic wasting syndrome. Virus Res. 146, 125–129. Blomstrom, A.L., Belak, S., Fossum, C., Fuxler, L., Wallgren, P., Berg, M., 2010. Studies of porcine circovirus type 2, porcine boca-like virus and torque teno virus indicate the presence of multiple viral infections in postweaning multisystemic wasting syndrome pigs. Virus Res. 152, 59–64. Claude, M., Fauquet, M., Maniloff, J., Desselberger, U., Ball, L.A., 2004. Virus Taxonomy: The Eighth Report of the International Committee on Taxonomy of Viruses. Academic Press. Cheng, W.X., Jin, Y., Duan, Z.J., Xu, Z.Q., Qi, H.M., 2008. Human bocavirus in children hospitalized for acute gastroenteritis: a case–control study. Clin. Infect. Dis. 47, 161–167. Cheng, W.X., Li, J.S., Huang, C.P., Yao, D.P., Liu, N., Cui, S.X., Jin, Y., Duan, Z.J., 2010. Identification and nearly full-length genome characterization of novel porcine bocaviruses. PLoS ONE 5 (10), e13583. Finkbeiner, S.R., Li, Y., Ruone, S., Conrardy, C., Gregoricus, N., 2009. Identification of a novel astrovirus (astrovirus VA1) associated with an outbreak of acute gastroenteritis. J. Virol. 83, 10836–10839. Kapoor, A., Slikas, E., Simmonds, P., Chieochansin, T., Naeem, A., 2009. A newly identified bocavirus species in human stool. J. Infect. Dis. 199, 196–200. Karalar, L., Lindner, J., Schimanski, S., Kertai, M., Segerer, H., 2010. Prevalence and clinical aspects of human bocavirus infection in children. Clin. Microbiol. Infect. 16 (6), 633–639. Li, B., Xiao, S.B., Ma, J.J., Liu, Y.L., Mao, L., Wen, L.B., Mao, A.H., Zhang, X.H., Ni, Y.X., Guo, R.L., Zhou, J.M., Yu, Z.Y., Lv, L.X., Wang, X.M., Fang, L.R., Chen, H.C., He, K.W., 2011. Development of a novel TaqMan-based real-time PCR assay for the detection of porcine boca-like virus (Pbo-likeV). Virol. J. 8, 357. Li, B., Ma, J.J., Xiao, S.B., Zhang, X.H., Wen, L.B., Mao, L., Ni, Y.X., Guo, R.L., Zhou, J.M., Lv, L.X., He, K.W., 2012. Development of a loop-mediated isothermal amplification method for rapid detection of porcine boca-like virus. J. Virol. Methods 179, 390–395. Li, H., Rothberg, L., 2004. Colorimetric detection of DNA sequences based on electrostatic interactions with unmodified gold nanoparticles. Proc. Natl. Acad. Sci. 101, 14036–14039. Li, L., Victoria, J., Kapoor, A., Blinkova, O., Wang, C., 2009. A novel picornavirus associated with gastroenteritis. J. Virol. 83, 12002–12006. Ma, X., Cui, Y., Qiu, Z., Zhang, B., Cui, S., 2013. A nanoparticle-assisted PCR assay to improve the sensitivity for rapid detection and differentiation of wild-type pseudorabies virus and gene-deleted vaccine strains. J. Virol. Methods 193, 374–378. McKillen, J., McNeilly, F., Duffy, C., McMenamy, M., McNair, I., Hjertner, B., Millar, A., McKay, K., Lagan, P., Adair, B., Allan, G., 2011. Isolation in cell cultures and initial characterisation of two novel bocavirus species from swine in Northern Ireland. Vet. Microbiol. 152 (1–2), 39–45. Shan, T., Lan, D., Li, L., Wang, C., Cui, L., Zhang, W., Hua, X., Zhu, C., Zhao, W., Delwart, E., 2011. Genomic characterization and high prevalence of bocaviruses in swine. PLoS ONE 6, e17292. Tozer, S.J., Lambert, S.B., Whiley, D.M., Bialasiewicz, S., Lyon, M.J., 2009. Detection of human bocavirus in respiratory, fecal, and blood samples by realtime PCR. J. Med. Virol. 81, 488–493. Zeng, S., Wang, D., Fang, L., Ma, J., Song, T., Zhang, R., Chen, H., Xiao, S., 2011. Complete coding sequences and phylogenetic analysis of porcine bocavirus. J. Gen. Virol. 92, 784–788. Zhai, S., Yue, C., Wei, Z., Long, J., Ran, D., Lin, T., Deng, Y., Huang, L., Sun, L., Zheng, H., Gao, F., Zheng, H., Chen, S., Yuan, S., 2010. High prevalence of a novel porcine bocavirus in weanling piglets with respiratory tract symptoms in China. Arch. Virol. 155, 1313–1317. Zhang, H.B., Huang, L., Liu, Y.J., Lin, T., Sun, C.Q., Deng, Y., Wei, Z.Z., Cheung, A.K., Long, J.X., Yuan, S.S., 2011. Porcine bocaviruses: genetic analysis and prevalence in Chinese swine population. Epidemiol. Infect. 139, 1581–1586.
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Short communication
A new nanoPCR molecular assay for detection of porcine bocavirus Xiaoling Wang a , Aiquan Bai b,∗∗ , Jing Zhang a , Miaomiao Kong a , Yuchao Cui a , Xingjie Ma a , Xia Ai c , Qinghai Tang d,∗ ∗ ∗ , Shangjin Cui a,∗ a Division of Swine Infectious Diseases, State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute of Chinese Academy of Agricultural Sciences, China b Foshan University, Foshan, Guandong, China c College of Animal Science and Veterinary Medicine, Tianjin Agricultural University, Tianjin, China d Nanyang Normal University, 1638 Wolong Road, Nanyang 473061, China
a b s t r a c t Article history: Received 3 October 2013 Received in revised form 24 February 2014 Accepted 27 February 2014 Available online 15 March 2014 Keywords: Detection Epidemic characterization NanoPCR NS1 gene PBoV
Nanoparticle-assisted polymerase chain reaction (nanoPCR) is a novel method for the rapid amplification of DNA and has been used for the detection of virus. For detection of porcine bocavirus (PBoV), a sensitive and specific nanoPCR assay was developed with a pair of primers that were designed based on NS1 gene sequences available in GenBank. Under the optimized conditions of the PBoV nanoPCR assay, the nanoPCR assay was 100-fold more sensitive than a conventional PCR assay. The lower detection limit of the nanoPCR assay was about 6.70 × 101 copies. The nanoPCR assay amplified the specific 482-bp fragment of the PBoV NS1 recombinant plasmid but did not produce any product with genomic DNA or cDNA of porcine parvovirus, porcine circovirus type II, porcine reproductive and respiratory syndrome virus, pseudorabies virus, classic swine fever virus, Encephalomyocarditis virus, Porcine Teschovirus or African swine fever virus plasmid. Of 65 clinical samples collected from diseased pigs, 73.8% and 86.2% were determined to be PBoV positive by PBoV conventional PCR and PBoV nanoPCR assay, respectively. Of 36 clinical samples from healthy pigs, 27.8% and 44.4% were PBoV positive by PBoV conventional PCR and PBoV nanoPCR assay, respectively. The nanoPCR assay will be useful for diagnosing PBoV and for studying its epidemiology and pathology. © 2014 Elsevier B.V. All rights reserved.
1. Introduction The Bocavirus genome is not segmented and contains a positiveor negative-sense, single-stranded DNA of 4000–6000 nucleotides (Allander et al., 2005). Like other members of the Parvoviridae family, bocaviruses contain NS1 and NP1 non-structural (NS) proteins and VP1/VP2 structural proteins. Known bocaviruses include bovine parvovirus (BPV), minute virus of canine (MVC), porcine bocavirus (PBoV), gorilla bocavirus (GBoV), and human bocaviruses 1–4 (Anderson, 2007; Claude et al., 2004 and Kapoor et al., 2009). In 2005, Allander et al. reported the detection of a new human parvovirus in children with acute respiratory tract infections. The new virus, which showed 42–43% amino acid identity to the
∗ Corresponding author at: 427 Maduan Street, Nangang District, Harbin 150001, Heilongjiang, China. Tel.: +86 18946066093; fax: +86 451 51997166. ∗∗ Corresponding author at: Institute of Science and Technology, Foshan, Guandong, China. ∗ ∗ ∗Co-corresponding author. E-mail addresses: [email protected] (A. Bai), [email protected] (Q. Tang), [email protected], [email protected] (S. Cui). http://dx.doi.org/10.1016/j.jviromet.2014.02.029 0166-0934/© 2014 Elsevier B.V. All rights reserved.
nearest neighbors (MVC and BPV) in both major ORFs that encode the NS1 and VP1 proteins, was assigned to the genus Bocavirus and was provisionally named human Bocavirus (HBoV) (Allander et al., 2005). Recently, HBoV2, HBoV3, and HBoV4 have been discovered and all have been assigned to the genus Bocavirus (Kapoor et al., 2009 and Arthur et al., 2009). These human bocaviruses have been associated with respiratory and enteric infections in humans, but their causal relationship with these infections has not been proven by experiments with animals (Allander et al., 2005; Cheng et al., 2008; Arthur et al., 2009; Kapoor et al., 2009; Tozer et al., 2009; Karalar et al., 2010). With the recent development of random amplification methods and high-throughput sequencing, an increasing number of new viral pathogens have been identified in samples originating from humans and animals (Allander et al., 2001 Finkbeiner et al., 2009; Li et al., 2009), and one of these new pathogens is porcine bocavirus. Porcine bocavirus was first described in 2009; it was isolated from feces of swine with postweaning multisystemic wasting syndrome (PMWS) in Sweden and was designated as porcine boca-like virus (PBo-likeV) (Blomstrom et al., 2009). PBo-likeV has also been identified in China and was named porcine bocavirus (PBoV) (Zhai
X. Wang et al. / Journal of Virological Methods 202 (2014) 106–111
et al., 2010 and Zeng et al., 2011) or porcine bocavirus 1 (Shan et al., 2011a, Zhang et al., 2011). A tentative classification of the newly discovered porcine bocaviruses was proposed by Zhang et al. (2011) grouping the six reported porcine bocaviruses into four species: PoBoV1 (porcine boca-like virus or PBoLV), PoBoV2 (porcine parvovirus 4 or PPV4), PoBoV3 (PBoV1/PBoV2), and PoBoV4 (6V/7V). A study using sequence-independent single primer amplification discovered a new group of further porcine bocaviruses designated PBoV1, PBoV2, 6V, and 7V that formed phylogenetically separate clusters (Cheng et al., 2010). Subsequent studies indicated a high prevalence of this novel PBoV in weaning piglets with respiratory tract symptoms (Blomstrom et al., 2009). PBoV has also been detected in healthy pigs in China (Zhang et al., 2011). PBoV has been successfully isolated (McKillen et al., 2011), and conventional PCR, real-time PCR, and LAMP assays have been developed to detect PBoV (Bin Li et al., 2011 and Bin Li et al., 2012). A nanoPCR assay, however, has not been developed for PBoV. Relative to conventional PCR assay, nanoPCR assay has the potential for increased sensitivity and specificity. In addition, real-time PCR assays require expensive instruments, and LAMP assays are easily contaminated. NanoPCR is an advanced form of PCR in which solid gold nanometal particles (1–100 nm) form colloidal nanofluids, which increase thermal conductivity. Therefore, PCR assays with nanofluids attain the target temperature more quickly than PCR assays with original liquids, and this reduces the time at non-target temperatures and thereby reduces non-specific amplification and increases specific amplification (Li and Rothberg, 2004; Ma et al., 2013). NanoPCR is also less prone than LAMP to false positive results from amplicon contamination. In addition, the nanoPCR assay does not require specialized instruments beyond standard PCR equipment, i.e., it can be conducted in standard molecular biology laboratories (Ma et al., 2013). The NS1 protein of PBoV is encoded by the NS1 gene and is produced in the early phase of PBoV replication, before structural protein synthesis. NS1 is a major NS protein and it is of great importance for porcine bocavirus. As expected, the functions of NS1 proteins are similar among different viruses. In addition, the NS1 gene was used for the development of conventional PCR for detection of PBoV. Consequently, NS1 was chosen as a specific gene to distinguish PBoV from other viruses. In this study, a highly sensitive and specific nanoPCR assay targeting the NS1 gene was established for the rapid detection of PBoV in clinical samples.
107
sera, spleen, liver, brain, heart, kidney, lungs, lymph nodes, and tonsils from healthy pigs (36 samples) and from diseased pigs (65 samples). Samples from diseased pigs were mostly collected from piglets that experienced diarrhea and death. 2.2. Preparation of template DNA and RNA were extracted from the above reference viruses and tissue homogenates (spleen, liver, brain, heart, kidney, lungs, lymph nodes, and tonsils) or sera of clinical samples using the TIANamp Virus genomic DNA/RNA kit (Beijing Tiangen Biotech Company, Beijing, China), according to the manufacturer’s instructions. The extracted DNA was eluted in a total volume of 50 L of RNase-free ddH2 O and stored at −20 ◦ C until used. cDNA synthesis reaction was performed with the TranScript First strand cDNA Synthesis SuperMix (Beijing TransGen Biotech Company) in accordance with the manufacturer’s instructions. 2.3. Establishment of the PBoV conventional PCR assay 2.3.1. Design of primers and construction of recombinant plasmid DNA The full sequence of PBoV was retrieved from the Porcine bocavirus pig/ZJD/China/2006 (GenBank accession numbers: HM053693 and HM053694). Primer premier 5 software was used to design primers that would amplify the NS1 gene, with a fragment length of 482 bp (Table 1). The complete coding sequences of the NS1 gene was cloned into the plasmid vector pUC57 as the standard plasmid. The resulting pUC57-PBoV-NS1 construction was amplified in Escherichia coli DH5␣, and the recombinant plasmid pUC57-PBoV-NS1 was purified with the AxyPrepTM Plasmid Miniprep Kit (AXYGEN Biotechnology Company, Hangzhou, China) and quantified using UV spectroscopy (6.70 × 1010 DNA copies/L). The plasmids were kept at −20 ◦ C until used. 2.3.2. Establishment of the PBoV conventional PCR assay The PBoV conventional PCR assay was performed in a 12-L reaction mixture containing 1 L of extracted DNA or standard plasmid, 11 L of conventional PCR Master Mix containing 6 L of 2× GC buffer, 1.0 L of each of forward and reverse primer (10 M), 0.2 L of Ex Taq DNA polymerase (5 U/L), 1.0 L of dNTP, and ddH2 O up to 12 L. The PCR was conducted as follows: 5 min at 94 ◦ C; followed by 30 cycles of 94 ◦ C for 30 s, 58 ◦ C for 30 s, and 72 ◦ C for 40 s; and a final elongation for 7 min at 72 ◦ C.
2. Materials and methods
2.4. Establishment of the PBoV nanoPCR assay
2.1. Viruses and sample preparation
2.4.1. Design of primers and construction of recombinant plasmid DNA Primers were designed and the recombinant plasmid DNA was constructed as described in Section 2.3.1.
The plasmid vector pUC57 was purchased from TaKaRa Biotechnology Company, Dalian, China, and the following viruses were obtained from the Harbin Veterinary Research Institute of Chinese Academy of Agricultural Sciences: porcine parvovirus (PPV, strain BQ-C), porcine circovirus type II (PCV2, strain SH), porcine reproductive and respiratory syndrome virus (PRRSV, strain HB), pseudorabies virus (PRV, strains SC), classic swine fever virus (CSFV), Encephalomyocarditis virus (EMCV), porcine Teschovirus (PTV), and African swine fever virus (ASFV). The Nano PCR Kit (NPK02) was purchased from GREDBIO (Weihai, China). Animal experiments were approved by the Harbin Veterinary Research Institute of the Chinese Academy of Agricultural Sciences, and animal experiments were performed in accordance with animal ethics guidelines and approved protocols. The Animal Ethics Committee approval number was Heilongjiang-SQ 2013-2046. A total of 101 clinical samples were collected from pig farms in China located in Hebei, Heilongjiang, etc. The samples mainly included
2.4.2. Optimization of the PBoV nanoPCR assay Experiments were performed to optimize the annealing temperature, primer volume, and plasmid DNA volume for the PBoV nanoPCR assay. The annealing temperatures in the PCR thermocycler (Eppendorf, Mastercycler-Gradient, Germany) ranged from 53 ◦ C to 62◦ C, the primer volume ranged from 0.4 L to 1.4 L, and the plasmid DNA volume ranged from 0.2 L to 1.4 L in increments of 0.2 L. The products were visualized on 2% agarose gels. 2.4.3. Sensitivity of PBoV nanoPCR To compare the sensitivity of nanoPCR and conventional PCR, 10-fold serial dilutions of the recombinant plasmid pUC57-PBoVNS1 (ranging from 6.70 × 1010 to 6.70 × 100 copies/L) were used as template. In another comparison, field samples of DNA from nine
108
X. Wang et al. / Journal of Virological Methods 202 (2014) 106–111
Table 1 Sequences of primers designed to detect the NS1 gene of PBoV by nanoPCR. Gene
Primer sequence (5 –3 )
Tm (◦ C)
Product (bp)
Enzyme site
NS1
F: GCCGAATTCATGAAGTGCTACGCTCTGG R: GCCGTCGACGCTAGACGCTCGCTTCGTC F: AGTCCTACGCCATCAGCAGCATC R: TCCCGCCTGCCAGGGATTGT
64.0 69.9 61.3 61.6
2112
EcoRI SalI
NS1
482
Underline: enzyme sites; F: forward primer; R: reverse primer.
pigs whose PBoV volume were different were also used as template. Each dilution and DNA sample was tested by nanoPCR and conventional PCR, and ddH2 O was used as the negative control. PCR products were subjected to electrophoresis on a 2% agarose gel.
2.4.4. Specificity of PBoV nanoPCR To assess the specificity of nanoPCR, the DNA or cDNA of PPV, PCV2, PRRSV, PRV, CSFV, EMCV, PTV and ASFV were subjected separately to the PBoV nanoPCR assay. The recombinant plasmid pUC57-PBoV-NS1 was used as a positive control, and DNA extracted from SPF swine tissues was used as a negative control. PCR products were subjected to electrophoresis on a 2% agarose gel.
2.6. DNA sequencing and the characterization of PBoV epidemics in China Several positive PBoV nanoPCR products generated from the clinical samples collected from Hebei (named PBoV-HB) were purified using the AxyPrepTM DNA Gel Extraction Kit (AXYGEN Biotechnology Company, Hangzhou, China) and sent to TaKaRa Company for sequencing. The aim was to determine the specificity of PBoV nanoPCR and the prevalence of PBoV in China. DNA Star software and BLAST searching of GenBank were used to determine the sequence consistency with the accessed PBoV-NS1 gene sequences in GenBank. MEGA5.1 software was used for alignment and construction of the phylogenetic tree. 3. Results
2.5. Detection of PBoV in clinical samples
3.1. Optimization of the PBoV nanoPCR assay
The viral DNA from the 101 samples was subjected to the PBoV nanoPCR assay and to the PBoV conventional PCR assay. Parts of the positive products from the samples were sequenced.
3.1.1. Optimization of the annealing temperature For optimization, the recombinant plasmid pUC57-PBoV-NS1 was used as a template, and the annealing temperatures in the
Fig. 1. Optimization of the PBoV nanoPCR assay. (a) Optimization of the annealing temperature. The numbers on the left indicate the sizes of the DL2000 DNA Marker, and the numbers on the right indicate the sizes of the products. The annealing temperature ranged from 53 ◦ C to 62 ◦ C. 1: DL2000; 2: negative control; 3: 53 ◦ C; 4: 54 ◦ C; 5: 55 ◦ C; 6: 56 ◦ C; 7: 57 ◦ C; 8: 58 ◦ C; 9: 59 ◦ C; 10: 60 ◦ C; 11: 61 ◦ C; 12: 62 ◦ C. (b) Optimization of the primer concentration. The primer volume ranged from 0.4 L to 1.4 L. 1: DL2000; 2: negative control; 3: 0.4 L; 4: 0.6 L; 5: 0.8 L; 6: 1.0 L; 7: 1.2 L; 8: 1.4 L. (c) Optimization of the plasmid DNA concentration. The plasmid DNA volume was 0.2–1.4 L. 1: DL2000; 2: negative control; 3: 0.2 L; 4: 0.4 L; 5: 0.6 L; 6: 0.8 L; 7: 1.0 L; 8: 1.2 L; 9: 1.4 L.
X. Wang et al. / Journal of Virological Methods 202 (2014) 106–111
109
Fig. 3. Specificity of the PBoV nanoPCR. The specificity of the PBoV nanoPCR assay was determined by testing the DNA or cDNA of PBoV NS1 recombinant plasmid DNA and eight other viruses using PBoV NS1 primers. 1: DL2000; 2: negative control; 3: positive control; 4: PPV; 5: PCV-2; 6: PRRSV; 7: PRV; 8: CSFV; 9: EMCV; 10: PTV; 11: ASFV. Fig. 2. Comparison of the PBoV nanoPCR assay and the PBoV conventional PCR assay for detection of PBoV NS1 plasmid DNA in a dilution series (A) and for detection of PBoV NS1 in field samples (from nine pigs containing different levels of the virus) (B). Gels in a and c are from the PBoV nanoPCR assay, and gels in b and d are from the PBoV conventional PCR assay. In A, 1: DL2000; 2: negative control; 3: 6.70 × 1010 copies/L; 4: 6.70 × 109 copies/L; 5: 6.70 × 108 copies/L; 6: 6.70 × 107 copies/L; 7: 6.70 × 106 copies/L; 8: 6.70 × 105 copies/L; 9: 6.70 × 104 copies/L; 10: 6.70 × 103 copies/L; 11: 6.70 × 102 copies/L; 12: 6.70 × 101 copies/L; 13: 6.70 × 100 copies/L. In B, 1: DL2000; 2: negative control; 3: 2804 ng/L; 4: 1941 ng/L; 5: 532 ng/L; 6: 216 ng/L; 7: 142 ng/L; 8: 41.6 ng/L; 9: 25.6 ng/L; 10: 19.8 ng/L; 11: 6.3 ng/L.
PCR thermocycler ranged from 53 to 62 ◦ C. The best results were obtained with temperatures between 55 ◦ C and 58 ◦ C (Fig. 1a). Because a higher annealing temperature is conducive to better specificity, 58 ◦ C was chosen as the annealing temperature. 3.1.2. Optimization of the primer concentrations To optimize the primer concentrations, the optimized annealing temperature of 58 ◦ C was used, and primer volumes in the PCR thermocycler ranged from 0.4 L to 1.4 L in increments of 0.2 L. Amplification was best at 0.8 L (Fig. 1b), and 0.8 L was chosen as the primer volume. 3.1.3. Optimization of the plasmid DNA concentrations To optimize the plasmid DNA concentrations, the optimized annealing temperature and primer volume were used, and plasmid DNA volume in the PCR thermocycler ranged from 0.2 L to 1.4 L in increments of 0.2 L. Results were not significantly affected by plasmid DNA volume (Fig. 1c), and 0.8 L (as recommended in the NPK02 Kit) was chosen as the plasmid DNA volume. Under the optimized conditions, the PBoV nanoPCR assay was performed in a 12-L reaction mixture containing 0.8 L of extracted DNA or standard plasmid, 11.2 L of nanoPCR Master Mix containing 6 L of 2× nano buffer, 0.8 L each of forward and reverse primer (10 M), 0.2 L of Taq DNA polymerase (5 U/L), and ddH2 O up to 12 L. The PCR conditions were 5 min at 94 ◦ C; followed by 30 cycles of 94 ◦ C for 30 s, 58 ◦ C for 30 s, and 72 ◦ C for 40 s; and a final elongation for 7 min at 72 ◦ C. 3.2. Sensitivity of the PBoV nanoPCR assay The sensitivity of the PBoV nanoPCR assay was compared with that of conventional PCR by testing 10-fold serial dilutions of the recombinant DNA plasmid (6.70 × 1010 to 6.70 × 100 copies/L) and DNA field samples obtained from nine pigs from the clinical samples containing different concentrations of PBoV. With the serially diluted plasmid, the detection limit was 6.70 × 101 copies/L for the PBoV nanoPCR and 6.70 × 103 copies/L for the conventional PCR (Fig. 2A). With the field samples, the lowest
concentration detected was 19.8 ng/L for the nanoPCR assay and 41.6 ng/L for the conventional PCR assay (Fig. 2B). 3.3. Specificity of the PBoV nanoPCR assay The specificity of PBoV nanoPCR assay was determined by testing the DNA or cDNA of eight other viruses using the PBoV NS1 primers. PBoV plasmid DNA and SPF swine DNA served as positive and negative controls, respectively. The nanoPCR assay amplified PBoV plasmid DNA but none of the other eight viruses (Fig. 3). 3.4. Detection of PBoV in clinical samples Of the 65 clinical samples collected from diseased pigs, 73.8% (48 of 65) and 86.2% (56 of 65) were determined to be PBoV positive by PBoV conventional PCR assay and PBoV nanoPCR assay, respectively. Of the 36 clinical samples collected from symptomless pigs, 27.8% (10 of 36) and 44.4% (16 of 36) were determined to be PBoV positive by PBoV conventional PCR assay and PBoV nanoPCR assay, respectively. Based on all samples, 57.4% (58 of 101) and 71.3% (72 of 101) were determined to be PBoV positive by PBoV conventional PCR assay PBoV nanoPCR assay, respectively (Table 2). These results suggest that PBoV plays an important role in the occurrence of diarrhea and death of piglets. The specific role needs further investigation. 3.5. DNA sequencing and analysis The sequence analysis revealed high similarity (>99%) between the products obtained with the nanoPCR amplification of the NS1 gene of PBoV (the objective sequences) and the reference sequence of PBoV. The result indicated PBoV nanoPCR is specificity. A phylogenetic tree was constructed by the neighbor-joining (NJ) method, and the robustness of the phylogenetic analysis was determined by bootstrap analysis with 500 replications (Fig. 4). The phylogenetic tree analysis demonstrated that the sequences of the NS1 gene obtained in the current research were part of a cluster that included porcine bocavirus in China and that was closely related to porcine bocavirus 2. 4. Discussion Bocaviruses are emerging pathogens that cause various diseases in both humans and animals. In particular, these viruses are associated with respiratory and gastrointestinal diseases in the young of humans and other animals. PBoV was discovered
110
X. Wang et al. / Journal of Virological Methods 202 (2014) 106–111
Table 2 Detection of PBoV in 101 clinical samples (collected from healthy and diseased pigs on commercial farms in China) by conventional PCR and by nanoPCR. Condition of pig
No. of clinical samples
No. of PBoV-positive samples by conventional PCR
Positive (%)
No. of PBoV-positive samples by nanoPCR
Positive (%)
Healthy Diseased Total
36 65 101
10 48 58
27.8 73.8 57.4
16 56 72
44.4 86.2 71.3
in 2009 in Swedish pigs with PMWS and is closely related to other bocaviruses (Blomstrom et al., 2009). In China, PBoV was subsequently detected in 38.7% of pigs with PMWS (Zhai et al., 2010). In Sweden, PBoV was detected in 88% of pigs with PMWS and in 46% of pigs without PMWS (Blomstrom et al., 2010). It follows that PBoV is now considered a serious threat to the pig industry in China, Sweden, and elsewhere, and the possible role of
PBoV in swine disease is currently under intensive investigation. The development of a rapid and reliable method for its detection would aid future studies of this emerging pathogen. Conventional PCR, real-time PCR, and LAMP assays have been previously established for the detection of PBoV. Conventional PCR, however, is relatively slow and insensitive, real-time PCR requires expensive instruments, and LAMP assays are easily contaminated.
Fig. 4. Phylogenetic tree based on NS1 gene nucleotide sequences from GenBank and PBoV-HB-NS1. Maximum likelihood bootstrap scores, which represent confidence coefficients, are shown above the branches. The figure also indicate that sequences from China in 2006 were not obtained from diseased piglets but those from China in 2010 (the seven sequences that are circled and colored) were obtained from diseased piglets. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)
X. Wang et al. / Journal of Virological Methods 202 (2014) 106–111
Before the current research, nanoPCR assay had not been used to detect PBoV. In this study, a nanoPCR assay that targets the NS1 gene was developed for detection of PBoV. Because it uses nanofluids, this assay is more rapid than conventional PCR. The PBoV nanoPCR assay was determined to be 100-times more sensitive than conventional PCR. The nanoPCR assay was also specific in that it did not amplify eight other porcine viruses. In addition to confirming that the nanoPCR assay is more sensitive than the conventional PCR assay for detection of PBoV, the data from the clinical samples demonstrated that PBoV is widespread in China. As shown in the phylogenetic tree, porcine bocavirus can be divided into two genotypes (genotype I and genotype II), and genotype I can be further divided into three clusters: a Chinese cluster (A), a European cluster (B) and an American cluster (C). At the same time, the sequences of the NS1 gene obtained in the current research were grouped in a cluster that belonged to genotype II and included porcine bocavirus in China. The phylogenetic tree indicates that piglet diarrhea in China was not associated with porcine bocaviruses before 2006, but has been associated with porcine bocaviruses since 2010. Porcine bocaviruses are a major threat to pig industry in China and elsewhere. Because of its low homology and it is troublesome to develop a vaccine to comprehensively control PBoV. 5. Conclusion A rapid, sensitive, and specific nanoPCR assay was developed for detection of PBoV. This assay should be useful for both clinical diagnosis and for the study of PBoV epidemiology and pathology. Acknowledgements This work was supported by National Natural Science Foundation of China (Nos. 31001069, 31172349, and 31172341), the Chinese State Key Laboratory of Veterinary Biotechnology Fund (NKLVBP 201108), the National High-tech R&D Program (8632011AA10A208/2011AA10A200), the Excellent Youth Foundation of Heilongjiang Scientific Committee (No. JC201216), and the National Science and Technology Achievement Transformation Project (No. 2012GB23260557). References Allander, T., Tammi, M.T., Eriksson, M., Bjerkner, A., Tiveljung-Lindell, A., 2005. Cloning of a human parvovirus by molecular screening of respiratory tract samples. Proc. Natl. Acad. Sci. U.S.A. 102, 12891–12896. Allander, T., Emerson, S.U., Engle, R.E., Purcell, R.H., Bukh, J., 2001. A virus discovery method incorporating DNase treatment and its application to the identification of two bovine parvovirus species. Proc. Natl. Acad. Sci. U.S.A. 98, 11609–11614. Anderson, L.J., 2007. Human bocavirus: a new viral pathogen. Clin. Infect. Dis. 44, 911–912.
111
Arthur, J.L., Higgins, G.D., Davidson, G.P., Givney, R.C., Ratcliff, R.M., 2009. A novel bocavirus associated with acute gastroenteritis in Australian children. PLoS Pathog. 5, e1000391. Blomstrom, A.L., Belak, S., Fossum, C., McKillen, J., Allan, G., Wallgren, P., Berg, M., 2009. Detection of a novel porcine boca-like virus in the background of porcine circovirus type 2 induced postweaning multisystemic wasting syndrome. Virus Res. 146, 125–129. Blomstrom, A.L., Belak, S., Fossum, C., Fuxler, L., Wallgren, P., Berg, M., 2010. Studies of porcine circovirus type 2, porcine boca-like virus and torque teno virus indicate the presence of multiple viral infections in postweaning multisystemic wasting syndrome pigs. Virus Res. 152, 59–64. Claude, M., Fauquet, M., Maniloff, J., Desselberger, U., Ball, L.A., 2004. Virus Taxonomy: The Eighth Report of the International Committee on Taxonomy of Viruses. Academic Press. Cheng, W.X., Jin, Y., Duan, Z.J., Xu, Z.Q., Qi, H.M., 2008. Human bocavirus in children hospitalized for acute gastroenteritis: a case–control study. Clin. Infect. Dis. 47, 161–167. Cheng, W.X., Li, J.S., Huang, C.P., Yao, D.P., Liu, N., Cui, S.X., Jin, Y., Duan, Z.J., 2010. Identification and nearly full-length genome characterization of novel porcine bocaviruses. PLoS ONE 5 (10), e13583. Finkbeiner, S.R., Li, Y., Ruone, S., Conrardy, C., Gregoricus, N., 2009. Identification of a novel astrovirus (astrovirus VA1) associated with an outbreak of acute gastroenteritis. J. Virol. 83, 10836–10839. Kapoor, A., Slikas, E., Simmonds, P., Chieochansin, T., Naeem, A., 2009. A newly identified bocavirus species in human stool. J. Infect. Dis. 199, 196–200. Karalar, L., Lindner, J., Schimanski, S., Kertai, M., Segerer, H., 2010. Prevalence and clinical aspects of human bocavirus infection in children. Clin. Microbiol. Infect. 16 (6), 633–639. Li, B., Xiao, S.B., Ma, J.J., Liu, Y.L., Mao, L., Wen, L.B., Mao, A.H., Zhang, X.H., Ni, Y.X., Guo, R.L., Zhou, J.M., Yu, Z.Y., Lv, L.X., Wang, X.M., Fang, L.R., Chen, H.C., He, K.W., 2011. Development of a novel TaqMan-based real-time PCR assay for the detection of porcine boca-like virus (Pbo-likeV). Virol. J. 8, 357. Li, B., Ma, J.J., Xiao, S.B., Zhang, X.H., Wen, L.B., Mao, L., Ni, Y.X., Guo, R.L., Zhou, J.M., Lv, L.X., He, K.W., 2012. Development of a loop-mediated isothermal amplification method for rapid detection of porcine boca-like virus. J. Virol. Methods 179, 390–395. Li, H., Rothberg, L., 2004. Colorimetric detection of DNA sequences based on electrostatic interactions with unmodified gold nanoparticles. Proc. Natl. Acad. Sci. 101, 14036–14039. Li, L., Victoria, J., Kapoor, A., Blinkova, O., Wang, C., 2009. A novel picornavirus associated with gastroenteritis. J. Virol. 83, 12002–12006. Ma, X., Cui, Y., Qiu, Z., Zhang, B., Cui, S., 2013. A nanoparticle-assisted PCR assay to improve the sensitivity for rapid detection and differentiation of wild-type pseudorabies virus and gene-deleted vaccine strains. J. Virol. Methods 193, 374–378. McKillen, J., McNeilly, F., Duffy, C., McMenamy, M., McNair, I., Hjertner, B., Millar, A., McKay, K., Lagan, P., Adair, B., Allan, G., 2011. Isolation in cell cultures and initial characterisation of two novel bocavirus species from swine in Northern Ireland. Vet. Microbiol. 152 (1–2), 39–45. Shan, T., Lan, D., Li, L., Wang, C., Cui, L., Zhang, W., Hua, X., Zhu, C., Zhao, W., Delwart, E., 2011. Genomic characterization and high prevalence of bocaviruses in swine. PLoS ONE 6, e17292. Tozer, S.J., Lambert, S.B., Whiley, D.M., Bialasiewicz, S., Lyon, M.J., 2009. Detection of human bocavirus in respiratory, fecal, and blood samples by realtime PCR. J. Med. Virol. 81, 488–493. Zeng, S., Wang, D., Fang, L., Ma, J., Song, T., Zhang, R., Chen, H., Xiao, S., 2011. Complete coding sequences and phylogenetic analysis of porcine bocavirus. J. Gen. Virol. 92, 784–788. Zhai, S., Yue, C., Wei, Z., Long, J., Ran, D., Lin, T., Deng, Y., Huang, L., Sun, L., Zheng, H., Gao, F., Zheng, H., Chen, S., Yuan, S., 2010. High prevalence of a novel porcine bocavirus in weanling piglets with respiratory tract symptoms in China. Arch. Virol. 155, 1313–1317. Zhang, H.B., Huang, L., Liu, Y.J., Lin, T., Sun, C.Q., Deng, Y., Wei, Z.Z., Cheung, A.K., Long, J.X., Yuan, S.S., 2011. Porcine bocaviruses: genetic analysis and prevalence in Chinese swine population. Epidemiol. Infect. 139, 1581–1586.
