Arch Virol DOI 10.1007/s00705-013-1972-4
BRIEF REPORT
Detection and characterization of porcine bocavirus in the United States Jinhai Huang • Sunil K. Mor • Jonathan Erber Elyce Voss • Sagar M. Goyal
•
Received: 17 September 2013 / Accepted: 29 December 2013 Ó Springer-Verlag Wien 2014
Abstract We screened pigs (n = 203) presenting with respiratory illness or diarrhea for porcine bocavirus (PBoV); 88 (43.30 %) were positive by PCR. More positives were seen in diarrhea cases (48.7 %) than in respiratory cases (29.1 %). Based on phylogenetic analysis of 540 nucleotides of the NS1 gene, the viruses could be divided into four possible groups. Group IV sequences did not match any GenBank sequences, while groups I, II and III gave matches with PBoV3, PBoV4 and PBoV5, respectively. The wide range (70 % to 100 %) of nucleotide (nt) sequence identity among strains in this study indicates high genetic diversity among porcine bocaviruses. Keywords analysis
Porcine bocavirus Diarrhea Phylogenetic
The genus Bocavirus, family Parvoviridae, subfamily Parvovirinae, includes five members: bovine parvovirus (BPV), canine minute virus (CnMV), human bocavirus (HBoV), gorilla bocavirus (GBoV), and California sea lion virus (CslBoV) [4, 7]. These non-enveloped viruses have a diameter of 26 nm and contain a linear, single-stranded DNA genome of 5-6 kb of either plus or minus polarity. There are three open reading frames (ORFs) encoding two
J. Huang S. K. Mor J. Erber E. Voss S. M. Goyal (&) Department of Veterinary Population Medicine and Minnesota Veterinary Diagnostic Laboratory, University of Minnesota, 1333 Gortner Ave, St. Paul, MN 55108, USA e-mail: [email protected] J. Huang Tianjin University, No. 92 Weijin road, Nankai District, Tianjin 300072, China
nonstructural proteins (NS1 and NP1) and two structural proteins (viral capsid proteins VP1 and VP2) [4]. Using random amplification and large-scale sequencing technology, porcine bocaviruses (PBoV) were discovered in Swedish pigs with post-weaning multisystemic wasting syndrome (PMWS) [1]. Since then, a number of different PBoVs have been discovered and characterized in Asia, Europe and the U.S.A. The virus was detected in China in 2010 [12], and its complete genome was sequenced [12, 14]. In the following years, highly divergent PBoVs were discovered. Cheng et al. [2] described the presence of PoBoV1 and PBoV2 in China. Two other bocaviruses, PoBoV3 and PoBoV4, were described in Hong Kong [5]. Recently, PBoV5 from pigs in China was described [6]. Using high-throughput sequencing, Shan et al. [11] identified bocaviruses in healthy (19-30 days) and diarrheic piglets (24-30 days) on a high-density farm (1000 sows) in North Carolina, USA. The present study was undertaken to determine the presence of bocaviruses samples from pigs submitted to the Minnesota Veterinary Diagnostic Laboratory (MVDL) for detecting the cause of diarrhea and respiratory problems. The samples were submitted to MVDL between October 2010 and February 2011. A total of 203 samples were examined: 55 were lung samples of pigs from seven different states, and 148 were fecal samples from 18 states and Mexico and Canada (Table 1). At the MVDL, these samples were examined for the presence of rotavirus, transmissible gastroenteritis virus (TGEV), porcine circovirus type-2b (PCV2b), porcine respiratory and reproductive syndrome virus (PRRSV), and hemagglutinating encephalomyelitis virus (HEV) [9, 10]. In addition, we tested 10 fecal samples each from healthy piglets and healthy gilts from two different Minnesota farms.
123
J. Huang et al. Table 1 Source of samples tested for porcine bocavirus Sample no.
State or country
No. positive/no. tested from the indicated samples Lung
Feces
Table 2 Occurrence of porcine bocavirus with other viruses Total positive/ total tested
1
Arizona
0/1
0/1
0/2
2
Arkansas
2/4
3/8
5/13
3 4
Colorado Illinois
0/0 2/4
3/10 7/8
3/10 9/12
5
Iowa
1/2
5/6
6/8
6
Kansas
0/0
0/1
7
Minnesota
9/41
21/42
8
Missouri
0/0
3/7
9
Michigan
0/0
0/1
0/1
10
Nebraska
0/0
4/5
4/5
11
North Carolina
0/0
3/5
3/5
12
Ohio
0/0
0/1
0/1
13
Oklahoma
1/2
3/20
4/22
14 15
Pennsylvania South Dakota
0/0 0/0
1/1 2/2
1/1 2/2
16
Tennessee
1/1
5/6
6/7
17
Virginia
0/0
0/1
0/1
18
Wisconsin
0/0
0/1
0/1
19
Canada
0/0
4/9
4/9
20
Mexico
0/0
8/13
8/13
16/55 (29.1 %)
72/148 (48.6 %)
88/203
Total
No. (%) positive in lungs
No. (%) positive in feces
Porcine bocavirus alone
0
4 (5.5)
Porcine bocavirus ? porcine astrovirus
0
7 (9.7)
Porcine bocavirus ? porcine circovirus Porcine bocavirus ? enteric viruses*
0 0
5 (7.0) 41 (57.0)
Porcine bocavirus ? rotavirus
3 (18.8)
15 (20.8)
0/1
Porcine bocavirus ? hemagglutinating encephalomyelitis virus
2 (12.5)
0
30/83
Porcine bocavirus ? PRRSV
2 (12.5)
0
3/7
Porcine bocavirus ? respiratory viruses**
9 (56.3)
0
DNA was extracted from all samples using a DNeasy Blood and Tissue Kit (QIAGEN, Valencia, CA). Extracted DNA was subjected to PCR using self-designed specific primers for partial amplification of the NS gene: BoVNS1F (50 ACAGGCAGCCGATCACTCACTAT 30 ) and BoV-NS1R (50 CTCGTTCCTCCCATCAGACACTT-30 ). A HotStar Taq Master Mix Kit (QIAGEN, Valencia, CA) was used for PCR, and the reaction mixture consisted of 12.5 ll of master mix, 0.6 lM primer, 100 ng of template, and nuclease-free water to make a total volume of 25 ll. The amplification reaction consisted of initial denaturation at 94 °C for 15 min, 35 cycles of denaturation at 94 °C for 30 s, annealing at 52 °C for 30 s, and extension at 72 °C for 45 s, and final extension at 72 °C for 10 min. PCR products were separated by electrophoresis on a 1.2 % agarose gel, and the presence of a band at the position corresponding to 780 bp confirmed the presence of PBoV. PCR products from a representative set of samples (n = 38) were purified by treating the amplified PCR products with ExoSAP-IT (USB). PCR product (5 ll) was mixed with 2 ll of ExoSAP-IT, incubated at 37 °C for 30 min, followed by inactivation of ExoSAP-IT at 80 °C
123
Virus
* Two or more enteric viruses (astro-, rota, HEV, PCV, TGE) were present in association with porcine bocavirus ** Two or more respiratory viruses (HEV, SIV, PCV, rota-, PRRSV) were present in association with porcine bocavirus
for 10 min. Purified products were submitted for sequencing to the University of Minnesota Genomics Center (UMGC). Forward and reverse sequences were aligned together using Sequencher 5.1 software (www. genecodes.com) followed by BLAST analysis (www.ncbi. nlm.nih.gov). The nucleotide sequences thus obtained were then aligned by the Clustal W method using MEGA 5.0 software. A phylogenetic tree of aligned sequences was constructed by the neighbor-joining and maximum-likelihood methods with the Kimura 2-parameter model using 1000 bootstrap replicate values. Of the 203 samples tested, 88 (43.3%) were positive for PBoV by PCR (Table 1). The virus was detected at a higher rate from feces (48.6 %) than from lungs (29.1 %). In respiratory cases, bocavirus was always present as a mixed infection with other viruses, e.g., rotavirus (18.7 %), HEV (12.5 %), and PRRSV (12.5 %). In 56.3 % of positive lungs, bocavirus was present as a mixed infection with more than two viruses (Table 2). In cases of diarrhea, 57 % of bocavirus-positive samples had mixed infections with PCV, porcine astrovirus, or porcine rotavirus. Seven of ten and six of ten samples were positive from healthy piglets and gilts, respectively. A representative number of samples (n = 38) were purified for sequencing; two were lung samples and 31 were intestinal contents from cases of illness. The remaining five samples were from healthy pigs. BLAST analysis of sequences confirmed them to be PBoV. All sequences have been submitted to GenBank under accession numbers KC514531-KC514561. The GenBank accession numbers for sequences from lung as well as sequences from healthy piglets and gilts are KF278661-KF278667. We compared bocavirus sequences of this study with published sequences of other bocaviruses. Phylogenetic
Bocavirus in swine
analysis was based on 540 nucleotides (position 753-1257 of the reference sequence JF713715) of the NS1 gene. The tree topology was the same in both neighbor-joining and maximum-likelihood analysis. Based on sequence alignment and phylogenic tree, all sequences were divided into four possible groups (groups I, II, III and IV). Group I included 18 sequences (15 intestinal, 2 lung and 1 healthy gilt), which had 90 % to 96 % nt sequence identity to published PBoV3 sequences from China (JX944666, NC_016031) and the USA (JF713715). Group II included
two sequences (one intestinal and one healthy piglet) that gave a match with PBoV 4 (JF512473). Group III had four sequences (three intestinal and one healthy piglet), which gave match with PBoV5 (JN621325, NC_016647) (Fig. 1). Group IV had 14 sequences (12 intestinal and one each from healthy gilt and piglet) that did not match any reference GenBank sequences. Group I sequences had 89 % to 100 % nt sequence identity to each other but only 76.4-80 %, 77 %-79.5 % and 75-80 % nt sequence identity with groups II, III, and
Fig. 1 Phylogenetic analysis based on 540 nucleotides (from nucleotide position 753 to 1257 of reference sequence JF713715) of the NS1 gene of bocavirus. The phylogenetic tree was constructed by the neighbor-joining method with the Kimura 2-parameter model and 1000 bootstrap replicates
123
J. Huang et al.
IV, respectively. Group II sequences had 91.7 % to 95 % nt sequence identity within the group and 79 % to 82 % nt sequence identity with group III sequences. Group III sequences had 92 % to 96 % nt sequence identity within the group. Group IV sequences had 87 % to 95.6 % nt sequence identity within the group while 71 % to 77 % and 72 % to 88 % nt sequence identity with group II and group III, respectively. Comparison between healthy and affected cases showed no distinction between the two, indicating that they are closely related. Based on the existing criteria for bocavirus classification by the International Committee on Taxonomy of Viruses (http://www.ictvdb.org), isolates belong to separate species if they have \95 % identity in the nonstructural gene DNA sequence [4]. In this study, all sequences had 90 % to 100 % nt sequence identity within their respective group, but because only partial sequences were determined, the existing criteria could not be applied here. The group IV sequences did not align with existing GenBank sequences of bocavirus and had limited identity (71 % to 88 %) to other sequences in this study. Complete genome sequencing of these strains should yield a clearer picture of these bocaviruses. One of the important findings of this study is that all of the sequences formed separate lineages from PBoV1 and PBoV2, which are considered to be closely related to HBoVs [14]. Recombination may play an important role in the generation of new genotypes, as parvoviruses are known to undergo genetic rearrangement and recombination similar to RNA viruses [3, 5, 14]. For example, canine parvoviruses have a mean substitution rate of *1 9 10-4 substitutions nt-1 year-1, which is similar to that of RNA viruses [3]. Hence, there is great need for continuous surveillance to rule out any possibility of emergence of novel bocaviruses of zoonotic importance. Bocaviruses have gained attention following reports of the involvement of human bocaviruses (HBoVs) in respiratory illness and diarrhea. Recently discovered bocaviruses from primates and pigs are closely related to HBoVs, leading to the hypothesis that HBoV could be of zoonotic origin [8, 13]. Thus, it is important to study emerging and reemerging pathogens of swine, and this preliminary study was conducted to determine the prevalence of porcine bocaviruses in the US swine population. The overall rate of bocavirus positivity in this study was higher than that reported by Lau et al. [5]. They reported 16.5 % of samples from healthy, sick, and deceased pigs to be bocavirus positive. In our study, 5.5 % of the diarrhea cases that tested negative for common gastrointestinal viruses were found to contain bocavirus, indicating that this virus should be considered a probable cause of diarrhea in pigs. In both respiratory and diarrhea cases, a large number of samples were positive as mixed infection (56.3 % and
123
57 %, respectively). This finding is in line with a study by Zhang et al. [13], who also found a significantly higher rate of mixed infections in diarrheal pigs than in healthy pigs in China. Blomstro¨m et al. [1] reported a high prevalence of bocavirus in pigs with PMWS when compared to nonPMWS pigs in Sweden. They detected bocavirus along with PCV-2 and porcine torque teno virus (PTTV-1, PTTV-2) and suggested that synergistic effects of these viruses may be responsible for the clinical manifestation of PMWS. Zhai et al. [12] studied 191 pigs with respiratory and reproductive problems on 31 farms in China and reported a higher prevalence of PCV2, PRRSV, PTTV and classical swine fever virus (CSFV) in bocavirus-positive samples than in bocavirus-negative samples. They believed that bocavirus present in healthy pigs may cause clinical disease in the presence of bad management and/or infection with other viruses. These studies indicate the importance of bocavirus in pig diseases, either alone or with other viruses, and also emphasize the need to study them further. Acknowledgments We thank Montserrat Torremorell for providing samples from healthy farms.
References 1. Blomstrom AL, Belak S, Fossum C, Fuxler L, Wallgren P, Berg M (2010) Studies of porcine circovirus type 2, porcine boca-like virus and torque teno virus indicate the presence of multiple viral infections in postweaning multisystemic wasting syndrome pigs. Virus Res 152:59–64 2. Cheng WX, Li JS, Huang CP, Yao DP, Liu N, Cui SX, Jin Y, Duan ZJ (2010) Identification and nearly full-length genome characterization of novel porcine bocaviruses. PLoS One 5:e13583 3. Hoelzer K, Shackelton LA, Holmes EC, Parrish CR (2008) Within-host genetic diversity of endemic and emerging parvoviruses of dogs and cats. J Virol 82:11096–11105 4. King AMQ, Lefkowiz E, Adams M, Carstens E (2012) Virus taxonomy: ninth report of the international committee on taxonomy of viruses. Parvovirdae. Academic Press, Waltham, pp 405–425 5. Lau SK, Woo PC, Yip CC, Li KS, Fu CT, Huang Y, Chan KH, Yuen KY (2011) Co-existence of multiple strains of two novel porcine bocaviruses in the same pig, a previously undescribed phenomenon in members of the family Parvoviridae, and evidence for inter- and intra-host genetic diversity and recombination. J Gen Virol 92:2047–2059 6. Li B, Ma J, Xiao S, Fang L, Zeng S, Wen L, Zhang X, Ni Y, Guo R, Yu Z, Zhou J, Mao A, Lv L, Wang X, He K (2012) Complete genome sequence of a novel species of porcine bocavirus, PBoV5. J Virol 86:1286–1287 7. Li L, Shan T, Wang C, Cote C, Kolman J, Onions D, Gulland FM, Delwart E (2011) The fecal viral flora of California sea lions. J Virol 85:9909–9917 8. Malecki M, Schildgen V, Schildgen O (2011) Human bocavirus: still more questions than answers. Future Virol 6:1107–1114 9. Marthaler D, Rossow K, Gramer M, Collins J, Goyal S, Tsunemitsu H, Kuga K, Suzuki T, Ciarlet M, Matthijnssens J (2012) Detection of substantial porcine group B rotavirus genetic
Bocavirus in swine diversity in the United States, resulting in a modified classification proposal for G genotypes. Virology 433:85–96 10. Mor SK, Chander Y, Marthaler D, Patnayak DP, Goyal SM (2012) Detection and molecular characterization of porcine astrovirus strains associated with swine diarrhea. J Vet Diagn Invest 24:1064–1067 11. Shan T, Li L, Simmonds P, Wang C, Moeser A, Delwart E (2011) The fecal virome of pigs on a high-density farm. J Virol 85:11697–11708 12. Zhai S, Yue C, Wei Z, Long J, Ran D, Lin T, Deng Y, Huang L, Sun L, Zheng H, Gao F, Chen S, Yuan S (2010) High prevalence
of a novel porcine bocavirus in weanling piglets with respiratory tract symptoms in China. Arch Virol 155:1313–1317 13. Zhang Q, Hu R, Tang X, Wu C, He Q, Zhao Z, Chen H, Wu B (2013) Occurrence and investigation of enteric viral infections in pigs with diarrhea in China. Arch Virol 158:1631–1636 14. Zeng S, Wang D, Fang L, Ma J, Song T, Zhang R, Chen H, Xiao S (2011) Complete coding sequences and phylogenetic analysis of porcine bocavirus. J Gen Virol 92:784–788
123
BRIEF REPORT
Detection and characterization of porcine bocavirus in the United States Jinhai Huang • Sunil K. Mor • Jonathan Erber Elyce Voss • Sagar M. Goyal
•
Received: 17 September 2013 / Accepted: 29 December 2013 Ó Springer-Verlag Wien 2014
Abstract We screened pigs (n = 203) presenting with respiratory illness or diarrhea for porcine bocavirus (PBoV); 88 (43.30 %) were positive by PCR. More positives were seen in diarrhea cases (48.7 %) than in respiratory cases (29.1 %). Based on phylogenetic analysis of 540 nucleotides of the NS1 gene, the viruses could be divided into four possible groups. Group IV sequences did not match any GenBank sequences, while groups I, II and III gave matches with PBoV3, PBoV4 and PBoV5, respectively. The wide range (70 % to 100 %) of nucleotide (nt) sequence identity among strains in this study indicates high genetic diversity among porcine bocaviruses. Keywords analysis
Porcine bocavirus Diarrhea Phylogenetic
The genus Bocavirus, family Parvoviridae, subfamily Parvovirinae, includes five members: bovine parvovirus (BPV), canine minute virus (CnMV), human bocavirus (HBoV), gorilla bocavirus (GBoV), and California sea lion virus (CslBoV) [4, 7]. These non-enveloped viruses have a diameter of 26 nm and contain a linear, single-stranded DNA genome of 5-6 kb of either plus or minus polarity. There are three open reading frames (ORFs) encoding two
J. Huang S. K. Mor J. Erber E. Voss S. M. Goyal (&) Department of Veterinary Population Medicine and Minnesota Veterinary Diagnostic Laboratory, University of Minnesota, 1333 Gortner Ave, St. Paul, MN 55108, USA e-mail: [email protected] J. Huang Tianjin University, No. 92 Weijin road, Nankai District, Tianjin 300072, China
nonstructural proteins (NS1 and NP1) and two structural proteins (viral capsid proteins VP1 and VP2) [4]. Using random amplification and large-scale sequencing technology, porcine bocaviruses (PBoV) were discovered in Swedish pigs with post-weaning multisystemic wasting syndrome (PMWS) [1]. Since then, a number of different PBoVs have been discovered and characterized in Asia, Europe and the U.S.A. The virus was detected in China in 2010 [12], and its complete genome was sequenced [12, 14]. In the following years, highly divergent PBoVs were discovered. Cheng et al. [2] described the presence of PoBoV1 and PBoV2 in China. Two other bocaviruses, PoBoV3 and PoBoV4, were described in Hong Kong [5]. Recently, PBoV5 from pigs in China was described [6]. Using high-throughput sequencing, Shan et al. [11] identified bocaviruses in healthy (19-30 days) and diarrheic piglets (24-30 days) on a high-density farm (1000 sows) in North Carolina, USA. The present study was undertaken to determine the presence of bocaviruses samples from pigs submitted to the Minnesota Veterinary Diagnostic Laboratory (MVDL) for detecting the cause of diarrhea and respiratory problems. The samples were submitted to MVDL between October 2010 and February 2011. A total of 203 samples were examined: 55 were lung samples of pigs from seven different states, and 148 were fecal samples from 18 states and Mexico and Canada (Table 1). At the MVDL, these samples were examined for the presence of rotavirus, transmissible gastroenteritis virus (TGEV), porcine circovirus type-2b (PCV2b), porcine respiratory and reproductive syndrome virus (PRRSV), and hemagglutinating encephalomyelitis virus (HEV) [9, 10]. In addition, we tested 10 fecal samples each from healthy piglets and healthy gilts from two different Minnesota farms.
123
J. Huang et al. Table 1 Source of samples tested for porcine bocavirus Sample no.
State or country
No. positive/no. tested from the indicated samples Lung
Feces
Table 2 Occurrence of porcine bocavirus with other viruses Total positive/ total tested
1
Arizona
0/1
0/1
0/2
2
Arkansas
2/4
3/8
5/13
3 4
Colorado Illinois
0/0 2/4
3/10 7/8
3/10 9/12
5
Iowa
1/2
5/6
6/8
6
Kansas
0/0
0/1
7
Minnesota
9/41
21/42
8
Missouri
0/0
3/7
9
Michigan
0/0
0/1
0/1
10
Nebraska
0/0
4/5
4/5
11
North Carolina
0/0
3/5
3/5
12
Ohio
0/0
0/1
0/1
13
Oklahoma
1/2
3/20
4/22
14 15
Pennsylvania South Dakota
0/0 0/0
1/1 2/2
1/1 2/2
16
Tennessee
1/1
5/6
6/7
17
Virginia
0/0
0/1
0/1
18
Wisconsin
0/0
0/1
0/1
19
Canada
0/0
4/9
4/9
20
Mexico
0/0
8/13
8/13
16/55 (29.1 %)
72/148 (48.6 %)
88/203
Total
No. (%) positive in lungs
No. (%) positive in feces
Porcine bocavirus alone
0
4 (5.5)
Porcine bocavirus ? porcine astrovirus
0
7 (9.7)
Porcine bocavirus ? porcine circovirus Porcine bocavirus ? enteric viruses*
0 0
5 (7.0) 41 (57.0)
Porcine bocavirus ? rotavirus
3 (18.8)
15 (20.8)
0/1
Porcine bocavirus ? hemagglutinating encephalomyelitis virus
2 (12.5)
0
30/83
Porcine bocavirus ? PRRSV
2 (12.5)
0
3/7
Porcine bocavirus ? respiratory viruses**
9 (56.3)
0
DNA was extracted from all samples using a DNeasy Blood and Tissue Kit (QIAGEN, Valencia, CA). Extracted DNA was subjected to PCR using self-designed specific primers for partial amplification of the NS gene: BoVNS1F (50 ACAGGCAGCCGATCACTCACTAT 30 ) and BoV-NS1R (50 CTCGTTCCTCCCATCAGACACTT-30 ). A HotStar Taq Master Mix Kit (QIAGEN, Valencia, CA) was used for PCR, and the reaction mixture consisted of 12.5 ll of master mix, 0.6 lM primer, 100 ng of template, and nuclease-free water to make a total volume of 25 ll. The amplification reaction consisted of initial denaturation at 94 °C for 15 min, 35 cycles of denaturation at 94 °C for 30 s, annealing at 52 °C for 30 s, and extension at 72 °C for 45 s, and final extension at 72 °C for 10 min. PCR products were separated by electrophoresis on a 1.2 % agarose gel, and the presence of a band at the position corresponding to 780 bp confirmed the presence of PBoV. PCR products from a representative set of samples (n = 38) were purified by treating the amplified PCR products with ExoSAP-IT (USB). PCR product (5 ll) was mixed with 2 ll of ExoSAP-IT, incubated at 37 °C for 30 min, followed by inactivation of ExoSAP-IT at 80 °C
123
Virus
* Two or more enteric viruses (astro-, rota, HEV, PCV, TGE) were present in association with porcine bocavirus ** Two or more respiratory viruses (HEV, SIV, PCV, rota-, PRRSV) were present in association with porcine bocavirus
for 10 min. Purified products were submitted for sequencing to the University of Minnesota Genomics Center (UMGC). Forward and reverse sequences were aligned together using Sequencher 5.1 software (www. genecodes.com) followed by BLAST analysis (www.ncbi. nlm.nih.gov). The nucleotide sequences thus obtained were then aligned by the Clustal W method using MEGA 5.0 software. A phylogenetic tree of aligned sequences was constructed by the neighbor-joining and maximum-likelihood methods with the Kimura 2-parameter model using 1000 bootstrap replicate values. Of the 203 samples tested, 88 (43.3%) were positive for PBoV by PCR (Table 1). The virus was detected at a higher rate from feces (48.6 %) than from lungs (29.1 %). In respiratory cases, bocavirus was always present as a mixed infection with other viruses, e.g., rotavirus (18.7 %), HEV (12.5 %), and PRRSV (12.5 %). In 56.3 % of positive lungs, bocavirus was present as a mixed infection with more than two viruses (Table 2). In cases of diarrhea, 57 % of bocavirus-positive samples had mixed infections with PCV, porcine astrovirus, or porcine rotavirus. Seven of ten and six of ten samples were positive from healthy piglets and gilts, respectively. A representative number of samples (n = 38) were purified for sequencing; two were lung samples and 31 were intestinal contents from cases of illness. The remaining five samples were from healthy pigs. BLAST analysis of sequences confirmed them to be PBoV. All sequences have been submitted to GenBank under accession numbers KC514531-KC514561. The GenBank accession numbers for sequences from lung as well as sequences from healthy piglets and gilts are KF278661-KF278667. We compared bocavirus sequences of this study with published sequences of other bocaviruses. Phylogenetic
Bocavirus in swine
analysis was based on 540 nucleotides (position 753-1257 of the reference sequence JF713715) of the NS1 gene. The tree topology was the same in both neighbor-joining and maximum-likelihood analysis. Based on sequence alignment and phylogenic tree, all sequences were divided into four possible groups (groups I, II, III and IV). Group I included 18 sequences (15 intestinal, 2 lung and 1 healthy gilt), which had 90 % to 96 % nt sequence identity to published PBoV3 sequences from China (JX944666, NC_016031) and the USA (JF713715). Group II included
two sequences (one intestinal and one healthy piglet) that gave a match with PBoV 4 (JF512473). Group III had four sequences (three intestinal and one healthy piglet), which gave match with PBoV5 (JN621325, NC_016647) (Fig. 1). Group IV had 14 sequences (12 intestinal and one each from healthy gilt and piglet) that did not match any reference GenBank sequences. Group I sequences had 89 % to 100 % nt sequence identity to each other but only 76.4-80 %, 77 %-79.5 % and 75-80 % nt sequence identity with groups II, III, and
Fig. 1 Phylogenetic analysis based on 540 nucleotides (from nucleotide position 753 to 1257 of reference sequence JF713715) of the NS1 gene of bocavirus. The phylogenetic tree was constructed by the neighbor-joining method with the Kimura 2-parameter model and 1000 bootstrap replicates
123
J. Huang et al.
IV, respectively. Group II sequences had 91.7 % to 95 % nt sequence identity within the group and 79 % to 82 % nt sequence identity with group III sequences. Group III sequences had 92 % to 96 % nt sequence identity within the group. Group IV sequences had 87 % to 95.6 % nt sequence identity within the group while 71 % to 77 % and 72 % to 88 % nt sequence identity with group II and group III, respectively. Comparison between healthy and affected cases showed no distinction between the two, indicating that they are closely related. Based on the existing criteria for bocavirus classification by the International Committee on Taxonomy of Viruses (http://www.ictvdb.org), isolates belong to separate species if they have \95 % identity in the nonstructural gene DNA sequence [4]. In this study, all sequences had 90 % to 100 % nt sequence identity within their respective group, but because only partial sequences were determined, the existing criteria could not be applied here. The group IV sequences did not align with existing GenBank sequences of bocavirus and had limited identity (71 % to 88 %) to other sequences in this study. Complete genome sequencing of these strains should yield a clearer picture of these bocaviruses. One of the important findings of this study is that all of the sequences formed separate lineages from PBoV1 and PBoV2, which are considered to be closely related to HBoVs [14]. Recombination may play an important role in the generation of new genotypes, as parvoviruses are known to undergo genetic rearrangement and recombination similar to RNA viruses [3, 5, 14]. For example, canine parvoviruses have a mean substitution rate of *1 9 10-4 substitutions nt-1 year-1, which is similar to that of RNA viruses [3]. Hence, there is great need for continuous surveillance to rule out any possibility of emergence of novel bocaviruses of zoonotic importance. Bocaviruses have gained attention following reports of the involvement of human bocaviruses (HBoVs) in respiratory illness and diarrhea. Recently discovered bocaviruses from primates and pigs are closely related to HBoVs, leading to the hypothesis that HBoV could be of zoonotic origin [8, 13]. Thus, it is important to study emerging and reemerging pathogens of swine, and this preliminary study was conducted to determine the prevalence of porcine bocaviruses in the US swine population. The overall rate of bocavirus positivity in this study was higher than that reported by Lau et al. [5]. They reported 16.5 % of samples from healthy, sick, and deceased pigs to be bocavirus positive. In our study, 5.5 % of the diarrhea cases that tested negative for common gastrointestinal viruses were found to contain bocavirus, indicating that this virus should be considered a probable cause of diarrhea in pigs. In both respiratory and diarrhea cases, a large number of samples were positive as mixed infection (56.3 % and
123
57 %, respectively). This finding is in line with a study by Zhang et al. [13], who also found a significantly higher rate of mixed infections in diarrheal pigs than in healthy pigs in China. Blomstro¨m et al. [1] reported a high prevalence of bocavirus in pigs with PMWS when compared to nonPMWS pigs in Sweden. They detected bocavirus along with PCV-2 and porcine torque teno virus (PTTV-1, PTTV-2) and suggested that synergistic effects of these viruses may be responsible for the clinical manifestation of PMWS. Zhai et al. [12] studied 191 pigs with respiratory and reproductive problems on 31 farms in China and reported a higher prevalence of PCV2, PRRSV, PTTV and classical swine fever virus (CSFV) in bocavirus-positive samples than in bocavirus-negative samples. They believed that bocavirus present in healthy pigs may cause clinical disease in the presence of bad management and/or infection with other viruses. These studies indicate the importance of bocavirus in pig diseases, either alone or with other viruses, and also emphasize the need to study them further. Acknowledgments We thank Montserrat Torremorell for providing samples from healthy farms.
References 1. Blomstrom AL, Belak S, Fossum C, Fuxler L, Wallgren P, Berg M (2010) Studies of porcine circovirus type 2, porcine boca-like virus and torque teno virus indicate the presence of multiple viral infections in postweaning multisystemic wasting syndrome pigs. Virus Res 152:59–64 2. Cheng WX, Li JS, Huang CP, Yao DP, Liu N, Cui SX, Jin Y, Duan ZJ (2010) Identification and nearly full-length genome characterization of novel porcine bocaviruses. PLoS One 5:e13583 3. Hoelzer K, Shackelton LA, Holmes EC, Parrish CR (2008) Within-host genetic diversity of endemic and emerging parvoviruses of dogs and cats. J Virol 82:11096–11105 4. King AMQ, Lefkowiz E, Adams M, Carstens E (2012) Virus taxonomy: ninth report of the international committee on taxonomy of viruses. Parvovirdae. Academic Press, Waltham, pp 405–425 5. Lau SK, Woo PC, Yip CC, Li KS, Fu CT, Huang Y, Chan KH, Yuen KY (2011) Co-existence of multiple strains of two novel porcine bocaviruses in the same pig, a previously undescribed phenomenon in members of the family Parvoviridae, and evidence for inter- and intra-host genetic diversity and recombination. J Gen Virol 92:2047–2059 6. Li B, Ma J, Xiao S, Fang L, Zeng S, Wen L, Zhang X, Ni Y, Guo R, Yu Z, Zhou J, Mao A, Lv L, Wang X, He K (2012) Complete genome sequence of a novel species of porcine bocavirus, PBoV5. J Virol 86:1286–1287 7. Li L, Shan T, Wang C, Cote C, Kolman J, Onions D, Gulland FM, Delwart E (2011) The fecal viral flora of California sea lions. J Virol 85:9909–9917 8. Malecki M, Schildgen V, Schildgen O (2011) Human bocavirus: still more questions than answers. Future Virol 6:1107–1114 9. Marthaler D, Rossow K, Gramer M, Collins J, Goyal S, Tsunemitsu H, Kuga K, Suzuki T, Ciarlet M, Matthijnssens J (2012) Detection of substantial porcine group B rotavirus genetic
Bocavirus in swine diversity in the United States, resulting in a modified classification proposal for G genotypes. Virology 433:85–96 10. Mor SK, Chander Y, Marthaler D, Patnayak DP, Goyal SM (2012) Detection and molecular characterization of porcine astrovirus strains associated with swine diarrhea. J Vet Diagn Invest 24:1064–1067 11. Shan T, Li L, Simmonds P, Wang C, Moeser A, Delwart E (2011) The fecal virome of pigs on a high-density farm. J Virol 85:11697–11708 12. Zhai S, Yue C, Wei Z, Long J, Ran D, Lin T, Deng Y, Huang L, Sun L, Zheng H, Gao F, Chen S, Yuan S (2010) High prevalence
of a novel porcine bocavirus in weanling piglets with respiratory tract symptoms in China. Arch Virol 155:1313–1317 13. Zhang Q, Hu R, Tang X, Wu C, He Q, Zhao Z, Chen H, Wu B (2013) Occurrence and investigation of enteric viral infections in pigs with diarrhea in China. Arch Virol 158:1631–1636 14. Zeng S, Wang D, Fang L, Ma J, Song T, Zhang R, Chen H, Xiao S (2011) Complete coding sequences and phylogenetic analysis of porcine bocavirus. J Gen Virol 92:784–788
123
