A novel wheat bZIP transcription factor, TabZIP60, confers multiple abiotic stress tolerances in transgenic Arabidopsis.

A novel wheat bZIP transcription factor, TabZIP60, confers multiple abiotic stress tolerances in transgenic Arabidopsis

Lina Zhang, Lichao Zhang, Chuan Xia, Guangyao Zhao, Ji Liu, Jizeng Jia and Xiuying Kong*

Key Laboratory of Crop Gene Resources and Germplasm Enhancement, Ministry of Agriculture, The National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing 100081, China *Corresponding author, e-mail: [email protected] The basic region/leucine zipper (bZIP) transcription factors (TFs) play vital roles in the response to abiotic stress. However, little is known about the function of bZIP genes in wheat abiotic stress. In this study, we report the isolation and functional characterization of the TabZIP60 gene. Three homologous genome sequences of TabZIP60 were isolated from hexaploid wheat and mapped to the wheat homoeologous group 6. A subcellular localization analysis indicated that TabZIP60 is a nuclear-localized protein that activates transcription. Furthermore, TabZIP60 gene transcripts were strongly induced by polyethylene glycol (PEG), salt, cold and exogenous abscisic acid (ABA) treatments. Further analysis showed that the overexpression of TabZIP60 in Arabidopsis resulted in significantly improved tolerances to drought, salt, freezing stresses and increased plant sensitivity to ABA in seedling growth. Meanwhile, the TabZIP60 was capable of binding ABA-responsive cis-elements (ABREs) that are present in promoters of many known ABA-responsive genes. A subsequent analysis showed that the overexpression of TabZIP60 led to enhanced expression levels of some stress-responsive genes and changes in several physiological parameters. Taken together, these results suggest that TabZIP60 enhance multiple abiotic stresses through the ABA signaling pathway and that modifications of its expression may improve multiple stress tolerances in crop plants.

This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1111/ppl.12261 This article is protected by copyright. All rights reserved

Abbreviations – ABA, abscisic acid; ABF, ABA-responsive element binding factor; ABREs, ABA-responsive cis-elements; AREB, ABA responsive element binding protein; bZIP, basic region/leucine zipper; CS, Chinese Spring; DREB2A, dehydration responsive element binding protein2A; GFP, green fluorescent protein; LIP, low-temperature-induced protein; NPR, non-expressor of pathogenesis-related gene; NT, nulli-tetrasomic; ORF, open reading frame; OsABF, Oryza sativa ABA-responsive element binding factor; OsABI5, O. sativa ABA INSENSITIVE 5; PEG, polyethylene glycol; PKABA, ABA-induced protein kinase; PR, pathogenesis-related; SLAREB, Solanum lycopersicum ABA-responsive element binding protein; TaOBF, Triticum aestivum octopine synthase gene enhancer binding factor; TBA, thiobarbituric acid; TCA, trichloracetic acid; TFs, transcription factors; WT , wild-type.

Introduction Plants often encounter unfavorable environmental factors, such as drought, high salt and extreme temperature. These adverse stresses can limit plant growth, development and crop productivity. To respond and adapt to these unfavorable conditions, plants have evolved various mechanisms at the morphological, cellular, physiological and biochemical levels to survive under various harsh environmental factors (Zhu 2002, Hirayama and Shinozaki 2010, Krasensky and Jonak 2012). The changes in gene expression play important roles in these processes. Stress-inducible genes consist of genes that are involved in direct protection from injury and genes that encode regulatory proteins such as phosphatases, protein kinases and transcription factors. These regulatory proteins are involved in signal perception, signal transduction and the transcriptional regulation of gene expression (Kreps et al. 2002, Seki et al. 2002). As a trigger of gene expression, transcription factors (TFs) bind to specific cis-elements in the promoters of stress-responsive genes to regulate their transcription and thus improve stress tolerance (Riechmann and Ratcliffe 2000, Chen and Zhu 2004, Chinnusamy et al. 2007). According to their conserved DNA-binding structural domain, TFs can be classified into different families in plants (Warren 2002, Yilmaz et al. 2009, Wang et al. 2011). Among these families, the basic leucine zipper (bZIP) transcription factor family is one of the largest and most diverse families. bZIP transcription factors harbor a highly conserved bZIP domain, which is composed of a basic region and a leucine

This article is protected by copyright. All rights reserved

zipper (Hurst. 1994, Jakoby et al. 2002). The highly conserved basic region consists of approximate 16 amino acid residues with an invariant N-x7-R/K motif containing a nuclear localization signal and DNA binding, whereas the leucine zipper is less conserved and forms an amphipathic helix consisting of heptad repeats of leucine or other bulky hydrophobic amino acids (Ile, Val, Phe, or Met) (Landschulz et al. 1988, Ellenberger et al. 1992). Previous studies have suggested that plant bZIP proteins bind to DNA sequences with an ACGT core cis-element, especially ABRE, G-box (CACGTG), C-box (GACGTC) and A-box (TACGTA) (Izawa et al. 1993, Foster et al. 1994). In plants, a large amount of data show that bZIP TFs participate in various biological processes, including organ formation and development (Walsh et al. 1998, Chuang et al. 1999, Abe et al. 2005, Silveira et al. 2007, Shen et al. 2007), the regulation of seed gene expression (Yamamoto et al. 2006, Alonso et al. 2009), the unfolded protein response (Takahashi et al. 2012, Kondo et al. 2011, Iwata and Koizumi. 2005), photomorphogenesis and light signaling (Gangappa et al. 2013, Prasad et al. 2012), and hormone and sugar signaling ( Kang et al. 2010, Li et al. 2011, Thalor et al. 2012). In addition, accumulated data show that bZIP TFs are involved in the response to biotic/abiotic stresses and signaling, such as pathogen defense, drought, salt and cold stress. In Arabidopsis, the TGACA motif-binding factor (TGA) family of bZIP TFs are considered as important regulators in activating plant defense response through interaction with the a non-expressor of pathogenesis-related gene (NPR) protein, which is a key component in pathogenesis-related (PR) induction (Despres et al. 2000, Zhou et al. 2000 ). The bZIP-type ABA responsive element binding protein (AREB)/ABA-responsive element binding factor (ABF) TFs AREB1, AREB2, and ABF3 cooperatively regulate the ABRE-dependent ABA signaling that is involved in dehydration and salinity stress tolerance (Yoshida et al. 2010, Uno et al. 2000). AtbZIP24 is a significant regulator of the salt stress response (Yang et al. 2009). The group S bZIPs, AtbZIP1 and AtbZIP44, respond to salt or cold stress (Weltmeier et al. 2009). In rice, several members of the bZIP family have been identified for their functions related to abiotic stress. For example, the overexpression of OsbZIP23 and OsbZIP71 significantly improves the tolerance to drought and high-salinity stresses through an ABA-dependent regulation pathway in rice (Xiang et al. 2008, Liu et al. 2014). OsbZIP72 and OsbZIP46 also play a positive role in drought resistance through ABA signaling (Lu et al. 2009, Tang et al. 2012). The low-temperature-induced protein (LIP)19 gene is induced by low temperature and may serve as molecular switch in cold signaling in rice (Shimizu et al. 2005). Oryza sativa ABA-responsive


element binding factor 1 (OsABF1) and O. sativa ABA-responsive element binding factor 2 (OsABF2) are involved in abiotic stress responses and ABA signaling in rice (Hossain et al. 2010a, 2010b). O. sativa ABA INSENSITIVE 5 (OsABI5) may act as a negative regulator in stress tolerance (Zou et al. 2008). To date, only a few bZIP transcription factors have been reported in wheat. The TabZIP1 gene is a biotic and abiotic stress induced gene (Zhang et al. 2009). The wheat WLIP19 and Triticum aestivum octopine synthase gene enhancer binding factor (TaOBF) proteins jointly participate in the low-temperature signaling pathway. The ectopic expression of Wlip19 in transgenic tobacco shows a significant increase in abiotic stress tolerance, especially freezing tolerance (Kobayashi et al. 2008a). Wabi5 also improves tolerance to multiple abiotic stresses in transgenic tobacco plants (Kobayashi et al. 2008b). T. aestivum ABA-responsive element binding factor (TaABF) may function as a physiological substrate for ABA-induced protein kinase (PKABA) 1 in ABA-inducible gene expression in seeds (Johnson et al. 2002). In the present study, a multiple abiotic stress-related gene, TabZIP60, was identified from a full-length wheat cDNA library. Expression profiles indicate that the expression of this gene is induced by PEG, salt, cold and exogenous ABA treatments. Transgenic Arabidopsis plants overexpressing TabZIP60 showed significantly improved tolerances to drought, salt, freezing stresses and elevated plant sensitivity to ABA compared with wild-type (WT) plants. Additionally, there were no significant morphological differences between the transgenic and wild-type Arabidopsis plants. Our results indicate that TabZIP60 has the potential to improve tolerance to abiotic stresses in crop plants.

Materials and methods Plant materials and abiotic stress treatments To isolate the genomic sequences of TabZIP60, wild and cultivated wheat lines of different ploidy levels, including Triticum urartu accession UR206, which was provided by Mr. Reader from John Innes Centre, Norwich, UK; Aegilops tauschii accession Y2282, which was provided by Dr. Mingcheng Luo, UC Davis; and Aegilops speltoides accession Y2006 and Chinese Spring (CS), were selected for the experiments. CS nulli-tetrasomic (NT) lines were used to identify the chromosomal location of the target gene. To study the tissue-specific expression of TabZIP60, spikes, leaves, stems and roots were


obtained from Chinese Spring wheat. Wheat cv. Hanxuan 10 (drought resistance) was selected for the drought treatment, wheat cv. Chadianhong (salt-resistant) was selected for the salt treatment, and Chinese Spring was selected for the low temperature and exogenous abscisic acid (ABA) treatments. Wheat seeds were germinated and cultured with distilled water at 25°C under a 16 h light/8 h dark cycle. Ten-day-old seedlings were treated with 16.1% polyethylene glycol-6000 (PEG, –0.5 MPa ), 250 mM NaCl, and 200 μM ABA, respectively, and the root tissues were sampled at 0, 1, 3, 6, 12, 24 and 48 h. For the cold stress treatment, 10-day-old seedlings were transferred from 25°C to 4°C, and the leaves were collected 0, 1, 3, 6, 12, 24 and 48 h. All of the treated samples were frozen immediately with liquid nitrogen and stored at –80°C for RNA isolation. The Arabidopsis thaliana Columbia-0 was used for the transgenic analysis of TabZIP60.

Cloning and sequence analysis of TabZIP60 members Previous studies generated 10 full-length wheat cDNA libraries in our laboratory. The full-length cDNA sequence of TabZIP60 was obtained by sequencing the cDNA plasmid using the ABI 3730XL 96-capillary DNA analyzer (Applied Biosystems). According to the cDNA sequence of TabZIP60, a pair of primers flanking the open reading frame (ORF) were designed (forward primer: 5’-TCGCCTCGGCTGATTGG-3’, reverse primer: 5’-CGGGCGTCGAAAGTAGTGC-3’) to amplify genomic sequences in UR206 (AA genome), Y2006 (SS genome), Y2282 (DD genome) and CS (ABD genome). The polymerase chain reaction (PCR) products were cloned into the pEASY-T1 clone vector (TransGen) and were sequenced with an ABI 3730XL 96-capillary DNA analyzer (Applied Biosystems).

Construction of a phylogenetic tree of TabZIP60 The amino acid sequences of the three TabZIP60 homologous proteins and abiotic stress-related bZIP TFs from wheat and other plant species were downloaded from the GenBank website. A amino acid sequence similarity analysis was conducted using the MegAlign program in DNASTAR. A sequence alignment was carried out with ClustalW in BioEdit software. The phylogenetic tree was constructed using the neighbor-joining (NJ) method in MEGA 5.1 software (Tamura et al. 2011). Bootstrap analysis was conducted using 1000 replicates in MEGA 5.1. The sequence logo for the bZIP domain was obtained by submitting multiple protein sequences of TabZIP60 and their homologous proteins to


the website (http://meme.nbcr.net/meme/cgi-bin/meme.cgi) (Bailey et al. 1994).

Promoter isolation and cis-acting regulatory elements analysis To isolate the promoter of TabZIP60, the genomic sequence of TabZIP60 was compared with a genome sequence database of Ae. tauschii (DD, D genome donor of species of common wheat) by BLAST to acquire the highest similarity scaffold sequence (Jia et al. 2013). According to the acquired sequence, gene-specific primers covering the promoter and partial coding sequences were designed to amplify the promoter sequences from CS (ABD genome). The cis-acting regulatory elements were predicted using a plant database (http://www.dna.affrc.go.jp/PLACE/).

Chromosomal assignment of the TabZIP60 genes According to the nucleotide sequence polymorphisms in the introns of the TabZIP60 genes, gene-specific

primers

were

designed

as

follows:

TabZIP60-A-F:

5’-TTTACTCTGCGTATTGGACTAC-3’, TabZIP60-A-R: 5’-CATGACATTGACAGGTCGAC-3’; TabZIP60-B-F:

5’-

TACAAGTCTAAATACAGCAAGTGT-3’,

-CTAACGAAATAAAAGAGCACAC-3’; CAAAGGATTAAAGCTAACTTATG-3’,

TabZIP60-B-R:

TabZIP60-D-F:5’ TabZIP60-D-R:

，

5’

，

-

5’-CAGTCTCCAATTCCATCATG-3’.

These primers were employed to distinguish the homologous TabZIP60 genes from different genomes. The templates of the PCR amplifications were genomic DNA samples from CS NT lines and CS. The PCR parameters were as follows: 95°C for 5 min; followed by 32 cycles of 95°C for 30 s, 59°C for 30 s, and 72°C for 40 s, and a final step at 72°C for 5 min. The amplified products were separated using 2% agarose gel electrophoresis.

Subcellular localization of the TabZIP60 protein The full-length coding sequence of TabZIP60 that did not include the stop codon was amplified using gene-specific

primers

with

the

HindIII

(5’-AAGCTTATGGATTTTCCGGGAGGC-3’,

HindIII

and

BamHI site

restriction

sites

underlined;

and

5’-GGATCCCCAAGGGCCCGTCAGCGT-3’, BamHI site underlined) and subcloned into the p163green fluorescent protein (GFP) vector under the control of the cauliflower mosaic virus (CaMV) 35S


promoter to generate the 35S:TabZIP60-GFP fusion construct. The construct was confirmed by restriction analysis followed by sequencing. The 35S:TabZIP60-GFP fusion protein or 35S:GFP alone were separately introduced into wheat protoplasts via the PEG-mediated transformation method using Jen Sheen’s laboratory protocol (Yoo et al. 2007). The transformed wheat protoplasts were incubated at 25°C for 15 h. The signals were observed and photographed using confocal laser scanning microscopy (Zeiss Lsm 700, Germany).

Transaction assay in yeast cells A

pair

of

gene-specific

primers

including

the

attB-sites

(forward

-GGGGACAAGTTTGTACAAAAAAGCAGGCTGCATGGATTTTCCGGGAGGG-3’, primer:

primer:

5’

reverse

5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTTACCAAGGGCCCGTCAGCG-3’,

attB sites underlined) was designed to amplify the full-length coding sequence of TabZIP60, and then the PCR product was cloned into the pDEST32 vector (ProQuestTM Two-Hybrid System with Gateway Technology, Life-Tech, cat. 10835) with the GAL4 DNA-binding domain (BD) and leu2 reporter gene. The construct pDEST32-TabZIP60, negative control pDEST32 vector alone and positive control pGAL4 were transformed individually into the yeast strain AH109 containing the His3 and Ade2 reporter genes with the GAL4-binding elements in the promoter. The positive transformants were confirmed by PCR and plated onto Leu– and Leu– His– Ade–, medium, respectively. The transcriptional activation was identified in the light of their growth status.

Quantitative real-time PCR The total RNA was extracted from wheat or Arabidopsis seedlings using TRIZOL reagent (Invitrogen) following the manufacturer’ instructions. DNaseI treatment was applied to remove the contaminated genomic DNA. The first-strand cDNA was synthesized using 10 μg RNA and SuperScriptTMII reverse transcriptase (Invitrogen). Real time qRT-PCR was performed using the SYBR Premix EX TagTM (Takara, Japan) in a volume of 20 μL on an ABI 7500 RT-PCR system (Applied Biosystems). The PCR parameters were as follows: 95°C for 2 min, 40 cycles of 95°C for 20 s, 55°C for 20 s and 72°C for 30 s. The wheat Tubulin gene (AF251217.1) and Arabidopsis Actin (NM_112764) gene were used as reference genes. All of the qRT-PCR reactions were repeated three times. The relative gene expression level was


calculated using the 2–ΔΔCT method. The primers that were used for the quantitative real-time PCR are listed in Supplementary Table S1.

Generation of the TabZIP60 transgenic Arabidopsis plants The full-length coding sequence of the TabZIP1 cDNA was amplified by PCR using gene-specific primers

containing

attB-sites

(underlined)

(forward

5’GGGGACAAGTTTGTACAAAAAAGCAGGCTGCATGGATTTTCCGGGAGGG-3’, primer:

primer: reverse

5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTTACCAAGGGCCCGTCAGCG-3’).

The PCR product was cloned into the plant expression vector pEarleyGate 100 (Earley et al. 2006) harboring the CaMV 35S promoter. The construct verified by PCR and sequencing was introduced into Agrobacterium GV3101::90RK and transformed into WT Arabidopsis plants via the floral dip method (Clough and Bent 1998). The positive transgenic plants were screened by spraying 0.002% (v/v) Basta solution and then identified further by RT-PCR.

Water loss rate determination Three-week-old transgenic and WT seedlings were detached from the roots and weighed immediately. The samples were then left on the laboratory bench (20–22°C, humidity 45–60%) and weighed at the designated times. The water loss rate was calculated based on the initial fresh weight of the samples. Ten plants of each transgenic and WT line were used in this assay, and each measurement was repeated three times.

Abiotic stress treatments and ABA sensitivity analysis of transgenic Arabidopsis plants For the drought stress treatment, the WT and transgenic surface-sterilized seeds were sown onto MS medium. Seven-day-old seedlings were cultivated in rectangular plates (4 cm deep) that were filled with a mixture of vermiculite and humus. The plants were initially grown under a normal watering environment for 3 weeks. Then, the watering was halted, and observations were made after a further 10 to 35 days without water. When the wild-type plants exhibited lethal effects of dehydration, the watering was resumed, and the plants were allowed to grow for a subsequent 5 days. For the salt stress treatment, surface-sterilized transgenic and WT seeds were grown vertically on MS medium. Five-day-old seedlings were transferred to MS medium containing 0 and 150 mM NaCl


and then planted vertically for 5 days. The root lengths of the transgenic and WT plants were measured. For the freezing stress treatment, three-week-old Arabidopsis plants were grown under a long-day photoperiod (16 h light/8 h dark) at 22°C, transferred to –10°C conditions for 3 h, and then cultured at 5°C for 2 h before culturing under normal conditions. For the ABA sensitivity analysis, surface-sterilized transgenic and WT seeds were sown vertically on MS medium for 5 days, transferred to MS medium containing 0 and 5 µM ABA, and then planted vertically for 7 days. The root lengths of the transgenic and WT plants were measured. For all of the above abiotic stress treatments, the phenotypes before and after treatment were surveyed and photographed. All of the stress treatments were performed in triplicate.

Measurements of the proline content, soluble sugar content and relative electrolyte leakage The determination of the proline content was carried out using approximately 0.3 g Arabidopsis seedlings that were extracted in 5 ml 3% sulfosalicylic acid at 100°C for 10 min. The 2 ml extraction was reacted with 3 ml acidic ninhydrin solution and 2 ml glacial acetic acid at 100°C for 40 min, and the reaction was terminated in an ice bath. The reaction mixture was extracted with 5 ml toluene and mixed vigorously. The chromophore-containing toluene was aspirated from the aqueous phase, and the absorbance was read at 520 nm using toluene as a blank. The Pro concentration was determined from a standard curve and calculated on a fresh weight as previously described (Bates et al. 1973). For the measurement of the soluble sugar content, approximately 0.3 g seedlings was homogenized in 5 ml 0.05 M phosphate buffer, after which 5 ml 0.5% thiobarbituric acid (TBA) in 5% trichloroacetic acid (TCA) was added and mixed vigorously. The mixture was incubated at 100°C for 10 min, quickly cooled in an ice-water mixture, and then centrifuged at 3000 g for 15 min. The absorbances at 532 nm, 450 nm and 600 nm were measured to calculate the soluble sugar content (Hodges et al. 1999, Cui and Wang 2006). The electrolyte leakage was evaluated by measuring the relative conductivity of the solution that contained the samples. The seedling samples were rinsed with double-distilled water (ddH2O) and then immersed in 10 ml ddH2O. After 2 h, the conductivities (J1) of the samples were measured. The samples were then boiled for 10 min and cooled to room temperature. The conductivities (J2) of the samples were determined. The J1/J2 ratio was calculated to evaluate the relative conductivity (Cao et


al. 2007).

Yeast one-hybrid assays For the yeast one-hybrid assays, a full length TabZIP60 ORF was fused to the vector pDEST22 with the GAL4 DNA-activation domain (AD) and Trp1 reporter gene, resulting in plasmid pDEST22TabZIP60. The bait plasmids containing hexamer ABRE/mABRE sequence were provided by Dr. Jun Zhao (Wang et al. 2002). The plasmid pDEST22-TabZIP60 or pDEST22 and the bait plasmids with hexamer ABRE or mABRE sequences were co-transformed into the yeast YM4271 using Frozen-EZ yeast transformation method (ZYMO RESEARCH, cat. T2001). The transformants were selected on SD Leu– Trp– medium at 30°C for 2 days, and then positive colonies were transferred to SD Leu– Trp– His– medium containing 0.5 mM or 1 mM 3-AT for 2 days.

Results Molecular features and structures of the TabZIP60 genes To analyze the genomic organization of TabZIP60, the genomic sequences were isolated from the available diploid wheat genomes A (UR206), S (Y2006) and D (Y2282) and the hexaploid wheat ABD genomes (CS). As a result, a single sequence was obtained from each of the diploid wheat genomes and named the TrubZIP60 gene from UR206, the AesbZIP60 gene from Y2006, and the AetbZIP60 gene from Y2282. Three homologous sequences were amplified from the hexaploid CS wheat. Comparing these sequences with the diploid TabZIP60 gene sequences, the three hexaploid sequences were identified as the A, B and D genomes and named TabZIP60-A, TabZIP60-B, and TabZIP60-D, respectively. It was found through a nucleotide similarity analysis between the three diploid and hexaploid TabZIP60 sequences that TrubZIP60 has a 100% identity with TabZIP60-A, AesbZIP60 has a 92% identity with TabZIP60-B, and AetbZIP60 shares a 94.6% sequence identity with TabZIP60-D. A comparison of the genomic sequence of TabZIP60-A with its corresponding cDNA sequence revealed that there were four exons and three introns, with all of the splicing sites complying with the GT–AG rule (Fig. 1A). The promoter sequence of TabZIP60 was amplified (1500 bp upstream region from the initiation codon) and searched for the putative cis-acting regulatory element. The results indicated that some basic components and stress-responsive element-binding motifs were identified in the sequence,


including CAAT boxes, TATA boxes and abiotic stress-response cis-elements, i.e., ABA-responsive element (ABRE), early responsive to dehydration (ERD)1 elements, and MYB recognition sequence (MYBRS) (Supplementary Table S2).

Phylogenetic analysis A phylogenetic tree of three TabZIP60 homologous proteins and abiotic stress-related bZIP TFs from wheat and other plant species was constructed (Fig. 1B). The three TabZIP60 homologous proteins showed the highest levels of identity with EeABF6 and ErABF1 followed by TRAB1, HvABI5 and WABI5-1 proteins. The results indicated that TabZIP60 was a novel TabZIP TF in wheat. It belonged to ABF/AREB subfamily of bZIP TFs and was distinct from WABI5-1. To explore the characteristics of these homologous bZIP domains, sequence logos were used to uncover the level of conservation in the bZIP domains at each residue position. The results indicate that the bZIP domains comprised a highly conserved basic region and a less-conserved leucine zipper motif (Fig. 1C). The TabZIP60 gene sequences have been submitted to GenBank with accession numbers KJ562868, KJ806555–KJ806560.

Expression profiles of the TabZIP60 gene in different tissues and under different stresses The expression patterns of TabZIP60 were determined by qRT-PCR with different wheat tissues. TabZIP60 was expressed in all of the tested tissues, including young spikes, leaves, stems and roots, with higher expression levels in the young spikes and leaves (Supplementary Fig. S1). To investigate the response of TabZIP60 to abiotic stress, different treated wheat seedling roots and leaves were used to detect the relative expression levels of TabZIP60 under various stress treatments. For salt stress, the expression of TabZIP60 peaked (33.1-fold) after 12 h (Fig. 2A). For PEG-induced osmotic stress, the expression of TabZIP60 peaked (3.3-fold) after 1 h of PEG treatment (Fig. 2B). ABA plays a pivotal role in the abiotic stress response. Therefore, the effect of ABA on TabZIP60 transcription was also examined. After treatment with exogenous ABA, the TabZIP60 levels were induced 6.0-fold after 1 h and peaked after 24 h (27.6-fold) (Fig. 2C). The expression of TabZIP60 increased 2.0-fold after 1 h of cold treatment followed by a decrease and peaked (2.2-fold) after 48 h (Fig. 2D). These results showed that the TabZIP60 transcripts were strongly induced by PEG, salt, cold and exogenous ABA treatments.


Chromosomal assignment of the TabZIP60 genes To investigate the chromosomal assignments of the TabZIP60-A, TabZIP60-B and TabZIP60-D genes, the CS NT lines and gene-specific primers were used to amplify each TabZIP60 gene. The amplified fragments indicated that the TabZIP60-A gene-specific primers obtained PCR products in the other four CS NT lines except for NT6A6B and NT6A6D. The TabZIP60-B gene-specific primers did not amplify products for NT6B6A and NT6B6D. The TabZIP60-D gene-specific primers did not amplify products for NT6D6A and NT6D6B. Therefore, the TabZIP60-A, TabZIP60-B and TabZIP60-D genes were located separately on chromosomes 6A, 6B and 6D (Fig. 3).

Subcellular localization of TabZIP60 To determine the subcellular localization of the TabZIP60 protein, we introduced the p35S:TabZIP60-GFP fluorescence protein fusion into wheat protoplasts using the 35S:GFP construct as a control. Confocal microscopy observations indicated that the GFP protein alone was distributed throughout the entire cytoplasm and nucleus, whereas the transformed cells carrying TabZIP60-GFP showed a strong green fluorescent signal in the nucleus of the wheat protoplasts (Fig. 4). These data indicate that the TabZIP60 protein is a nuclear-localized protein, which agrees with the characteristics of transcription factors.

Transaction assay of yeast cells To determine if TabZIP60 has transcriptional activity, the open reading frame of TabZIP60 was fused to the GAL DNA-binding domain (BD) in the vector pDEST32, and the construct was transformed into yeast with the pDEST32 vector and pGAL4 as negative and positive controls, respectively. All of the transformants grew on SD/Leu– medium. The GAL4-BD-TabZIP60 construct and pGAL4 grew well on SD/Leu–His–Ade– medium, while the transformants containing the pDEST32 vector did not grow on the same medium (Fig. 5). These results indicate that TabZIP60 has transcriptional activity in yeast.

TabZIP60 transgenic plants exhibited improved tolerance to multiple abiotic stresses To investigate the role of the TabZIP60 gene in plant stress tolerance, we generated transgenic


Arabidopsis overexpressing the TabZIP60 gene under the control of the CaMV 35S promoter. Ten T3 homozygous transgenic lines were acquired, and the three independent plants L1, L11 and L26 were used for further analysis. The expression levels of the TabZIP60 gene in the transgenic plants were measured by qRT-PCR analysis (Supplementary Fig. S2). To identify the performance of the TabZIP60 transgenic plants under drought stress in soil, WT and three transgenic lines were tested at the seedling stage. Water was withheld for the first few days. There were no obvious morphological differences between the transgenic and WT plants. However, after a 35-day water-withholding period, all of the WT plants presented severe wilting, and some were dead, while only some of the TabZIP60 transgenic plants showed signs of severe dehydration, and the rosette leaves of some of the transgenic plants were still green and fully expanded. After 5 days of re-watering, all of the WT plants died, and 38–79% of the transgenic seedlings survived (Fig. 6A, B). To evaluate the salt tolerance of the transgenic plants, the WT and transgenic plants were planted vertically under normal conditions and in 150 mM NaCl MS medium for five days. The transgenic and WT plants had no significant difference in root length or leaf growth on MS medium. However, significantly greater root elongation was observed in the transgenic Arabidopsis seedlings compared with the WT plants on MS medium containing 150 mM NaCl. The leaf growth was almost the same in the transgenic and WT plants (Fig. 7A, B). To examine the effects of the overexpression of TabZIP60 on the freezing tolerance, WT and transgenic seedlings were subjected to –10°C for 3 h. Almost all of the WT rosette leaves were dead; however, the vast majority of transgenic seedlings were green and re-grew normally after recovery (Fig. 8A), and the survival rates of the transgenic plants (86–100%) were also much higher than those of the WT plants (40%) (Fig. 8B). These results indicate that the overexpression of TabZIP60 enhanced multiple abiotic stress tolerances.

Changes in the physiological traits under drought and cold stress conditions The enhanced multiple abiotic stress tolerances in the TabZIP60 transgenic plants prompted us to detect the physiological differences. The water loss of plants was estimated by measuring the fresh weights of the detached leaves from the three TabZIP60 transgenic and WT plants at the designated times. Three transgenic plants had lower rates of water loss compared with the WT plants (Fig. 6C). Soluble sugar accumulation in plant leaves is fundamental for enhanced stress tolerance (Wanner and


Junttila 1999). The soluble sugar contents in the three transgenic and WT plants were similar under normal growth conditions. After drought and freezing treatments, the soluble sugar level was significantly up-regulated in the three transgenic plants compared with the WT plants (Fig. 6D, 8C). Electrolyte leakage reflects membrane injury after stress. Under normal conditions, there were no differences in the electrolyte leakage levels of the TabZIP60 transgenic and WT plants. However, when the plants were grown under drought and freezing stress conditions, the electrolyte leakage was reduced in the three transgenic plants compared with the WT plants (Fig. 6E, 8D). The proline content is also an important parameter that is related to the plant response to abiotic stress. The proline contents in the three transgenic and WT plants that were grown under normal conditions were similar. When the plants were exposed to drought and freezing stresses, the proline content was significantly higher in the TabZIP60 transgenic plants than in the WT plants (Fig. 6F, 8E).

TabZIP60 expression increases plant sensitivity to ABA To assess whether TabZIP60 participates in ABA signaling pathway, ABA sensitivity of transgenic plants were examined. The results showed that ABA inhibited root elongation of transgenic and WT plants in the presence of 5 µM ABA. Furthermore, root length of the transgenic plants was affected more severely than that of the WT. In contrast, the growth of transgenic plants was similar to that of WT plants in the absence of ABA (Fig. 9A, B).

TabZIP60 binds to the ABRE cis-acting element The members of the ABF/AREB of bZIP TFs can interact with ABRE cis-acting element to activate downstream stress response genes (Uno et al. 2000, Kim et al. 2011). A yeast one-hybrid assay was conducted to examine the ABRE-binding affinity of TabZIP60. All of the transformants grew on SD/Leu–Trp– medium. In contrast, the transformants of GAL4-AD-TabZIP60 and the bait plasmid with ABRE sequence grew well on SD/ Leu–Trp–His– containing 3-aminotriazole (3-AT) medium. The other transformants did not grow on the same medium (Fig. 10). The results indicate that TabZIP60 binds to the ABRE sequence. TabZIP60 was not able to bind to the mutated forms of ABRE sequence (mABRE), and the GAL4 activation domain (GAL4-AD) alone was not able to bind to the ABRE sequence.


Altered expression of stress-responsive genes in the TabZIP60 transgenic plants To gain a deeper understanding of the function of the TabZIP60 gene in abiotic stress tolerance, the expression levels of 10 known abiotic stress-response genes were investigated in the WT and TabZIP60 transgenic plants under salt stress conditions. Compared with the WT plants, seven genes, AtRD29A, AtRD20, AtRD29B, AtCOR47, AtMYB2, AtDREB2A and AtERD6, exhibited a significantly higher expression level in the TabZIP60 transgenic plants (Fig. 11). However, the expression levels of the other three genes (AtRD26, AtGEA6, and AtLEA4-5) were not significantly changed (data not shown). These results suggest that the overexpression of TabZIP60 in Arabidopsis enhances the expression of stress-responsive genes under salt stress.

Discussion The bZIP gene family is a large TF family and regulates a very wide range of biological processes in plants. In Arabidopsis and rice, many bZIP genes have been reported with roles in response to abiotic stresses. However, there are few reports on the bZIP genes in wheat. As we know, wheat is a staple food worldwide and is an allohexaploid crop with three diploid genomes designated as A, B, and D (Gill et al. 2004). The complex genome of wheat makes it extremely challenging to characterize genetically and functionally. In this study, TabZIP60 was isolated from full-length wheat cDNA library. This gene was induced by environmental stresses. Moreover, the expression pattern of the TabZIP60 gene under PEG treatment was similar to that under cold stress. The transcription levels and response times indicated that TabZIP60 is very sensitive to PEG and cold stresses (Fig. 2). Meanwhile, numerous stress-related cis-acting elements, including ABRE, LTR, ERD1, MYBRS and MYCRS, are present in the 1.5 kb promoter region of the TabZIP60 gene. AREB/ABF, MYB and MYC transcription factors can combine with ABRE, MYBRS and MYCRS respectively, and are then involved in ABA signaling and abiotic stress responses. Interestingly, in addition to the cis-acting regulatory elements in ABA-dependent gene expression in the TabZIP60 promoter, ERD1 (cis-acting element), which is responsible for ERD1 gene expression during dehydration and etiolation in the ABA-independent pathway, is located in the TabZIP60 promoter region (Yamaguchi-Shinozaki and Shinozaki 2005). Such an abundance of stress responsive cis-acting elements in the TabZIP60 promoter suggests a pivotal role for this gene in stress tolerance. In addition, a phylogenetic analysis also showed that TabZIP60 is more closely related to ErABF1 and EeABF6 than to WABI5-1 (Fig.


1B). The expression of ErABF1 gene was also induced by ABA, drought, high salt and low temperature. ErABF1-overexpression improved the tolerance to drought and high-salt stresses in transgenic tobacco plants (Gao et al. 2011). The strong expression of the TabZIP60 gene by multiple stress factors and the high similarity of TabZIP60 to ErABF1 indicate that TabZIP60 may play a critical role in abiotic stress tolerance in wheat. The overexpression of TFs that control the transcription of numerous downstream stress-related genes is a beneficial method in the cultivation of tolerant transgenic plants. Furthermore, Arabidopsis plants have been frequently used in the transgenic research of stress-tolerant genes from crops on which it is difficult to perform gene transformation analysis, including soybean and wheat (Gao et al. 2011, Zhang et al. 2012, Niu et al. 2012). In this study, transgenic Arabidopsis plants overexpressing TabZIP60 exhibited tolerance to drought, salt and freezing temperature stresses, which was consistent with the transcriptional expression of the TabZIP60 gene. This finding suggests that the TabZIP60 gene may participate in regulating the plant response to diverse abiotic stresses, indicating that this gene has potential in plant stress tolerance improvement. Abiotic stresses often cause changes in several metabolites, such as proline and a variety of sugars and sugar alcohols in plants. Soluble sugars do not only function as metabolic energy but also act as molecular signals regulating different genes that are associated with the stress pathway to cope with abiotic stress conditions (Rosa et al. 2009). Proline plays an important role in the response to abiotic stresses, including osmotic adjustment, stabilizing sub-cellular structures, scavenging free radicals, and inducing the expression of stress-responsive genes (Srinivas and Balasubramanian 1995, Satoh et al. 2002, Chinnusamy et al. 2005, Ashraf and Foolad 2007). Studies have demonstrated that drought, salinity and low temperatures commonly increase the soluble sugar and proline concentrations. In this work, the concentrations of free proline and soluble sugars were higher in the TabZIP60 transgenic plants than in the WT plants that were grown under stress conditions (Fig. 6, 8), demonstrating that soluble sugars and proline are factors that contribute to the tolerance of TabZIP60 transgenic plants to multiple stresses. Meanwhile, the water-loss rate was lower in the leaves from the TabZIP60 transgenic Arabidopsis seedlings than in the leaves from the WT plants. The leaf water-loss rates indicate that TabZIP60 overexpressors have a stronger water-holding capability than do wild-type plants. The changes in the physiological indices of the TabZIP60 transgenic plants were advantageous to the plant responses to adverse conditions.


The transcription factors interact with the cis-elements in the promoter regions of many abiotic stress-related genes, thus enhancing the expression of these stress-responsive genes, resulting in abiotic stresses tolerance (Agarwal et al. 2010). The overexpression of the TabZIP60 gene in Arabidopsis improved multiple abiotic stress tolerances. Therefore, it is necessary to detect the expression levels of stress-related genes in the transgenic plants. In this work, the expression levels of the stress-responsive genes AtRD29A, AtRD29B, AtMYB2, AtCOR47, AtRD20, AtDREB2A and AtERD6 were upregulated in the TabZIP60 overexpressing Arabidopsis plants under salt stress treatment. It was concluded that the RD29A gene acted as a regulator via ABA-dependent and ABA-independent pathways (Zhu 2002). Furthermore, a tomato bZIP TF named Solanum lycopersicum ABA-responsive element binding protein (SLAREB) can bind the AtRD29A promoter and upregulate the expression of AtRD29A and AtCOR47 under salt stress (Hsieh et al. 2010). AtRD20 gene expression increases in response to salt stress and in transgenic plants overexpressing the salt stress-responsive AtbZIP17 gene (Liu et al. 2008, Aubert et al. 2010). Recently, it was also found that bZIP transcription factors can bind to and activate the dehydration-responsive element-binding protein 2A (DREB2A) promoter in an ABRE-dependent manner under drought and high-salinity stresses. In other words, DREB2A expression requires both ABA-dependent and ABA-independent signaling cascades (Kim et al. 2011). The other three genes, AtRD29B, AtMYB2 and AtERD6 have been reported to be induced under salt stress and ABA conditions (Nakashima et al. 2009), and the transcriptional expression of TabZIP60 was induced by exogenous ABA treatment in wheat. The TabZIP60 was capable of binding ABRE sequence and the overexpression of TabZIP60 in Arabidopsis led to greater sensitivity to exogenous ABA in seedling growth. These results suggest that TabZIP60 plays roles in the response to abiotic stress through an ABA-dependent pathway. In conclusion, the overexpression of the wheat bZIP gene, TabZIP60, which encodes a nuclear-localized protein and which functions as transcriptional activator in yeast, in transgenic Arabidopsis results in enhanced multiple abiotic stresses and increased sensitivity to exogenous ABA through the regulation of stress-responsive genes and changes in certain physiological parameters. These results broaden our understanding of wheat bZIP TFs in response to abiotic stresses and may offer an excellent gene for wheat stress tolerance improvement.


Acknowledgements – We are grateful to Professor Yongfu Fu and Professor Jun Zhao for providing plant expression vector pEarleyGate 100 and the bait plasmid and to Dr. Yongqiang Gu (USDA/ARS/WRRC-GDD) for critical readings of the manuscript. We also thank Lei Pan for his warm experimental help. This work was supported by the National Transgenic Research Project (2014ZX0800918B) and the National 863 Project (2012AA10A309).

References Abe M, Kobayashi Y, Yamamoto S, Daimon Y, Yamaguchi A, Ikeda Y, Ichinoki H, Notaguchi M, Goto K, Araki T (2005) FD, a bZIP protein mediating signals from the floral pathway integrator FT at the shoot apex. Science 309: 1052–1056 Agarwal PK, Jha B (2010) Transcription factors in plants and ABA dependent and independent abiotic stress signaling. Biol Plantarum 54: 201–212 Alonso R, Oñate-Sánchez L, Weltmeier F, Ehlert A, Diaz I, Dietrich K, Vicente-Carbajosa J, Dröge-Laser W (2009) A pivotal role of the basic leucine zipper transcription factor bZIP53 in the regulation of Arabidopsis seed maturation gene expression based on heterodimerization and protein complex formation. Plant Cell 21: 1747–1761 Ashraf M, Foolad MR (2007) Roles of glycine betaine and proline in improving plant abiotic stress resistance. Environ Exp Bot 59: 206–216 Aubert Y, Vile D, Pervent M, Aldon D, Ranty B, Simonneau T, Vavasseur A, Galaud JP (2010) RD20, a stress-inducible caleosin, participates in stomatal control, transpiration and drought tolerance in Arabidopsis thaliana. Plant Cell Physiol 51: 1975–1987 Bailey TL, Elkan C (1994) Fitting a mixture model by expectation maximization to discover motifs in biopolymers. Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology. AAAI Press, Menlo Park, California, pp 28–36 Bates LS, Waldren RP, Teare ID (1973) Rapid determination of free proline for water-stress studies. Plant Soil 39: 205–207 Cao W, Liu J, He X, Mu R, Zhou H, Chen S, Zhang J (2007) Modulation of ethylene responses affects plant salt-stress responses. Plant Physiol 143: 707–719 Chen W, Zhu T (2004) Networks of transcription factors with roles in environmental stress response.


Trends Plant Sci 9: 591–596 Chinnusamy V, Jagendorf A, Zhu JK (2005) Understanding and improving salt tolerance in plants. Crop Sci 45: 437–448 Chinnusamy V, Zhu J, Zhu JK (2007) Cold stress regulation of gene expression in plants. Trends Plant Sci 12: 444–451 Chuang CF, Running MP, Williams RW, Meyerowitz EM (1999) The PERIANTHIA gene encodes a bZIP protein involved in the determination of floral organ number in Arabidopsis thaliana. Genes Dev 13: 334–344 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735–743 Cui Y, Wang Q (2006) Physiological responses of maize to elemental sulphur and cadmium stress. Plant Soil Environ 52: 523–529 Despres C, DeLong C, Glaze S, Liu E, Fobert PR (2000) The Arabidopsis NPR1/NIM1 protein enhances the DNA binding activity of a subgroup of the TGA family of bZIP transcription factors. Plant Cell 12: 279–290 Ellenberger TE, Brandl CJ, Struhl K, Harrison SC (1992) The GCN4 basic region leucine zipper binds DNA as a dimer of uninterrupted alpha helices: crystal structure of the protein-DNA complex. Cell 71: 1223–1237 Earley KW, Haag JR, Pontes O, Opper K, Juehne T, Song K, Pikaard CS (2006) Gateway-compatible vectors for plant functional genomics and proteomics. Plant J 45: 616–629 Foster R, Izawa T, Chua NH (1994) Plant bZIP proteins gather at ACGT elements. FASEB J 8: 192– 200 Gangappa SN, Crocco CD, Johansson H, Datta S, Hettiarachchi C, Holm M, Botto JF (2013) The Arabidopsis B-BOX protein BBX25 interacts with HY5, negatively regulating BBX22 expression to suppress seedling photomorphogenesis. Plant Cell 25: 1243–1257 Gao SQ, Tang YM, Yang Y, Liu S, Chen JR, Ma JX, Tian LP, Zhang FT, Zhao CP (2011) Cloning and functional analysis of ErABF1 gene from Elytrigria repens. J Triticeae Crops 31: 194–201 Gao SQ, Chen M, Xu ZS, Zhao CP, Li LC, Xu HJ, Tang YM, Zhao X, Ma YZ (2011) The soybean GmbZIP1 transcription factor enhances multiple abiotic stress tolerances in transgenic plants. Plant Mol Biol 75: 537–553


Gill BS, Appels R, Botha-Oberholster AM, Buell CR, Bennetzen JL, Chalhoub B, Chumley F, Dvorak J, Iwanaga M, Keller B, Li W, McCombie WR, Ogihara Y, Quetier F, Sasaki T (2004) A work-shop report on wheat genome sequencing: international genome research on wheat consortium. Genetics 168: 1087–1096 Hirayama T, Shinozaki K (2010) Research on plant abiotic stress responses in the post-genome era: past, present and future. Plant J 61: 1041–1052 Hodges DM, DeLong JM, Forney CF, Prange RK (1999) Improving the thiobarbituric acid-reactive-substances assay for estimating lipid peroxidation in plant tissues containing anthocyanin and other interfering compounds. Planta 207: 604–611 Hossain MA, Cho JI, Han M, Ahn CH, Jeon JS, An G, Park PB (2010a) The ABRE-binding bZIP transcription factor OsABF2 is a positive regulator of abiotic stress and ABA signaling in rice. Plant Physiol 167: 1512–1520 Hossain MA, Lee Y, Cho JI, Ahn CH, Lee SK, Jeon JS, Kang H, Lee CH, An G, Park PB (2010b) The bZIP transcription factor OsABF1 is an ABA responsive element binding factor that enhances abiotic stress signaling in rice. Plant Mol Biol 72: 557–566 Hsieh TH, Li CW, Su RC, Cheng CP, Sanjaya, Tsai YC, Chan MT (2010) A tomato bZIP transcription factor, SlAREB, is involved in water deficit and salt stress response. Planta 231: 1459–1473 Hurst HC (1994) Transcription factors 1: bZIP proteins. Protein Profile 1: 123–168 Iwata Y, Koizumi N (2005) An Arabidopsis transcription factor, AtbZIP60, regulates the endoplasmic reticulum stress response in a manner unique to plants. Proc Natl Acad Sci USA 102: 5280–5285 Izawa T, Foster R, Chua NH (1993) Plant bZIP protein DNA binding specificity. J Mol Biol 230: 1131–1144 Jakoby M, Weisshaar B, Droege Laser W, Vicente Carbajosa J, Tiedemann J, Kroj T, Parcy F. (2002) bZIP transcription factors in Arabidopsis. Trends Plant Sci 7: 106–111 Jia JZ , Zhao SC, Kong XY, Li YR, Zhao GY, He WM, Appels R, Pfeifer M, Tao Y, Zhang XY, Jing RL, Zhang C, Ma YZ, Gao LF, Gao C, Spannagl M, Mayer KF, Li D, Pan SK, Zheng FY, Hu Q, Xia XC, Li JW , Liang QS, Chen J, Wicker T, Gou C, Kuang HH , He GY, Luo YD , Keller B, Xia QJ, Lu P, Wang JY, Zou HF, Zhang RZ, Xu JY, Gao JL, Middleton C, Quan ZW, Liu GM, Wang J, Yang HM , Liu X, He ZH , Mao L, Wang J (2013) Aegilops tauschii draft genome


sequence reveals a gene repertoire for wheat adaptation. Nature 496: 91–95 Johnson RR, Wagner RL, Verhey SD, Walker-Simmons MK (2002) The abscisic acid-responsive kinase PKABA1 interacts with a seed-specific abscisic acid response element-binding factor, TaABF, and phosphorylates TaABF peptide sequences. Plant Physiol 130: 837–846 Kang SG, Price J, Lin PC, Hong JC, Jang JC (2010) The Arabidopsis bZIP1 transcription factor is involved in sugar signaling, protein networking, and DNA binding. Mol Plant 3: 361–373 Kim JS, Mizoi J, Yoshida T, Fujita Y, Nakajima J, Ohori T, Todaka D, Nakashima K, Hirayama T, Shinozaki K, Yamaguchi-Shinozaki K (2011) An ABRE promoter sequence is involved in osmotic stress-responsive expression of the DREB2A gene, which encodes a transcription factor regulating drought-inducible genes in Arabidopsis. Plant Cell Physiol 52: 2136–2146 Kobayashi F, Maeta E, Terashima A, Kawaura K, Ogihara Y, Takum S (2008a) Development of abiotic stress tolerance via bZIP-type transcription factor LIP19 in common wheat. J Exp Bot 59: 891–905 Kobayashi F, Maeta E, Terashima A, Takumi S (2008b) Positive role of a wheat HvABI5 ortholog in abiotic stress response of seedlings. Physiol Plant 134: 74–86 Kondo S, Saito A, Asada R, Kanemoto S, Imaizumi K, (2011) Physiological unfolded protein response regulated by OASIS family members, transmembrane bZIP transcription factors. IUBMB life 63: 233–239 Krasensky J, Jonak C (2012) Drought, salt, and temperature stress-induced metabolic rearrangements and regulatory networks. J Exp Bot 63: 1593–1608 Kreps JA, Wu Y, Chang HS, Zhu T, Wang X, Harper JF (2002) Transcriptome changes for Arabidopsis in response to salt, osmotic, and cold stress. Plant Physiol 130: 2129–2141 Landschulz WH, Johnson PF, McKnight SL (1988) The leucine zipper: a hypothetical structure common to a new class of DNA binding proteins. Science 240: 1759–1764 Li ZF, Zhang LX, Yu YW, Quan YD, Zhang ZJ, Zhang HW, Huang RF (2011) The ethylene response factor AtERF11 that is transcriptionally modulated by the bZIP transcription factor HY5 is a crucial repressor for ethylene biosynthesis in Arabidopsis. Plant J 68: 88–99 Liu CT, Mao BG, Ou SJ, Wang W, Liu LC, Wu YB, Chu CC, Wang XP (2014) OsbZIP71, a bZIP transcription factor, confers salinity and drought tolerance in rice. Plant Mol Biol 84: 19–36 Liu JX, Srivastava R, Howell SH. (2008) Stress-induced expression of an activated form of AtbZIP17


provides protection from salt stress in Arabidopsis. Plant Cell Environ 31: 1735–1743 Lu G, Gao C, Zheng X, Han B (2009) Identification of OsbZIP72 as a positive regulator of ABA response and drought tolerance in rice. Planta 229: 605–615 Niu CF, Wei W, Zhou QY, Tian AG, Hao YJ, Zhang WK, Ma B, Lin Q, Zhang ZB, Zhang JS, Chen SY (2012) Wheat WRKY genes TaWRKY2 and TaWRKY19 regulate abiotic stress tolerance in transgenic Arabidopsis plants. Plant Cell Environ 35: 1156–1170 Prasad VB, Gupta N, Nandi A, Chattopadhyay S (2012) HY1 genetically interacts with GBF1 and regulates the activity of the Z-box containing promoters in light signaling pathways in Arabidopsis thaliana. Mech Dev 129: 298–307 Riechmann JL, Ratcliffe OJ (2000) A genomic perspective on plant transcription factors. Curr Opin Plant Biol 3: 423–434 Rosa M, Prado C, Podazza G, Interdonato R, González JA, Hilal M, Prado FE ( 2009) Soluble sugars – metabolism, sensing and abiotic stress: A complex network in the life of plants. Plant Signal Behav 5: 388–393 Satoh R, Nakashima K, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2002) ACTCAT, a novel cis-acting element for proline- and hypoosmolarity-responsive expression of the ProDH gene encoding proline dehydrogenase in Arabidopsis. Plant Physiol 130: 709–719 Seki M, Narusaka M, Ishida J, Nanjo T, Fujita M, Oono Y, Kamiya A, Nakajima M, Enju A, Sakurai T, Satou M, Akiyama K, Taji T, Yamaguchi-Shinozaki K, Carninci P, Kawai J, Hayashizaki Y, Shinozaki K (2002) Monitoring the expression profiles of 7000 Arabidopsis genes under drought, cold and high-salinity stresses using a full-length cDNA microarray. Plant J 31: 279–292 Shen H, Cao K, Wang X (2007) A conserved proline residue in the leucine zipper region of AtbZIP34 and AtbZIP61 in Arabidopsis thaliana interferes with the formation of homodimer. Biochem Biophys Res Commun 362: 425–430 Shimizu H, Sato K, Berberich T, Miyazaki A, Ozaki R, Imai R, Kusano T (2005) LIP19, a basic region leucine zipper protein, is a Fos-like molecular switch in the cold signaling of rice plants. Plant Cell Physiol 46: 1623–1634 Silveira AB, Gauer L, Tomaz JP, Cardoso PR, Carmello-Guerreiro S, Vincentz M (2007) The Arabidopsis AtbZIP9 protein fused to the VP16 transcriptional activation domain alters leaf and vascular development. Plant Sci 172: 1148–1156


Srinivas V, Balasubramanian D (1995) Proline is a protein-compatible hydrotrope. Langmuir 11: 2830–2833 Takahashi H, Kawakatsu T, Wakasa Y, Hayashi S, Takaiwa F (2012) A rice transmembrane bZIP transcription factor, OsbZIP39, regulates the endoplasmic reticulum stress response. Plant Cell Physiol 53: 144–153 Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28: 2731–2739 Tang N, Zhang H, Li XH, Xiao JH, Xiong LZ (2012) Constitutive activation of transcription factor OsbZIP46 improves drought tolerance in rice. Plant Physiol 158: 1755–1768 Thalor SK, Berberich T, Lee SS, Yang SH, Zhu X, Imai R, Takahashi Y, Kusano T (2012) Deregulation of sucrose-controlled translation of a bZIP-Type transcription factor results in sucrose accumulation in leaves. PLoS One 7: e33111 Uno Y, Furihata T, Abe H, Yoshida R, Shinozaki K, Yamaguchi-Shinozaki K (2000) Arabidopsis basic leucine zipper transcription factors involved in an abscisic acid-dependent signal transduction pathway under drought and high-salinity conditions. Proc Natl Acad Sci USA 97: 11632–11637 Walsh J, Waters CA, Freeling M (1998) The maize gene liguleless2 encodes a basic leucine zipper protein involved in the establishment of the leaf blade sheath boundary. Genes Dev 12: 208–218 Wang JZ, Zhou JX, Zhang BL, Vanitha J, Ramachandran S, Jiang SY (2011) Genome-wide expansion and expression divergence of the basic leucine zipper transcription factors in higher plants with an emphasis on Sorghum. J Integr Plant Biol 53: 212–231 Wang L, Zhao J, Fan YL (2002) Gene cloning and function analysis of ABP9 protein which specifically binds to ABRE2 motif of maize Cat1 gene. Chin Sci Bull 47: 1871–1875 Wanner LA, Junttila O (1999) Cold-induced freezing tolerance in Arabidopsis. Plant Physiol 120: 391–399 Warren AJ (2002) Eukaryotic transcription factors. Curr Opin Struct Biol 12: 107–114 Weltmeier F, Rahmani F, Ehlert A, Dietrich K, Schütze K, Wang X, Chaban C, Hanson J, Teige M, Harter K, Vicente-Carbajosa J, Smeekens S, Dröge-Laser W (2009) Expression patterns within the Arabidopsis C/S1 bZIP transcription factor network: availability of heterodimerization


partners controls gene expression during stress response and development. Plant Mol Biol 69: 107–119 Xiang Y, Tang N, Du H, Ye H, Xiong L (2008) Characterization of OsbZIP23 as a key player of the basic leucine zipper transcription factor family for conferring abscisic acid sensitivity and salinity and drought tolerance in rice. Plant Physiol 148: 1938–1952 Yamaguchi-Shinozaki K, Shinozaki K (2005) Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters. Trends Plant Sci 10: 88–94 Yamamoto MP, Onodera Y, Touno SM, Takaiwa F. (2006) Synergism between RPBF Dof and RISBZ1 bZIP activators in the regulation of rice seed expression genes. Plant Physiol 141: 1694– 1707 Yang O, Popova1 OV, Süthoff U, Lüking I, Dietz KJ, Golldack D (2009) The Arabidopsis basic leucine zipper transcription factor AtbZIP24 regulates complex transcriptional networks involved in abiotic stress resistance. Gene 436: 45–55 Yilmaz A, Nishiyama MY, Fuentes BG, Souza GM, Janies D, Gray J, Grotewold E (2009) GRASSIUS: a platform for comparative regulatory genomics across the grasses. Plant Physiol 149: 171–180 Yoo SD, Cho YH, Sheen J (2007) Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Protoc 2: 1565–1572 Yoshida T, Fujita Y, Sayama H, Kidokoro S, Maruyama K, Mizoi J, Shinozaki K, Yamaguchi-Shinozaki K (2010) AREB1, AREB2, and ABF3 are master transcription factors that cooperatively regulate ABRE-dependent ABA signaling involved in drought stress tolerance and require ABA for full activation. Plant J 61: 672–685 Zhang LC, Zhao GY, Xia C, Jia JZ, Liu X, Kong XY (2012) A wheat R2R3-MYB gene, TaMYB30-B, improves drought stress tolerance in transgenic Arabidopsis. J Exp Bot 63: 5873–5885 Zhang Y, Zhang G, Xia N, Wang XJ, Huang LL, Kang ZS (2009) Cloning and characterization of a bZIP transcription factor gene in wheat and its expression in response to stripe rust pathogen infection and abiotic stresses. Physiol Mol Plant Pathol 73: 88–94 Zhou JM, Trifa Y, Silva H, Pontier D, Lam E, Shah J, Klessig DF (2000) NPR1 differentially interacts with members of the TGA/OBF family of transcription factors that bind an element of the PR-1 gene required for induction by salicylic acid. Mol Plant–Microbe Interact 13: 191–202


Zhu JK (2002) Salt and drought stress signal transduction in plants. Annu Rev Plant Biol 53: 247–273 Zou M, Guan Y, Ren H, Zhang F, Chen F (2008) A bZIP transcription factor, OsABI5, is involved in rice fertility and stress tolerance. Plant Mol Biol 66: 675–683

Edited by M. Uemura


Figure legends

Fig. 1. The gene structure of the TabZIP60-A gene (A), phylogenetic tree (B) and sequence logo (C) for the bZIP domain of the three TabZIP60 homologous proteins and abiotic stress-related bZIP TFs from wheat and other plant species. (A) Schematic diagram (position and length) of the TabZIP60-A gene in the exons and introns. The boxes represent exons, and the black lines represent introns. (B) Phylogenetic tree based on amino acid sequences indicating the relationships of TabZIP60 with other plant bZIP-type proteins. The accession numbers (in parentheses) of the amino acid sequences are ErABF1 (HQ738283), EeABF6 (HQ622092); WABI5-1 (AB362818), TaABI5 (AB238932), TaABF (AF519804), TaOBF1a (AB334129) and WLIP19a (AB334127); HvABI5 (AY150676), HvABF1 (DQ786408) and HvABF3 (DQ786410); OsABI5 (EF199630) and TRAB1 (AB023288); AtABF1 (AF093544), AtABF2 (AF093545) and AtABF3 (AF093546). (C) The sequence logo of the conserved bZIP domain including the basic region and leucine zipper motif was determined by MEME using the protein sequences of TabZIP60 and bZIP members from other plant species. The y-axis (measured in bits) depicts the overall height of each stack, indicating the conservation of the protein sequence at that position, while the height of letters within the stack indicates the relative frequency of each amino acid at that position.



Fig. 2. Expression patterns of the wheat TabZIP60 gene under different treatments. The y-axis indicates the relative expression levels of the TabZIP60 gene, and the data were calculated using the 2–ΔΔCT method. The experiment was performed in triplicate. The bars indicate standard errors.


Fig. 3. Chromosomal assignment of the TabZIP60 genes. The TabZIP60-A gene was not amplified using templates NT6A6B and NT6A6D lacking chromosome 6A. The TabZIP60-B gene was not amplified using templates NT6B6A and NT6B6A lacking chromosome 6B. The TabZIP60-D gene was not amplified using templates NT6D6A and NT6D6B lacking chromosome 6D.


TabZIP60-A TabZIP60-B

TabZIP60-D

NT6D6B

NT6D6A

NT6B6D

NT6B6A

NT6A6D

NT6A6B

Fig. 4. Subcellular localization of the TabZIP60 protein in wheat protoplasts. The p35:TabZIP60-GFP and p35:GFP constructs were separately introduced and expressed transiently in wheat protoplasts. Bars=10 μM.


Fig. 5. Transcriptional activity of the TabZIP60 protein in yeast. Test of transcriptional activity of the full-length TabZIP60 protein. The pDEST32 vector alone and GAL4 were used as negative and positive controls respectively.


Fig. 6. Drought stress response of the TabZIP60-overexpressing Arabidopsis seedlings. (A) Phenotype of the transgenic and WT plants before and after drought treatment. (B) Survival rate in (A). (C) Water loss rate of the detached leaves. (D) Soluble sugar content in different plants. (E) Relative electrolyte leakage in the plant leaves. (F) Proline content in the seedlings. The data represent the means from three replicates. The bars indicate the SD. The asterisks indicate significant differences compared with the WT plants (*0.01 < P < 0.05, **P＜0.01).


Fig. 7. Salt stress response of the TabZIP60-overexpressing Arabidopsis seedlings. (A) Phenotype of the transgenic and WT plants on MS containing 0 and 150 mM NaCl. (B) Root length of plants in (A). The data represent the means from three replicates. The bars indicate the SD. * and ** represent significant differences compared with the WT lines at the 0.01 < P < 0.05 and P < 0.01 levels.


Fig. 8. Freezing stress response of the TabZIP60-overexpressing Arabidopsis seedlings. (A) Phenotype of the transgenic and WT plants before and after freezing treatment. (B) Survival rate after freezing. (C) Soluble sugar content in the seedlings. (D) Relative electrolyte leakage in the seedlings. (E) Proline content in the plants. The data represent the means from three replicates. The bars indicate the SD. * and ** represent significant differences compared with the WT lines at the 0.01 < P < 0.05 and P < 0.01 levels.


Fig. 9. ABA sensitivity analysis of TabZIP60-overexpressing Arabidopsis seedlings. (A) Phenotype of the transgenic and WT plants on MS containing 0 and 5 µM ABA. (B) Root length of plants in (A). The data represent the means from three replicates. The bars indicate the SD. * and ** represent significant differences compared with the WT lines at the 0.01 < P < 0.05 and P < 0.01 levels.


Fig. 10. Yeast one-hybrid binding analysis of ABRE and TabZIP60. The hexamer ABRE/mABRE sequence were used as negative controls. Yeast cell were grown in liquid medium and diluted in a 10 × dilution series. 10 µL of each dilution was spotted on SD / leu–Trp–His– medium with 0.5 mM and 1 mM 3-AT.

Fig. 11. Expression levels of the stress-responsive genes under salt stress. Gene-specific primers were selected for the detection of the relative transcript levels of the stress-responsive genes. The data represent the means of three replicates. The bars indicate the SD. * and ** represent significant differences compared with the WT lines at the 0.01 < P < 0.05 and P < 0.01 levels.


Novel NAC transcription factor TaNAC67 confers enhanced multi-abiotic stress tolerances in Arabidopsis.

ABI-like transcription factor gene TaABL1 from wheat improves multiple abiotic stress tolerances in transgenic plants.

Mulberry Transcription Factor MnDREB4A Confers Tolerance to Multiple Abiotic Stresses in Transgenic Tobacco.

Wheat Transcription Factor TaAREB3 Participates in Drought and Freezing Tolerances in Arabidopsis.

Reduced tolerance to abiotic stress in transgenic Arabidopsis overexpressing a Capsicum annuum multiprotein bridging factor 1.

AtTGA4, a bZIP transcription factor, confers drought resistance by enhancing nitrate transport and assimilation in Arabidopsis thaliana.

Constitutive expression of a salinity-induced wheat WRKY transcription factor enhances salinity and ionic stress tolerance in transgenic Arabidopsis thaliana.

TaNAC29, a NAC transcription factor from wheat, enhances salt and drought tolerance in transgenic Arabidopsis.

A thaumatin-like protein of Ocimum basilicum confers tolerance to fungal pathogen and abiotic stress in transgenic Arabidopsis.

BnaABF2, a bZIP transcription factor from rapeseed (Brassica napus L.), enhances drought and salt tolerance in transgenic Arabidopsis.

LchERF, a novel ethylene-responsive transcription factor from Lycium chinense, confers salt tolerance in transgenic tobacco.

The NAC family transcription factor OsNAP confers abiotic stress response through the ABA pathway.

The Arabidopsis NAC transcription factor ANAC096 cooperates with bZIP-type transcription factors in dehydration and osmotic stress responses.

GhABF2, a bZIP transcription factor, confers drought and salinity tolerance in cotton (Gossypium hirsutum L.).

A novel NAC transcription factor from Suaeda liaotungensis K. enhanced transgenic Arabidopsis drought, salt, and cold stress tolerance.

Dominant repression by Arabidopsis transcription factor MYB44 causes oxidative damage and hypersensitivity to abiotic stress.

Multiple NUCLEAR FACTOR Y transcription factors respond to abiotic stress in Brassica napus L.

Pigeonpea Hybrid-Proline-Rich Protein (CcHyPRP) Confers Biotic and Abiotic Stress Tolerance in Transgenic Rice.

ABA inducible rice protein phosphatase 2C confers ABA insensitivity and abiotic stress tolerance in Arabidopsis.

ERF Type Transcription Factor OsEREBP1 Confers Biotic and Abiotic Stress Tolerance in Rice.

EsDREB2B, a novel truncated DREB2-type transcription factor in the desert legume Eremosparton songoricum, enhances tolerance to multiple abiotic stresses in yeast and transgenic tobacco.

A novel tomato MYC-type ICE1-like transcription factor, SlICE1a, confers cold, osmotic and salt tolerance in transgenic tobacco.

A novel alkyl hydroperoxidase (AhpD) of Anabaena PCC7120 confers abiotic stress tolerance in Escherichia coli.

The SsDREB Transcription Factor from the Succulent Halophyte Suaeda salsa Enhances Abiotic Stress Tolerance in Transgenic Tobacco.