A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells.

Page 1 of 56

Stem Cells and Development A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells (doi: 10.1089/scd.2014.0143) This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.

1 REVISED VERSION 2

A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells

Running title: Single cell definitive endoderm differentiation

Ulf Diekmann, Sigurd Lenzen, and Ortwin Naujok From the Institute of Clinical Biochemistry, Hannover Medical School, Hannover, Germany

This work was supported by the Deutsche Forschungsgemeinschaft (German Research Foundation) within the framework of the Cluster of Excellence REBIRTH.

Word count: Main 5953, Abstract 203 Number of Figures: 7 and Supplement (6)

August 2014 Corresponding Author: Dr. Ortwin Naujok Institute of Clinical Biochemistry Hannover Medical School 30625 Hannover Germany Phone: +49/511/5323544 Fax: +49/511/5323584 E-mail: [email protected]

Page 2 of 56


2 CONTACT INFORMATION FOR ALL AUTHORS: Ulf Diekmann Institute of Clinical Biochemistry Hannover Medical School 30625 Hannover Germany Phone: +49/511/5322836 Fax: +49/511/5323584 E-mail: [email protected]

Prof. Sigurd Lenzen Institute of Clinical Biochemistry Hannover Medical School 30625 Hannover Germany Phone: +49/511/5326525 Fax: +49/511/5323584 E-mail: [email protected]

Corresponding Author: Dr. Ortwin Naujok Institute of Clinical Biochemistry Hannover Medical School 30625 Hannover Germany Phone: +49/511/5323544 Fax: +49/511/5323584 E-mail: [email protected]

Page 3 of 56


3 ABSTRACT Differentiation of pluripotent cells into endoderm related cell types initially requires in vitro gastrulation into the definitive endoderm. Most differentiation protocols are initiated from colonies of pluripotent cells complicating their adaption due to insufficiently defined starting conditions. The protocol described here was initiated from a defined cell number of dispersed single cells and tested on three different human embryonic stem cell lines and one human induced pluripotent stem cell line. Combined activation of ActivinA/Nodal signaling and GSK3-inhibition for the first 24h, followed by ActivinA/Nodal signaling efficiently induced the definitive endoderm state. Activation of ActivinA/Nodal signaling alone was not effective. Efficient GSK3-inhibition allowed the reduction of the ActivinA concentration during the entire protocol. A feeder-independent cultivation of pluripotent cells was preferred to achieve the high efficiency and robustness since feeder cells hindered the differentiation process. Additionally, inhibition of the PI3K signaling pathway was not required, nonetheless yielding high cell numbers efficiently committed towards the definitive endoderm. Finally, the endoderm generated could be differentiated further into PDX1-positive pan-pancreatic cells and NGN3-positive endocrine progenitors. Thus, this efficient and robust definitive endoderm differentiation protocol is a step forward towards better reproducibility due to the well-defined conditions based on dispersed single cells from feeder-free cultivated human pluripotent cells.

Page 4 of 56


4 INTRODUCTION Pluripotent cells like embryonic stem cells (ESCs) or induced pluripotent stem cells (iPSCs) represent an interesting cell source for regenerative medicine due to their unlimited selfrenewal potential and their capability to differentiate into all somatic cell types. Cell replacement therapies for degenerative liver, lung and pancreas diseases by surrogate cells are of great interest (for review see [1]). These organs are derived from the endoderm, which is one of the three primary germ layers next to ectoderm and mesoderm arising in a process called gastrulation (reviewed by [2]). A number of studies showed as proof of concept the in vitro generation of hepatocyte-like cells [3,4], lung/airway epithelial cells [5] or pancreatic cells [6,7] by directed differentiation of human ESCs (hESCs). Protocols aiming towards endoderm-derived cell types require as initial key step the efficient differentiation of ESCs into the definitive endoderm (DE) [8]. For the differentiation of human and mouse ESCs it is generally accepted that high concentrations of Activin A (ActA) direct this process by activating the TGF-beta signaling pathway [9,10]. However, it is not likely that this well concerted process is solely controlled by one pathway because it includes the differentiation of the epiblast-like hESCs [11], via the primitive streak to mesendodermal progenitor cells and finally their division into either mesoderm or endoderm. Consequently, most groups combine ActA with other molecules like Wnt3a [12,13], phosphatidylinositol 3-kinase (PI3K)-inhibitiors [14,15] or HDAC-inhibitors [16,17] to differentiate hESCs into the DE. More recently, it has been shown that inhibition of the PI3K signaling is beneficial for the DE differentiation with ActA [18]. Nearly all protocols initiate differentiation from human pluripotent cell colonies because it is the most popular cultivation technique either feeder-dependent or feeder-free. This complicates the adaption of published protocols by other laboratories due to the undefined starting conditions such as colony size, colony number per cavity, passaging procedure and a potential crosstalk between feeder cells and pluripotent cells during differentiation. Therefore,

Page 5 of 56


5 this study used dispersed single cells in defined cell numbers to differentiate human pluripotent stem cells into the DE lineage. These dispersed single cells can be differentiated efficiently into the DE by a combined treatment with CHIR-99021 (Chir), activating canonical Wnt signaling [19], and ActA for the first 24 h followed by ActA alone. Furthermore, an efficient inhibition of the GSK3 [19] allowed a reduction of the usual ActA concentration. An inhibition of PI3K was not necessary under these conditions, which resulted in a high proliferation rate during the differentiation process. Interestingly, an additional chemical inhibition of the PI3K decreased the proliferation rate without increasing efficiency. ESCs differentiated with this well-defined protocol were able to differentiate into the pancreatic lineage under appropriate conditions reflecting the functionality of the differentiated DE cells.

Page 6 of 56


6 MATERIALS & METHODS Human ESC culture Human ESC work was performed in accordance with the German Stem Cell Act. High priority of the research objectives in this study was confirmed by the Central Ethical Committee for Stem Cell Research (ZES) in Germany (Berlin). Approval of the experiments was granted by the Robert Koch-Institute (Berlin), which is the responsible authority for hESC research in Germany. Routine culturing of the hESC lines HUES4 and HUES8 was performed with minor changes as described earlier [17]. Briefly, hESCs were cultured as colonies on cell culture plates coated with hESC-qualified Matrigel (Corning, Amsterdam, Netherlands) according to the manufacturer’s instructions in mTeSR1 medium (StemCell Technologies, Köln, Germany) and passaged every 5-7 days. For passaging, the cells were incubated for 5-10 min with Dispase (1 U/ml - StemCell Technologies, Köln, Germany), washed twice with Knockout DMEM/F12 (Life Technologies, Darmstadt, Germany) and scraped with a 1 ml tip. The cells were re-seeded as clumps in a ratio of 1:2-6 in mTeSR1 medium on plates coated with Matrigel. The supernatant of this Matrigel coating, for routine feeder-free ESC cultivation, was collected and stored at 4°C for a maximum of 2 weeks. Such “re-used” Matrigel was employed for the coating of differentiation experiments equal to the normal Matrigel coating procedure. A third human ESC line, HES3 and the hiPSC line hCBiPS2 [20], were routinely cultivated on feeder cells as described elsewhere [21,22] with a split ratio of 1:8-12. To adapt these cell lines to the aforementioned feeder-free culture conditions they were passaged as clumps on Matrigel-coated plates in mTeSR1. After the first passage most of the feeder cells were removed and the cells were cultivated as described above with a split ratio of 1:6-12. Differentiation experiments from dispersed single cells ESC colonies were dissociated by washing once with Knockout-DMEM/F12 or PBS, incubated for 5-8 min with gentle cell dissociation reagent (StemCell Technologies, Köln,

Page 7 of 56


7 Germany) or Trypsin/EDTA, collected with Knockout-DMEM/F12 and centrifuged for 3 min at 300x g. The cell-pellet was re-suspended in mTeSR1 containing 10 µM Y-27632 (Selleck Chemicals, Munich, Germany). Cells were counted with the Cellometer Auto T4 counter (Nexcelom Bioscience, Lawrence, USA) and seeded on dishes coated with “re-used” Matrigel (see above) at densities of 95,000-100,000 cells/cm2 (HUES4 and HUES8) or 65,000-72,000 cells/cm2 (HES3) in mTeSR1 with 10 µM Y-27632 to allow re-attachment of the cells overnight. Advanced RPMI 1640 (Life Technologies, Darmstadt, Germany) supplemented with penicillin/streptomycin, Glutamax (Life Technologies, Darmstadt, Germany) and 0.2% FBS (PAA, Vienna, Austria) was used as base medium for all differentiation protocols. For randomized differentiation no substances were added. A classical definitive endoderm induction protocol [12] was applied as positive control using a sequential treatment with 25 ng/ml Wnt3a (Peprotech, Hamburg, Germany) and 100 ng/ml ActivinA (Peprotech, Hamburg, Germany) for the first 24 h without FBS, followed by a 72 h treatment with 100 ng/ml ActivinA plus 0.2% FBS. Differentiation exclusively via TGF-beta signaling was conducted with 50-100 ng/ml ActivinA. Inhibition of the GSK3 was performed with 5 µM CHIR-99021 (Biozol, Eching, Germany) and 50 or 100 ng/ml ActivinA for the first 24 h followed by 72 h cultivation in base medium supplemented with 50 or 100 ng/ml ActivinA. Inhibition of the PI3K was performed by supplementation of 10 µM LY294002 to the respective medium. Media were changed daily. Differentiation after DE induction was performed with minor modifications according to a published protocol [23]. Briefly, to induce a randomized differentiation, the medium was changed to DMEM (Life Technologies, Darmstadt, Germany) supplemented with penicillin/streptomycin, Glutamax, 1% B27 (Life Technologies, Darmstadt, Germany) and 50 ng/ml recombinant human FGF-10 (ReliaTech, Wolfenbüttel, Germany) for the following days. Directed differentiation into the pancreatic lineage was conducted with 2 µM retinoic

Page 8 of 56


8 acid (RA - Sigma-Aldrich, Taufkirchen, Germany), 1 µM Dorsomorphin (DM - Tocris Bioscience, Bristol, United Kingdom) and 10 µM SB-431542 (SB - Tocris Bioscience, Bristol, United Kingdom) supplemented to this medium. The medium was changed daily until day 10 of differentiation and thereafter every second day. Flow cytometry For flow cytometric analysis the in vitro differentiated cells were washed with PBS, dissociated using Trypsin/EDTA and resuspended in PBS plus 2% FBS. Antibody staining was performed following standard protocols. 2.5*105 cells were washed, incubated for 4560 min with primary conjugated antibodies, washed three times and measured with a CyFlow ML flow cytometer (Partec, Münster, Germany). At least 2.0*104 events of each sample were analyzed with FlowJo (Ashland, OR, USA). The fconjugated antibodies anti-human CD49eFITC (Biolegend, London, UK) and anti-human CXCR4-PE (Neuromics, Minneapolis, USA) were used. Gene expression analysis Isolation of total RNA was carried out with the RNeasy Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. Synthesis of cDNA was performed from 5002000 ng of total RNA per reaction using the RevertAid™ H Minus M-MuLV Reverse Transcriptase (Thermo Fisher Scientific, Braunschweig, Germany) with random hexamer primers (Life Technologies, Darmstadt, Germany). The cDNA samples were diluted and 515 ng (of the initially total RNA) was used per reaction. All reactions were performed on a ViiA7 real-time PCR system (Life Technologies, Darmstadt, Germany) with the following protocol: 50°C for 2 min, 95°C for 10 min and 40 cycles comprising a melting step at 95°C for 15 s and an annealing/extension step at 60°C for 60 s. To verify the correct amplification for SybrGreen-based PCR reactions a melting curve was performed. Each sample was amplified as triplicate using specific primer pairs or TaqMan assays (Supplementary Table 1). Data normalization was performed with qBasePlus (Biogazelle, Zwijnaarde, Belgium) against

Page 9 of 56


9 the geometric mean of the three housekeeping genes G6PD, TBP and TUBA1A. Analysis of stable expression of these housekeeping genes was performed in qBasePlus with the geNorm algorithm (all M-values < 0.5). Immunocytochemistry Immunocytochemistry was performed according to standard procedures. Briefly, hESCs were seeded on Matrigel-coated glass slides (Zellkontakt, Nörten-Hardenberg, Germany) and subjected to differentiation. Alternatively the cells were passaged on Matrigel-coated glass slides one day prior fixation in the respective medium containing 5 µM Y-27632. Cells were fixed in 4% (w/v) paraformaldehyde for 20-30 min at 4°C and subsequently blocked for 20 min in PBS plus 0.2% Triton X-100 with either 6% BSA plus 1 mg/ml NaBH4 or 5% donkey serum (Dianova,, Hamburg Germany). Primary and secondary antibodies were diluted in PBS with 0.1% Triton X-100 plus 0.1% BSA. Primary antibodies were incubated on the slides for 1-3 h at room temperature or overnight at 4°C. Secondary antibodies were diluted 1:250-500 and incubated for 1 h at room temperature. The following primary antibodies were used:

anti-SOX17

(R&D

Systems,

AF1924,

Minneapolis,

USA),

anti-FOXA2

(MerckMillipore, 07-633, Schwalbach, Germany), anti-Oct3/4 (SantaCruz, sc-5279, Heidelberg, Germany), anti-PDX1 (R&D systems, AF2419) and anti-NGN3 (R&D systems, AF3444). Secondary antibodies were obtained from Dianova (Hamburg, Germany) conjugated with AlexaFluor or Cy fluorophores. Finally, staining of the nuclei was performed with DAPI. Finally, the slides were mounted with Mowiol/DABCO (Sigma Aldrich, Taufkirchen, Germany) anti photo-bleaching mounting media. Stained cells were examined using an Olympus IX81 microscope (Olympus, Hamburg, Germany) and multiple representative pictures of each slide taken. Quantification of SOX17/FOXA2 double positive cells per picture was carried out by manual counting. Initially, double-positive cells were counted, followed by single positive cells and finally the nuclei to calculate the percentages of double-positive cells. The single positive

Page 10 of 56


10 cells were counted as negative for the subsequent quantification of double-positive cells. More than 4,000 nuclei were counted per condition from three independent experiments and representative pictures. Quantification of PDX1 and NGN3 single positive cells was performed with the BZ Analyzer Software (Keyence, Neu-Isenburg, Germany). More than 13,000 nuclei for PDX1 and more than 9,000 nuclei for NGN3 were automatically counted from different representative pictures for SM treated cells. Without SM treatment more than 3,000 nuclei (PDX1) or 4,000 nuclei (NGN3) were counted by the software, respectively. Statistics Unless stated otherwise the data values were expressed as mean ± SEM. Statistical analyses were performed using the GraphPad Prism analysis software (Graphpad, San Diego, CA, USA) applying Student’s t-test or ANOVA followed by Bonferroni’s or Dunnett’s post-hoctest for multiple comparisons.

Page 11 of 56


11 RESULTS Flow cytometric quantification of the definitive endodermal differentiation potential under different conditions Human ESC colonies were separated into single cells to obtain a defined starting population and were allowed to re-attach overnight on dishes coated with “re-used” Matrigel. Subsequent differentiation was performed under the conditions depicted in Fig. 1A. The two surface markers CXCR4 and CD49e were measured by flow cytometry for quantification of DEcommitted cells (Fig. 1B). Random differentiation (7.5 ± 0.8%) and the treatment with ActA alone (A) (7.6 ± 0.5%) did not yield high numbers of CXCR4-positive cells (Fig. 1C). The reference protocol (RP), published by D´Amour and coworkers [12], yielded significantly increased higher quantities (39.6 ± 5.3%). However, the combined treatment with Chir and ActA for the first 24 h followed by ActA alone (CA-A) resulted in an additional significant (> 2-fold) increase of CXCR4-positive cells (82.9 ± 1.4%) compared to the reference protocol (Fig. 1C). To exclude that the CA-A protocol was cell line dependent a second hESC line (HUES4) was subjected to these conditions with similar findings after four days of differentiation (Fig. 1D). This cell line yielded with the CA-A protocol 73.2 ± 1.6% of CXCR4-positive cells, a > 2-fold increase DE cells compared to the RP. In a recent publication [24] we could show that replacement of Wnt3a by Chir allowed a reduction of the typically required ActA concentration. Thus, 50 ng/ml ActA was used throughout the study but data for 100 ng/ml ActA were gathered additionally to exclude growth factor concentration effects (Suppl. Fig. 1A-D). The CA-A protocol revealed no differences between 50 and 100 ng/ml ActA (Suppl. Fig. 1A/B). This was also consistently observed for protocol A. Neither the flow cytometry data nor the gene expression data revealed any significant differences between 50 and 100 ng/ml ActA for HUES8 and HES3 cells (Suppl. Fig. 1A/C/D).

Page 12 of 56


12 Differentiation potential towards the definitive endoderm of HUES4 and HUES8 cells under these conditions Differentiated populations were analyzed upon the expression of GSC, SOX17 and FOXA2 by qPCR (Fig. 2A/B). GSC was significantly increased for CA-A treated cells compared to randomly differentiated samples after four days of differentiation. Only the CA-A protocol resulted in significant induced gene expression levels for the two DE marker genes SOX17 and FOXA2 compared to the RP (Fig. 2A). Overall these three genes showed the highest expression levels after CA-A treatment demonstrating the DE-commitment. Embryonic transcription factors (POU5f1 (OCT3/4), NANOG and SOX2) were expressed at very low levels after four days of differentiation with the CA-A protocol. The expression was similar or even lower compared to the Random protocol and significantly reduced compared to the RP (Fig. 2A and Suppl. Fig. 1E). The extra-embryonic marker gene SOX7 was equally induced in the RP and the CA-A condition and low in the Random protocol (Fig. 2A). Thus, both conditions induced some extra-embryonic endodermal cells without a correlation to the DE differentiation efficiency, indicating no favored extra-embryonic endodermal differentiation with the CA-A protocol compared to the RP. These expression pattern were in accordance with the flow cytometric data (Fig. 1C), thereby validating the two surface markers. The expression pattern of the second hESC line HUES4 were closely matching the data obtained with the HUES8 line (Fig. 2B). Nuclear co-localization of SOX17 and FOXA2 was regarded as a hallmark of definitive endoderm commitment and double-positive cells were quantified. Representative pictures of the HUES8 line are depicted in Fig. 2C and the quantification is shown in Fig. 2D. A nearly confluent double-positive layer for the CA-A protocol (82.9 ± 1.4% SOX17/FOXA2 doublepositive cells) was observed. The RP protocol (42.3 ± 2.2%) showed clusters of doublepositive cells, while the Random (5.3 ± 1.0%) and A protocol (13.6 ± 3.1%) showed only scattered double-positive cells (Fig. 2C/D). Single positive cells were seldom detected under

Page 13 of 56


13 all conditions (Fig. 2C, white arrowhead) and defined as negative for the quantification of double-positive cells. These results are in line with the flow cytometric quantification (Fig. 1C) and the gene expression analysis (Fig. 2A) substantiated the commitment of these cells into the DE lineage. Quantification of the second hESC line HUES4 (Fig. 2E) yielded similar results to those measured by flow cytometry (Fig. 1D) with significantly increased numbers of 23.7 ± 3.0% (RP) and 71.7 ± 2.9% (CA-A) of double-positive cells compared to randomly differentiated cells (Random). In summary, these results clearly demonstrate that the CA-A protocol was able to robustly and efficiently differentiate the dispersed single cells from both human ESC lines into the DE lineage. A third human ESC line differentiated as dispersed single cells into the definitive endoderm The HES3 cell line was routinely cultivated on feeder cells, which allowed the analysis of a) the effect of a feeder-dependent vs. feeder-free cultivation and b) the effect of mTeSR1 vs. conditioned feeder medium (MEF-CM) prior to the differentiation. HES3 colonies were directly dispersed together with the feeder cells, cultivated for one passage in mTeSR1 or MEF-CM, or under feeder-free conditions for at least 2 passages prior to differentiation. For the 24 h re-attachment phase either mTeSR1 or MEF-CM was used and differentiation was performed according to the specified protocols. No significant differences for all applied protocols could be detected under feeder-dependent vs. feeder-reduced conditions prior to differentiation. Only the CA-A protocol yielded for these conditions > 40% of CXCR4positive cells (Fig. 3A). Expression analysis of SOX17, FOXA2, and GSC confirmed this finding with significantly increased expressions only for the CA-A protocol (Suppl. Fig. 2A). In contrast, feeder-free cultivated HES3 cells yielded significantly increased numbers of CXCR4-positive cells (68.2 ± 4.9%) compared to all other conditions when differentiated with the CA-A protocol (Fig. 3A). Hence, the CA-A protocol works ideally with cells

Page 14 of 56


14 cultivated under feeder-free conditions and 2-3 passages without feeder cells were sufficient to ensure the efficient DE generation. In comparison to HUES4 and HUES8, HES3 cells reached 69.3 ± 3.9% of CXCR4-positive cells after four days of differentiation with the CA-A protocol, significantly increased numbers compared to all other protocols (Fig. 3B). As well for this hESC line a treatment only with ActA was not efficient to obtain sufficient numbers of DE-committed cells (Fig. 3B). The expression of the DE marker genes GSC, SOX17 and FOXA2 was significantly induced upon differentiation with the CA-A protocol, whereas the expression of the embryonic transcription factors POU5f1 (OCT3/4), NANOG and SOX2 exhibited low levels compared to undifferentiated cells as well as to the RP and A conditions (Fig. 3C and Suppl. Fig. 1E). Interestingly, the HES3 line exhibited a lower SOX7 expression in the RP compared to the CA-A condition (Fig. 3C) but also a lower DE efficiency compared to the HUES lines. Quantification of SOX17/FOXA2 double-positive cells revealed 64.3 ± 2.9% double-positive cells for the CA-A protocol (Fig. 3D) matching the flow cytometry results (Fig. 3B) and the gene expression analysis (Fig. 3C). Thus, the CA-A protocol also differentiated the third hESC line HES3 with high efficiencies into the DE lineage. Importance of cell number, concentration dependency and ECM matrix for the definitive endoderm differentiation from dispersed single cells To further define the conditions for an efficient DE generation, the optimal cell densities (cells per cm2) before initiation of the differentiation was assessed. HUES8 cells were passaged as single cells in the presence of Y-27632 and re-seeded with cell densities from 5.3x104 to 1.3x105 cells per cm2. Differentiation was initiated the next day by applying the CA-A protocol and DE-committed cells were quantified four days later by flow cytometric measurement of CXCR4-positve cells (Fig. 4A). Below 9.2x105 cells per cm2 the DE differentiation efficiency significantly decreased, whereas above this number no significant increase was detectable (Fig. 4A). This demonstrates the requirement of a minimal cell

Page 15 of 56


15 density to ensure a highly efficient DE differentiation with this protocol. For HES3 cells lower cell amounts were required to ensure the efficient DE differentiation compared to both HUES lines. This can be explained by the higher re-attachment rate of HES3 cells (~85-95%) compared to the HUES lines (~65-75%). Hence, the specific re-attachment rate of a particular cell line has to be considered to calculate the ideal cell density to ensure efficient and robust DE differentiation with the CA-A protocol. Furthermore, different concentrations of ActA and Chir were tested to define the required signaling intensities. HUES8 cells were subjected to the indicated concentrations after overnight re-attachment of the dispersed single cells in the presence of Y-27632 (Fig. 4B). Chir was first applied together with the indicated ActA concentration (first 24 h) and subsequently ActA was supplemented alone. HUES8 cells showed a minimally required concentration of 10 ng/ml ActA to ensure differentiation above background levels (zero ActA) (Fig. 4B). However, 25 ng/ml ActA resulted for all three tested Chir concentrations in significantly increased differentiation efficiencies (Fig. 4B). An initial concentration of 2.5 µM Chir was ideal and lower concentrations (1 µM Chir) yielded slightly decreased CXCR4-positive cell numbers, whereas 5 µM Chir had no beneficial effect. This result indicates that an activation of the Wnt/beta-catenin signaling pathway above a particular threshold may reduce the requirement of high ActA concentrations during endoderm differentiation. A comparison of these results with HUES4 cells (Suppl. Fig. 2B) revealed stronger dependency on the activation of the Wnt/beta-catenin signaling pathway than HUES8 cells. Only high concentrations of Chir (5 µM) permitted a decrease of the ActA concentration to 25 ng/ml (Suppl. Fig. 2B) without reducing the efficiency. Additionally, the effect of a “re-used” or fresh Matrigel surface was analyzed for HUES8 (Fig. 5A/B and Suppl. Fig. 2C) and HES3 cells (Fig. 5C/D and Suppl. Fig. 2D). No difference could be detected for the Random, RP and CA-A protocol for both cell lines in the flow cytometry analysis (Fig. 5A/C). The expression of different marker genes (POU5F1, SOX2,

Page 16 of 56


16 NANOG, SOX17, FOXA2, GSC and SOX7) was not significantly changed under the tested conditions between “re-used” and fresh Matrigel coating under the respective differentiation condition (Fig. 5 B/D and Suppl. Fig. 2C/D). PI3K inhibition and proliferation during differentiation McLean and co-workers [18] postulated that PI3K inhibition is a necessary prerequisite for the induction of the DE by ActA. Hence, four conditions were tested: PI3K activation within the Advanced RPMI 1640 (containing 10 mg/l insulin), regular RPMI 1640 medium, and the effect of the PI3K inhibitor LY294002 in both base media (Fig. 6 and Suppl. Fig. 3). In RPMI 1640 medium HUES8 cells yielded ~70% CXCR4-positive cells but only ~40% when Advanced RPMI 1640 was used (Fig. 6A). Addition of the PI3K inhibitor did not significantly change the outcome in RPMI 1640 medium but increased the quantity of CXCR4-positive cells in Advanced RPMI 1640. However, the proliferation rate during differentiation in RPMI 1640 medium, especially in the presence of LY294002, was significantly reduced compared to the CA-A protocol that revealed the highest increase in cell quantity (Table 1). Thus, an additional inhibition of the PI3K in Advanced RPMI 1640 medium was only beneficial for the RP indicating that this protocol is highly dependent on PI3K inhibition. In contrast, no increased efficiencies were detectable for the CA-A protocol, neither in Advanced RPMI 1640 or RPMI 1640 supplemented with LY294002 (Fig. 6A). A similar pattern of the changed efficiencies was detected for HES3 cells (Fig. 6B). The presence of LY294002 in RPMI 1640 resulted in a loss of cells (fold increase below 1) and the RNA quality in these cells was low, too, which excluded a reliable qPCR gene expression analysis for HUES8 cells (Fig. 6C and Suppl. Fig. 3A). Otherwise the gene expression profiles of the depicted marker genes (Fig. 6C and Suppl. Fig. 3A) were in accordance with the respective DE differentiation efficiency (Fig. 6A). Furthermore, the CA-A protocol exhibited the lowest expression values of the embryonic marker genes (POU5f1, SOX2 and NANOG) compared to the other conditions (Fig. 6C and Suppl. Fig. 3A). A nearly identical

Page 17 of 56


17 expression profile for these genes was measurable for HES3 cells (Suppl. Fig. 3B). Of particular interest is the observation that all protocols in RPMI 1640 exhibited much higher SOX7 expression levels for both hESC cell lines than in Advanced RPMI 1640 (Fig. 6C and suppl. Fig. 3B). The cell proliferation rate during differentiation is another important point to obtain large numbers of DE-committed cells. This was assessed by counting cells prior and after four days of differentiation to calculate the fold increase of cell quantity (Table 1). Compared to all other conditions, the CA-A protocol exhibited for the three hESC lines significantly increased proliferation rates with values around ~5-fold (HUES8) or ~8-fold (HUES4, HES3). PI3K inhibition decreased the proliferation and the change from Advanced RPMI 1640 to RPMI 1640 massively reduced the proliferation, which resulted in a lower cell number than initially seeded (Table 1). A possible strong proliferation of undifferentiated cells under the CA-A condition could be excluded by the very low expression of embryonic markers (POU5f1, SOX2 and NANOG), the distinctness of CXCR4 staining and immunofluorescent co-staining of OCT3/4 and SOX17 (Suppl. Fig. 3C). The differentiated population contained mainly SOX17-positive cells and a minority of OCT3/4-positive cells, which had obviously resisted the differentiation procedure. Seldom double-positive cells were detected (arrowhead, Suppl. Fig. 3C). A third rare population of cells was negative for both transcription factors indicating a differentiation into a different germ layer (arrow, Suppl. Fig. 3C). To demonstrate that the CA-A protocol is also able to differentiate human iPSCs into the DE the hCBiPS2 line [20] was subjected to the differentiation conditions. As controls the RP (in Advanced RPMI 1640 and RPMI 1640) and Random protocol were used. The CA-A protocol generated with the hiPSC line significantly increased numbers of CXCR4-positive cells (> 75%) compared to the RP in both media. Thus, the CA-A protocol is suited also for efficient hiPSCs differentiation into the DE lineage. Further developmental potential of the differentiated DE

Page 18 of 56


18 Next, the developmental potential of the differentiated DE was further characterized by in vitro differentiation towards the pancreatic lineage. HUES8 and HUES4 cells were initially differentiated into the DE with the CA-A protocol. Further differentiation towards the pancreatic lineage was performed with an adapted protocol published by Kunisada and coworkers [23]. For this purpose a combined treatment with SB-431542 (TGF-beta-inhibition), Dorsomorphin (BMP-inhibition) and retinoic acid (with SM, Fig. 7A - orange arrow) was applied. As a control condition, the small molecules were excluded from the medium (w/o SM, Fig. 7A - gray arrow) to permit a randomized differentiation. After four days of differentiation the embryonic transcription factors POU5F1, NANOG and SOX2 showed only low residual expression levels. Longer differentiation further decreased the expressions of POU5F1 and NANOG. In contrast, SOX2 expression increased after four days in the medium with SM (Suppl. Fig. 4A). GSC was highly induced at day four of differentiation and its expression decreased thereafter to low levels (Suppl. Fig. 4B). The SOX17 and FOXA2 gene expression peaked after four days but especially the FOXA2 expression remained high in the medium with SM. This is necessary because the expression of FOXA2 is passed from the DE towards the gut tube and the developing derivatives [25]. The early gut tube marker HNF1b showed the highest gene expression after six days and slightly decreased thereafter (Suppl. Fig. 4C). Expression levels of HNF6, a gut tube marker and required to specify different pancreatic lineages [26], were increased after six days of differentiation only in the medium with SM and remained at this level until day 14 (Suppl. Fig. 4C). As well PDX1, a pan-pancreatic marker, showed increased expressions only in the medium with SM. This expression was first detectable after six days of differentiation and increased until day 14. A marker for the dorsal pancreatic bud, MNX1 (HB9), exhibited an expression profile similar to that of PDX1 (Fig. 7B). PTF1a showed an inverse expression profile with a remarkable increase in randomly differentiated cells after eight days of differentiation (Fig. 7B). Maturation of these pancreatic progenitor cells towards the

Page 19 of 56


19 endocrine lineage is characterized by NGN3 expression, which increased dramatically after 10 days in the medium with SM (Fig. 7C). The same pattern, with a two day delay, was observed for NKX2.2 and NKX6.1 (Fig. 7C). Together with NGN3 these genes are considered as a hallmark of endocrine progenitors and their maturation. The expression pattern of differentiated hESC line HUES4 (Suppl. Fig. 5 and 6) showed nearly identical results compared to HUES8 cells. Expression levels of the embryonic transcription factors (Suppl. Fig. 5A) decreased rapidly. In contrast to this the expression of PS (Suppl. Fig. 5B) as well as definitive endoderm marker genes (Suppl. Fig. 5C) increased to their maximum after four days of differentiation. Only the high FOXA2 expression was passed in the medium with SM to the next differentiation stages. The gene expression of the early gut tube markers showed strong inductions after six days of differentiation and remained highly expressed in the medium with SM during further differentiation (Suppl. Fig. 5D). PDX1 and MNX1 (HB9) showed increased expression profiles only after cultivation with SM (Suppl. Fig. 6A). The expression of NGN3 increased distinctly after 10 days of differentiation, whereas NKX2.2 and NKX6.1 were strongly induced after 12 days of differentiation with SM (Suppl. Fig. 6B). Protein expression of PDX1 and NGN3 was analyzed by immunofluorescence staining after 10 or 14 days, respectively. Only very rare PDX1-positive cells were detectable after 10 days in the medium w/o SM. In contrast, the medium with SM frequently yielded PDX1expressing cells with different signal intensities (Fig. 7D). Quantification of the PDX1positive cells after 10 days (Fig. 7E) revealed significantly increased numbers in the medium with SM (46.3 ± 1.7%) compared to the medium w/o SM (2.4 ± 0.4%). Only differentiation with small molecules produced significant numbers of NGN3-positive cells (10.7 ± 0.8%, Fig. 5F) compared to w/o SM (0.3 ± 0.2%), which is in accordance with the gene expression analysis. These results clearly demonstrate that the DE-committed cells from dispersed single


Page 20 of 56

20

cells were able to differentiate further into the gut tube stage and subsequently into the

pancreatic lineage.

Page 21 of 56


21 DISCUSSION The in vitro differentiation of ESCs into adult cell types is a potential approach to generate surrogate cells for replacement therapies of degenerative diseases. Somatic cells derived from organs of the endoderm germ layer such as liver, lung or pancreas are of particular interest [1]. Endoderm derived cells require as a first step the differentiation towards the DE as a key stage [8] for further patterning towards the desired organ lineage [27]. Most protocols for DE differentiation are based on hESCs grown as colonies. Generally, hESC cell colonies are suboptimal for differentiation attempts due to the poorly defined starting conditions such as differences in colony sizes or colony numbers per cavity. Growth factors, cytokines or small chemical molecules added to the medium as directive cues may not uniformly activate all cells in a given colony. Finally, cell-to-cell contacts may alter extrinsic cell signaling. In addition ESCs grown on a feeder layer are hampered by cross-contamination with these mesenchymal cells. The contamination may influence the function and differentiation potential of hESCs. Therefore, a DE differentiation protocol based on dispersed single cells from feeder-free cultivated pluripotent cells with a defined cell number as starting population is a step towards better reproducibility. In the present study we described a very efficient and robust protocol fulfilling these criteria of feeder-free cultivated human pluripotent cells. The DE differentiation has earlier been considered as mainly ActA/Nodal dependent [9,12]. However, the results shown here and by others [24,28-30] demonstrate that ActA/Nodal signaling alone, independent from the strength, was not able to induce sufficient numbers of cells committed to the DE lineage. A combined activation of ActA/Nodal signaling and GSK3 inhibition by Chir for the first 24 h followed by ActA/Nodal signaling alone (CA-A protocol) was able to yield high numbers of cells truly committed to the DE from dispersed human pluripotent cells. HUES8 cells required lower Chir concentrations nevertheless ensuring an efficient DE induction compared to HUES4 and HES3 cells. This confirms results of Jiang

Page 22 of 56


22 and co-workers, who observed that HES3 cells expressed lower WNT3 levels resulting in a lower differentiation efficiency when compared to HUES8 cells [28]. In line with the earlier studies [24,28-30] this provided proof that the Wnt/beta-catenin pathway plays an important role during the early differentiation steps of the DE differentiation process. The different response to GSK3 inhibition demonstrates lineage propensities of pluripotent cells [31]. As in our recent publication [24], the required ActA concentration could be reduced upon replacement of Wnt3a by Chir. The differentiation efficiencies for the hESC lines HUES8 and HES3 in the study from Jiang et al [28] were lower compared to the described CA-A protocol. Furthermore, sufficient numbers of DE-committed cells could be differentiated with the CAA protocol from HUES4 cells (> 72%) and the hiPSC line hCBiPSC2 [20] (> 76%), demonstrating the robustness of this protocol using dispersed single cells as starting population. Inhibition of the PI3K was proposed to be required for the Nodal/TGF- -mediated differentiation of hESCs into DE [18]. According to our findings the RP highly depends on low or inhibited PI3K signaling because high DE efficiencies could only be obtained in RPMI 1640 medium with or without LY294002. An additional PI3K inhibition resulted also in Advanced RPMI 1640 in higher efficiencies. The advanced RPMI 1640 contains a high insulin concentration, which activates the PI3K signaling pathway. An activation of the PI3K signaling pathway is essential for growth and viability of cells in culture [36] and its inhibition in mESCs as well as their differentiated progeny decrease proliferation by accumulation of cells in the G1-phase [39]. This explains the higher proliferation rates in Advanced RPMI 1640 or generally in media without PI3K inhibition and the cytotoxicity observed in media with low or inhibited PI3K activity. The CA-A protocol is independent from PI3K inhibition, which is beneficial and superior to other reports [18,37]. An interesting aspect is that upon insulin stimulation GSK3β can be phosphorylated by AKT, a downstream

Page 23 of 56


23 kinase of the insulin receptor/PI3K pathway, resulting in its inactivation [40]. Therefore, an efficient GSK3 inhibition by Chir is probably supported by PI3K signaling. The supernatant of the Matrigel-coating for routine ESC cultivation could be used as coating matrix for differentiation experiments, which further reduces the costs and shows that this “reused” Matrigel is an adequate substrate for dispersed single cells. Other protocols applied an additional Matrigel layer on top of the cell monolayer to increase the robustness of the protocol by promoting the epithelial-to-mesenchymal transition during cardiomyocyte differentiation [32]. However, such a “Matrigel-sandwich” would complicate the procedure, since it is not necessary for the DE induction. Feeder cells, routinely used for long-term cultivation of ESCs, harbor the problem of a potential contaminating cell source during differentiation. Here, we demonstrated that feeder-free cultivated hESCs are generally preferable even though the cells could be differentiated directly with the feeder cells, albeit with lower efficiencies and higher variability between individual experiments. The beneficial feeder-free cultivation in this protocol is advantageous for potential clinical applications because feeder-dependent cultures are inappropriate for a therapeutic use of hESCs. The ability of the DE to differentiate into endoderm-derived organs was analyzed by differentiation towards the pancreatic lineage (adapted from [23]). The expression of the pluripotency associated genes quickly decreased but SOX2 was re-expressed after six days, when retinoic acid signaling combined with TGF-beta- and BMP-inhibition was applied. This, in combination with the expression profiles of HNF1B and HNF6, showed that the protocol with SM induced the foregut state because SOX2 is, next to its role during pluripotency, expressed mainly in the foregut of the developing embryo with functions for its later specification [33,34]. Interestingly, only the treatment with SM was able to induce a significant induction of the pan-pancreatic marker PDX1 that together with MNX1 (HB9) and HNF6 pattern the foregut/gut tube endoderm towards the pancreatic lineage. In particular the high MNX1 expression is interesting as this gene is a marker for the dorsal pancreatic bud [35-

Page 24 of 56


24 37]. High gene expressions of the transcription factors NKX2.2 and NKX6.1 noted upon cultivation with SM point to a further maturation of these pan-pancreatic progenitors. NKX2.2 is normally detected in the early pancreatic endoderm, it induces beta cell differentiation from NGN3-positive cells and has essential functions in adult beta cells [38]. NKX6.1 plays a similar role during development [38] and has recently been shown to be a crucial biomarker for the in vivo maturation potential of ES-cell derived pancreatic progenitors [39]. The pro-endocrine marker gene NGN3 is a target of HNF6 [25,26,40-42] and marks the transition towards a potential further endocrine differentiation. Therefore, the detectable high expression of NGN3 upon SM addition showed that the pancreatic progenitor cells matured and differentiated towards endocrine progenitors. Thus, the DE-committed cells, differentiated with the protocol described here, were capable for pancreatic differentiation up to endocrine progenitor cells. In summary, we present an efficient endoderm differentiation protocol, which is robust and reproducible using three different hESC lines and one hiPSC line. Furthermore, the starting conditions are well defined and allow differentiation in a medium with high PI3K signaling, yielding high cell numbers after endoderm commitment. Finally the differentiated endoderm is physiologically relevant and these DE cells could be directed into multipotent PDX1postive pan-pancreatic cells and NGN3-positive endocrine progenitors.

Page 25 of 56


25 ACKNOWLEDGEMENTS This work has been supported by the Deutsche Forschungsgemeinschaft (DFG, German Research Foundation) within the framework of the Cluster of Excellence REBIRTH (From Regenerative Biology to Reconstructive Therapy). The skilful technical assistance of Rebecca Straußis gratefully acknowledged. The authors thank Prof. F. Buettner, Dr. R. Zweigerdt and Prof. U. Martin for providing the HES3 and hCBiPS2 cell lines.

DISCLOSURE STATEMENT No conflicting financial interests exist.

CONFLICT OF INTEREST The authors declare no potential conflicts of interest.

Page 26 of 56


26 REFERENCES 1.

Naujok O, C Burns, PM Jones and S Lenzen. (2011). Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet? Mol Ther 19:1759-1768.

2.

Murry CE and G Keller. (2008). Differentiation of embryonic stem cells to clinically relevant populations: lessons from embryonic development. Cell 132:661-680.

3.

Agarwal S, KL Holton and R Lanza. (2008). Efficient differentiation of functional hepatocytes from human embryonic stem cells. Stem Cells 26:1117-1127.

4.

Cai J, Y Zhao, Y Liu, F Ye, Z Song, H Qin, S Meng, Y Chen, R Zhou, X Song, Y Guo, M Ding and H Deng. (2007). Directed differentiation of human embryonic stem cells into functional hepatic cells. Hepatology 45:1229-1239.

5.

Huang SX, MN Islam, J O'Neill, Z Hu, YG Yang, YW Chen, M Mumau, MD Green, G Vunjak-Novakovic, J Bhattacharya and HW Snoeck. (2014). Efficient generation of lung and airway epithelial cells from human pluripotent stem cells. Nat Biotechnol 32:84-91.

6.

Jiang W, Y Shi, D Zhao, S Chen, J Yong, J Zhang, T Qing, X Sun, P Zhang, M Ding, D Li and H Deng. (2007). In vitro derivation of functional insulin-producing cells from human embryonic stem cells. Cell Res 17:333-344.

7.

Kroon E, LA Martinson, K Kadoya, AG Bang, OG Kelly, S Eliazer, H Young, M Richardson, NG Smart, J Cunningham, AD Agulnick, KA D'Amour, MK Carpenter and EE Baetge. (2008). Pancreatic endoderm derived from human embryonic stem cells generates glucose-responsive insulin-secreting cells in vivo. Nat Biotechnol 26:443-452.

8.

Semb H. (2008). Definitive endoderm: a key step in coaxing human embryonic stem cells into transplantable beta-cells. Biochem Soc Trans 36:272-275.

9.

D'Amour KA, AD Agulnick, S Eliazer, OG Kelly, E Kroon and EE Baetge. (2005). Efficient differentiation of human embryonic stem cells to definitive endoderm. Nat Biotechnol 23:1534-1541.

10.

Kubo A, K Shinozaki, JM Shannon, V Kouskoff, M Kennedy, S Woo, HJ Fehling and G Keller. (2004). Development of definitive endoderm from embryonic stem cells in culture. Development 131:1651-1662.

11.

Tesar PJ, JG Chenoweth, FA Brook, TJ Davies, EP Evans, DL Mack, RL Gardner and RD McKay. (2007). New cell lines from mouse epiblast share defining features with human embryonic stem cells. Nature 448:196-199.

Page 27 of 56


27 12.

D'Amour KA, AG Bang, S Eliazer, OG Kelly, AD Agulnick, NG Smart, MA Moorman, E Kroon, MK Carpenter and EE Baetge. (2006). Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat Biotechnol 24:1392-1401.

13.

Mfopou JK, B Chen, I Mateizel, K Sermon and L Bouwens. (2010). Noggin, retinoids, and fibroblast growth factor regulate hepatic or pancreatic fate of human embryonic stem cells. Gastroenterology 138:2233-2245, 2245 e2231-2214.

14.

Cho CH, NR Hannan, FM Docherty, HM Docherty, M Joao Lima, MW Trotter, K Docherty and L Vallier. (2012). Inhibition of activin/nodal signalling is necessary for pancreatic differentiation of human pluripotent stem cells. Diabetologia 55:3284-3295.

15.

Zhang D, W Jiang, M Liu, X Sui, X Yin, S Chen, Y Shi and H Deng. (2009). Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulinproducing cells. Cell Res 19:429-438.

16.

Jiang J, M Au, K Lu, A Eshpeter, G Korbutt, G Fisk and AS Majumdar. (2007). Generation of insulin-producing islet-like clusters from human embryonic stem cells. Stem Cells 25:1940-1953.

17.

Naujok O and S Lenzen. (2012). A critical re-evaluation of CD24-positivity of human embryonic stem cells differentiated into pancreatic progenitors. Stem Cell Rev 8:779791.

18.

McLean AB, KA D'Amour, KL Jones, M Krishnamoorthy, MJ Kulik, DM Reynolds, AM Sheppard, H Liu, Y Xu, EE Baetge and S Dalton. (2007). Activin a efficiently specifies definitive endoderm from human embryonic stem cells only when phosphatidylinositol 3-kinase signaling is suppressed. Stem Cells 25:29-38.

19.

Lian X, C Hsiao, G Wilson, K Zhu, LB Hazeltine, SM Azarin, KK Raval, J Zhang, TJ Kamp and SP Palecek. (2012). Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling. Proc Natl Acad Sci U S A 109:E1848-1857.

20.

Haase A, R Olmer, K Schwanke, S Wunderlich, S Merkert, C Hess, R Zweigerdt, I Gruh, J Meyer, S Wagner, LS Maier, DW Han, S Glage, K Miller, P Fischer, HR Scholer and U Martin. (2009). Generation of induced pluripotent stem cells from human cord blood. Cell Stem Cell 5:434-441.

21.

Xu XQ, R Zweigerdt, SY Soo, ZX Ngoh, SC Tham, ST Wang, R Graichen, B Davidson, A Colman and W Sun. (2008). Highly enriched cardiomyocytes from human embryonic stem cells. Cytotherapy 10:376-389.

Page 28 of 56


28 22.

Konze SA, L van Diepen, A Schroder, R Olmer, H Moller, A Pich, R Weissmann, AW Kuss, R Zweigerdt and FF Buettner. (2014). Cleavage of E-cadherin and betacatenin by calpain affects Wnt signaling and spheroid formation in suspension cultures of human pluripotent stem cells. Mol Cell Proteomics 13:990-1007.

23.

Kunisada Y, N Tsubooka-Yamazoe, M Shoji and M Hosoya. (2012). Small molecules induce efficient differentiation into insulin-producing cells from human induced pluripotent stem cells. Stem Cell Res 8:274-284.

24.

Naujok O, U Diekmann and S Lenzen. (2014). The Generation of Definitive Endoderm from Human Embryonic Stem Cells is Initially Independent from Activin A but Requires Canonical Wnt-Signaling. Stem Cell Rev 10:480-493.

25.

Van Hoof D, KA D'Amour and MS German. (2009). Derivation of insulin-producing cells from human embryonic stem cells. Stem Cell Res 3:73-87.

26.

Murtaugh LC. (2007). Pancreas and beta-cell development: from the actual to the possible. Development 134:427-438.

27.

Spence JR, R Lauf and NF Shroyer. (2011). Vertebrate intestinal endoderm development. Dev Dyn 240:501-520.

28.

Jiang W, D Zhang, N Bursac and Y Zhang. (2013). WNT3 Is a Biomarker Capable of Predicting the Definitive Endoderm Differentiation Potential of hESCs. Stem Cell Reports 1:46-52.

29.

Sumi T, N Tsuneyoshi, N Nakatsuji and H Suemori. (2008). Defining early lineage specification of human embryonic stem cells by the orchestrated balance of canonical Wnt/beta-catenin, Activin/Nodal and BMP signaling. Development 135:2969-2979.

30.

Toivonen S, K Lundin, D Balboa, J Ustinov, K Tamminen, J Palgi, R Trokovic, T Tuuri and T Otonkoski. (2013). Activin A and Wnt-dependent specification of human definitive endoderm cells. Exp Cell Res 319:2535-2544.

31.

Osafune K, L Caron, M Borowiak, RJ Martinez, CS Fitz-Gerald, Y Sato, CA Cowan, KR Chien and DA Melton. (2008). Marked differences in differentiation propensity among human embryonic stem cell lines. Nat Biotechnol 26:313-315.

32.

Zhang J, M Klos, GF Wilson, AM Herman, X Lian, KK Raval, MR Barron, L Hou, AG Soerens, J Yu, SP Palecek, GE Lyons, JA Thomson, TJ Herron, J Jalife and TJ Kamp. (2012). Extracellular matrix promotes highly efficient cardiac differentiation of human pluripotent stem cells: the matrix sandwich method. Circ Res 111:1125-1136.

Page 29 of 56


29 33.

Ishii Y, M Rex, PJ Scotting and S Yasugi. (1998). Region-specific expression of chicken Sox2 in the developing gut and lung epithelium: regulation by epithelialmesenchymal interactions. Dev Dyn 213:464-475.

34.

Que J, T Okubo, JR Goldenring, KT Nam, R Kurotani, EE Morrisey, O Taranova, LH Pevny and BL Hogan. (2007). Multiple dose-dependent roles for Sox2 in the patterning and differentiation of anterior foregut endoderm. Development 134:25212531.

35.

Gradwohl G, A Dierich, M LeMeur and F Guillemot. (2000). neurogenin3 is required for the development of the four endocrine cell lineages of the pancreas. Proc Natl Acad Sci U S A 97:1607-1611.

36.

Harrison KA, J Thaler, SL Pfaff, H Gu and JH Kehrl. (1999). Pancreas dorsal lobe agenesis and abnormal islets of Langerhans in Hlxb9-deficient mice. Nat Genet 23:7175.

37.

Li H, S Arber, TM Jessell and H Edlund. (1999). Selective agenesis of the dorsal pancreas in mice lacking homeobox gene Hlxb9. Nat Genet 23:67-70.

38.

Gittes GK. (2009). Developmental biology of the pancreas: a comprehensive review. Dev Biol 326:4-35.

39.

Rezania A, JE Bruin, J Xu, K Narayan, JK Fox, JJ O'Neil and TJ Kieffer. (2013). Enrichment of human embryonic stem cell-derived NKX6.1-expressing pancreatic progenitor cells accelerates the maturation of insulin-secreting cells in vivo. Stem Cells 31:2432-2442.

40.

Jacquemin P, SM Durviaux, J Jensen, C Godfraind, G Gradwohl, F Guillemot, OD Madsen, P Carmeliet, M Dewerchin, D Collen, GG Rousseau and FP Lemaigre. (2000). Transcription factor hepatocyte nuclear factor 6 regulates pancreatic endocrine cell differentiation and controls expression of the proendocrine gene ngn3. Mol Cell Biol 20:4445-4454.

41.

Jacquemin P, FP Lemaigre and GG Rousseau. (2003). The Onecut transcription factor HNF-6 (OC-1) is required for timely specification of the pancreas and acts upstream of Pdx-1 in the specification cascade. Dev Biol 258:105-116.

42.

Pierreux CE, AV Poll, CR Kemp, F Clotman, MA Maestro, S Cordi, J Ferrer, L Leyns, GG Rousseau and FP Lemaigre. (2006). The transcription factor hepatocyte nuclear factor-6 controls the development of pancreatic ducts in the mouse. Gastroenterology 130:532-541.


Page 30 of 56

30

FIGURE LEGENDS

Page 31 of 56


31

Fig. 1. Comparative flow cytometric analysis of definitive endoderm development for the hESC lines HUES4 and HUES8 initiated from dispersed single cells. Human ESCs were dissociated into single cells, cultivated for 24 h (overnight) in the presence of Y-27632 in mTeSR1 and thereafter differentiated following the in (A) depicted protocols. The abbreviations of the different protocols used for further denotation are specified. (B) Representative flow cytometric dot plot diagrams of the HUES8 line after four days of differentiation under these conditions. Depicted is the staining of the definitive endoderm marker CXCR4 and the differentiation marker CD49e. The indicated numbers represent total CXCR4-positive cells from the upper left quadrant (CXCR4 single-positive cells) and the upper right quadrant (CXCR4/CD49e double-positive cells) detected in this particular experiment. (C-D) Quantification of the percentage of CXCR4-positive cells after four days of differentiation from the hESC lines HUES8 (C) and HUES4 (D). The respective treatments


Page 32 of 56

32

are specified with their abbreviations. Values are means ± SEM, from n=6-18 independent

experiments. ANOVA plus Bonferroni’s post-hoc test. ** p ≤ 0.01 compared to random

differentiated cells (Random) and

(RP). #

p ≤ 0.05, ##

p ≤ 0.01 compared to the reference protocol

Stem Cells and Development A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells (doi: 10.1089/scd.2014.0143) This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof. Page 33 of 56

33

Fig. 2. Gene and protein expression analysis of definitive endoderm generated from

HUES8 and HUES4 cells.

(A-B) Depicted are the relative gene expressions under the different conditions of marker

genes for the primitive streak/definitive endoderm (GSC, SOX17 and FOXA2), the extra-

Page 34 of 56


34 embryonic marker gene SOX7 and embryonic marker genes (POU5f1 (OCT3/4) and NANOG) of HUES8 (A) and HUES4 (B) cells after four days of differentiation. All expression values were normalized to three stably expressed housekeeping genes (G6PD, TUBA and TBP) and scaled to undifferentiated hESCs (set as one). Values are means ± SEM (n=5-10). ANOVA plus Bonferroni’s post-hoc test. * p ≤ 0.05, ** p ≤ 0.01 compared to the Random protocol and #

p ≤ 0.05, ## p ≤ 0.01 compared to the RP. (C) Representative fluorescence micrographs after

four days of differentiation illustrating the protein expression of SOX17 (green) and FOXA2 (red) in HUES8 cells. Nuclei were counterstained with DAPI (blue). The zoomed-in higher magnification shows the co-localization of the stained proteins in yellow with a designated single positive cell (white arrowhead, only SOX17-positive). Scale bar: 100 µm. (D-E) Percentages of SOX17/FOXA2 double-positive cells derived from the HUES8 line (D) or HUES4 line (E) after four days of differentiation. Single positive cells, which occurred very seldom, were counted as negative for the subsequent quantification of double-positive cells. Values are means ± SEM, n=4-6 independent experiments with at least four to six quantified random pictures per condition by manual counting. ANOVA plus Bonferroni’s post-hoc test. ** p ≤ 0.01, * p ≤ 0.05 compared to Random and # p ≤ 0.05, ## p ≤ 0.01 compared to RP.

Page 35 of 56


35

Fig. 3. Definitive endoderm differentiation from HES3 cells. Depicted in (A) are the percentages of CXCR4-positive cells of the hESC line HES3 after four days of differentiation. Indicated are a) the different ESC cultivation conditions (feederfree, feeder-depleted and short-time mTeSR1 adapted (feeder-free)) and b) the specified protocols applied for the differentiation. Thereby w/o is equal to the Random protocol. Values are means ± SEM, n=4-6 independent experiments. ANOVA plus Bonferroni’s post-hoc test. * p ≤ 0.05, ** p ≤ 0.01 compared to all other differentiation protocols within one ESC cultivation condition and

##

p ≤ 0.01 compared to all other CA-A conditions. (B) Percentages

Page 36 of 56


36 of CXCR4-positive from mTeSR1 adapted HES3 cells after four days of differentiation. Values are means ± SEM, n=6-12 independent experiments. ANOVA plus Bonferroni’s posthoc test. ** p ≤ 0.01 compared to Random and

##

p ≤ 0.01 compared to RP. In (C) are the

relative expressions of the marker genes GSC (primitive streak/definintive endoderm), SOX17 and FOXA2 (endodermal) as well as POU5f1 (OCT3/4) and NANOG (embryonic) of mTeSR1 adapted HES3 cells shown after four days of differentiation with the indicated protocols. Gene expressions were normalized to the stably expressed housekeeping genes (G6PD, TUBA, TBP) and scaled to undifferentiated HES3 cells. Values are means ± SEM, n=4-5 independent experiments. ANOVA plus Bonferroni’s post-hoc test. ** p ≤ 0.01 compared to Random and

#

p ≤ 0.05,

##

p ≤ 0.01 compared to RP. (D) Representative fluorescence

micrographs depicting the protein expression of SOX17 (green) and FOXA2 (red) in HES3 cells after four days of differentiation with either the Random or the CA-A protocol. Nuclei were counterstained with DAPI (blue). Quantification of the percentages of SOX17/FOXA2 double-positive cells derived from mTeSR1 adapted HES3 cells are shown in the bar diagram. Values are means ± SEM, n=4 independent experiments. At least four to six random pictures per condition of each independent experiment were quantified by manual counting of the double-positive cells. Student’s t-test ** p ≤ 0.01 compared to the Random protocol.

Page 37 of 56


37

Fig. 4. Minimally required cell densities and concentration dependencies of Chir and ActA for the definitive endoderm differentiation potential of HUES8 cells. (A) Flow cytometric analysis of CXCR4-positive cells in dependency on the cell density. Different numbers of cells were plated as dispersed single cells 24 h before differentiation with the CA-A protocol. Values are means ± SEM, n=5. ANOVA plus Bonferroni’s post-hoc test. ** p ≤ 0.01 compared to 9.2*104 cells per cm2 . (B) Concentration dependency of Chir and ActA for the DE differentiation efficiency. The specified concentrations of Chir were added for the first 24 h together with the denoted ActA concentrations. Further differentiation was carried out only with the indicated ActA concentrations for the next three days. Values are means ± SEM, n=4-5. ANOVA plus Bonferroni’s post-hoc test. ** p ≤ 0.01 compared to a protocol without any substances (w/o, identical to Random) and compared to the CA-A protocol as positive control.

#

p ≤ 0.05,

##

p ≤ 0.01

Page 38 of 56


38

Fig. 5. Effect of the fresh and “re-used” Matrigel for definitive endoderm differentiation. The flow cytometric quantification of CXCR4-positive cells after four days of differentiation is shown for the HUES8 line (A) and the HES3 line (C). Values are means ± SEM, n=3-6. ANOVA plus Bonferroni’s post-hoc test. The respective gene expression analysis of SOX17, FOXA2, SOX7 and POU5f1 is depicted in (B) for HUES8 cell and in (D) for HES3 cells. Expression values were normalized to the stably expressed housekeeping genes (G6PD,


39

TUBA and TBP) and scaled to the respective undifferentiated sample. Values are means ±

SEM, n=3-6. ANOVA plus Bonferroni’s post-hoc test.


Page 40 of 56

40

Fig. 6. Effects of PI3K signaling for the definitive endoderm formation and endodermal

differentiation potential of the human iPSC line hCBiPS2.

Page 41 of 56


41 Shown in (A-B) are the flow cytometric quantifications of CXCR4-positive cells after four days of differentiation for HUES8 cells (A) and HES3 cells (B). Denoted are the different media (Advanced RPMI 1640 or RPMI 1640), the applied protocols, and the additional PI3K inhibition by supplementation with 10 µM LY-294002. Values are means ± SEM, n=4-6. ANOVA plus Bonferroni’s post-hoc test. ** p ≤ 0.01 compared to the respective protocol in Advanced RPMI 1640 and # p ≤ 0.05, ## p ≤ 0.01 compared to the CA-A protocol as control. (C) Gene expression analysis of HUES8 cells differentiated for four days. Depicted are the normalized gene expression values of the marker genes SOX17, FOXA2, SOX7 and POU5f1 scaled to undifferentiated cells. The normalization was carried out against the housekeeping genes G6PD, TUBA and TBP. Values are means ± SEM, n=4-6. ANOVA plus Bonferroni’s post-hoc test. * p ≤ 0.05, ** p ≤ 0.01 compared to the respective protocol in Advanced RPMI 1640 and # p ≤ 0.05, ## p ≤ 0.01 compared to the CA-A protocol as control. (D) Depicted are the quantifications of CXCR4-positive cells after four days of differentiation for the human iPSC line hCBiPS2. The used protocols are indicated. Values are means ± SEM, n=3-6. ** p ≤ 0.01 compared to the RP in Advanced RPMI 1640.

Page 42 of 56


42

Fig. 7. The pancreatic differentiation potential of HUES8 cells upon definitive endoderm induction with the CA-A protocol from dispersed single cells. The two applied differentiation protocols for further differentiation towards the pancreatic lineage are shown in (A). DE differentiation was carried out with the CA-A protocol and further directed differentiation towards the pancreatic lineage was adapted with minor

Page 43 of 56


43 modifications from Kunisada and co-workers (SM) [23]. As a randomized control no small molecules (w/o SM) were added. (B-C) Depicted is the relative gene expression of marker genes

for

the

pancreatic

endoderm

(PDX1,

PTF1A

and

MNX1

(HB9))

and

maturation/endocrine progenitors (NGN3, NKX6.1 and NKX2.2). Expressions were normalized to three stably expressed housekeeping genes (G6PDH, TUBA, TBP) and scaled to undifferentiated Hues8 cells with the exception of PDX1, which is depicted in arbitrary units because an expression in ESCs was undetectable. Values are means ± SEM, n=4-6. (D) Representative fluorescence micrographs depicting the protein expression of PDX1 in HUES8 cells and NGN3 in HUES4 cells after 10 or 14 days of differentiation, respectively. Nuclei were counterstained with DAPI. (E) Percentages of PDX1-positive cells after 10 days of differentiation. Values are means ± SEM, n=3-4 independent experiments. Four to eight random pictures per experiment and condition were counted automatically with the BZAnalyzer software. The settings for counting were equal for the two conditions (w/o SM and with SM) but varied between the different magnifications of the pictures. Student’s t-test ** p ≤ 0.01 compared to w/o SM. In (F) are the percentages of NGN3-positive cells after 14 days of differentiation quantified. Values are means ± SEM, n=2. Of each experiment six pictures were counted with the BZ-Analyzer software as described for PDX1. Student’s t-test ** p ≤ 0.01 compared to w/o SM.

Page 44 of 56


44 Table 1: Fold increase in cell quantity of the different protocols and cell lines. fold increase in cell quantity (compared to day 0)

protocol

base medium

Random

advanced RPMI 1640

2.5 ±0.2 (n=13)

**

3.7 ±0.7 (n=6)

**

4.4 ±0.3 (n=14)

**

RP

advanced RPMI 1640

3.1 ±0.2 (n=11)

**

6.3 ±0.6 (n=12)

*

6.5 ±0.6 (n=10)

*

A

advanced RPMI 1640

2.6 ±0.2 (n=9)

**

5.5 ±0.3 (n=6)

**

5.6 ±0.5 (n=10)

**

CA-A

advanced RPMI 1640

4.8 ±0.2 (n=20)

RP + LY

advanced RPMI 1640

2.9 ±0.4 (n=6)

**

n.d.

5.1 ±0.1 (n=5)

*

CA-A + LY

advanced RPMI 1640

3.5 ±0.3 (n=5)

*

n.d.

5.2 ±0.2 (n=5)

*

RP

RPMI 1640

0.7 ±0.1 (n=6)

**

n.d.

2.2 ±0.5 (n=5)

**

RP + LY

RPMI 1640

0.6 ±0.1 (n=5)

**

n.d.

1.2 ±0.2 (n=4)

**

CA-A + LY

RPMI 1640

0.6 ±0.2 (n=4)

**

n.d.

0.6 ±0.2 (n=2)

**

HUES8

HUES4

8.5 ±0.9 (n=9)

HES3

8.1 ±0.5 (n=16)

The significant differences between the analyzed conditions were calculated by ANOVA followed by Dunnett’s post-hoc-test for multiple comparisons to the CA.A condition. LY = LY294002

Page 45 of 56


45 Supplementary Table 1: Standard qRT-PCR assays and used primer pairs Gene Symbol FOXA2 G6PD GSC HNF1b HNF6 MIXL1 MNX1 (HB9) NANOG NGN3 NGN3 NKX2.2 NKX2.2 NKX6.1 PDX1 POU5f1 PTF1a SOX2 SOX7(v2) SOX17 T TBP TUBA1A

Primer Sequence 5’-3’ Fw: gggagcggtgaagatgga Rev: tcatgttgctcacggaggagta Fw: aggccgtcaccaagaacattca Rev: cgatgatgcggttccagcctat Fw: gaggagaaagtggaggtctggtt Rev: ctctgatgaggaccgcttctg Fw: gaggaatgcaacagggcagaatg Rev: gaatgcctcctccttcctgcg Fw: cgctccgcttagcagcatgc Rev: gtgtgttgcctctatccttcccatg Fw: ccgagtccaggatccaggta Rev: ctctgacgccgagacttgg Fw: tccaccgcgggcatgatc Rev: gcttgggccgcgacaggta Fw: ccgagggcagacatcatcc Rev: ccatccactgccacatcttct Applied Biosystems Taqman Assay Hs00360700_g1 Fw: gcgaccagaagcccgctg Rev: ggcgtcatcctttctaccggc Applied Biosystems Taqman Assay HS00159616_m1 Fw: aaccccttctacgacagcagcg Rev: acttggagcttgagtcctgagggg Applied Biosystems Taqman Assay Hs00232355_m1 Applied Biosystems Taqman Assay Hs00426216_m1 Fw: cttgctgcagaagtgggtggagg Rev: ctgcagtgtgggtttcgggca Fw: ccatcggggcacccggtc Rev: tctggggtcctctggggtcca Fw: agctacagcatgatgcagga Rev: ggtcatggagttgtactgca Fw: gatgctgggaaagtcgtggaagg Rev: tgcgcggccggtacttgtag Applied Biosystems Taqman Assay Hs00751752_s1 Fw: tgcttccctgagacccagtt Rev: gatcacttctttcctttgcatcaag Fw: caacagcctgccaccttacgctc Rev: aggctgtggggtcagtccagtg Fw: ggcagtgtttgtagacttggaaccc Rev: tgtgataagttgctcagggtggaag

Exon spanning

Accession #

Yes

NM_153675.2

Yes

NM_000402

Yes

NM_173849.2

Yes

NM_000458.2

Yes

NM_004498.2

Yes

NM_031944.1

Yes

NM_005515

Yes

NM_024864.2

Yes

NM_020999

Yes

NM_020999

Yes

NM_002509

Yes

NM_002509

Yes

NM_006168.2

Yes

NM_000209

Yes

NM_001173531.2

Yes

NM_178161.2

Yes

NM_003106.3

Yes

NC_000008.11

Yes

NM_022454

Yes

NM_003181.2

Yes

NM_003194

Yes

NM_006009


Page 46 of 56

46

Page 47 of 56


47 SUPPLEMENTARY FIGURE LEGENDS Suppl. Fig.1: Concentration dependency of ActA during differentiation of hESCs with the CA-A and A protocol. The quantities of CXCR4-positive cells after four days of differentiation with the CA-A and A protocol (50 ng/ml ActA vs. 100 ng/ml ActA) are shown in (A) for HUES8 and HES3. Values are means ± SEM, n=3-5, Student’s t-test, n.s. = non-significant. (B) Gene expression analysis of SOX17, FOXA2 and GSC of HUES8 cells differentiated with the CA-A protocol with the indicated ActA concentration (CA-A (50) = 50 ng/ml ActA and CA-A (100) = 100 ng/ml ActA). The gene expression was normalized to the stably expressed housekeeping genes (G6PD, TUBA and TBP) and scaled to CA-A (50). Values are means ± SEM, n=3. (C-D) Gene expression analysis of SOX17, FOXA2, GSC, POU5f1, SOX2 and NANOG after four days of differentiation with the A protocol for HUES8 cells (C) and HES3 cells (D). Different ActA concentrations are specified (A (50) = 50 ng/ml ActA and A (100) = 100 ng/ml ActA). The gene expression was normalized to housekeeping genes (G6PD, TUBA and TBP) and scaled to CA-A (50).Values are means ± SEM, n=3-5, Student’s t-test. (E) SOX2 gene expression for all tested hESC lines and all tested protocols scaled to undifferentiated cells of the respective hESC line. Values are means ± SEM, n=4-10. ANOVA plus Bonferroni’s posthoc test. * p ≤ 0.05, ** p ≤ 0.01 compared to the Random protocol and # p ≤ 0.05, ## p ≤ 0.01 compared to the RP. Suppl. Fig.2: Gene expression analysis of HES3 cells cultivated under feeder-dependent or feeder-reduced conditions. Concentration dependency of Chir and ActA during DE induction of HUES4 cells. Gene expression data of fresh and “re-used” matrigel. (A) Gene expression profiles of SOX17, FOXA2 and GSC after four days of differentiation. HES3 cells were cultivated on feeder cells or one passage on matrigel to reduce the feeder cells prior initiation of the differentiation. Gene expression data were normalized to three

Page 48 of 56


48 stably expressed housekeeping genes (G6PD, TUBA and TBP) and scaled to undifferentiated HES3 cells. Values are means ± SEM, n=2-4. ANOVA plus Bonferroni’s post-hoc test. ** p ≤ 0.01 each condition compared with the w/o protocol (identical to Random) within the different cultivation groups. (B) Concentration dependency of Chir and ActA for the DE differentiation efficiency of the HUES4 cell line. Chir was added for the first 24 h together with ActA in the denoted concentrations. Further differentiation was carried out with ActA alone for the next 72 h in the respective concentration. Values are means ± SEM, n=2-4. ANOVA plus Bonferroni’s post-hoc test. ** p ≤ 0.01 compared to the differentiation without any substances (w/o, equal to Random) and

#

p ≤ 0.05,

##

p ≤ 0.01 compared to the CA-A

protocol as positive control. (C-D) Gene expression data of GSC, SOX2 and NANOG after differentiation with fresh or “re-used” matrigel for HUES8 (C) and HES3 (D). All values were normalized and scaled to undifferentiated cells. Values are means ± SEM, n=3-6. ANOVA plus Bonferroni’s post-hoc test. Suppl. Fig.3: Effect of the PI3K inhibition on the DE differentiation. (A) Gene expression analysis of GSC, SOX2 and NANOG shown for the different culture conditions with or without LY294002 in Advanced RPMI 1640 or RPMI 1640. All values are normalized to the stably expressed housekeeping genes (G6PD, TUBA and TBP) and scaled to undifferentiated HUES8 cells (set to one). Values are means ± SEM, n=4-6. ANOVA plus Bonferroni’s post-hoc test.

#

p ≤ 0.05 compared to the CA-A protocol. (B) Expression

analysis of definitive endoderm markers (SOX17, FOXA2 and GSC), embryonic transcription factors (POU5f1, NANOG and SOX2) and the extra-embryonic marker SOX7 under the above noted conditions. Values are means ± SEM, n=2-6. ANOVA plus Bonferroni’s post-hoc test. * p ≤ 0.05, ** p ≤ 0.01 compared to the respective protocol in Advanced RPMI 1640 and # p ≤ 0.05,

##

p ≤ 0.01 compared to the CA-A protocol. (C) Representative fluorescence

micrographs of HUES8 cells after four days of differentiation with the CA-A protocol or

Page 49 of 56


49 cultivated in mTeSR1 illustrating the protein expression of SOX17 (red) and OCT3/4 (green). Nuclei were counterstained with DAPI (blue). The white arrowheads mark SOX17/OCT3/4 double-positive cells and the white arrows cells negative for both transcription factors. Double positive cells were only detectable upon CA-A treatment. Scale bar: 50 µm. Suppl. Fig.4: Gene expression profiles after further differentiation of HUES8 cells towards the pancreatic lineage. (A) Expression profiles of the embryonic transcription factors POU5f1, NANOG and SOX2 during the further differentiation of HUES8 cells towards the pancreatic lineage. (B) Expression profiles of marker gene for the anterior primitive streak (PS) GSC, (C) the definitive endoderm (SOX17 and FOXA2), and (D) of the primitive gut tube markers HNF1b and HNF6 under the specified conditions. Normalization was carried out against stably expressed housekeeping genes (G6PDH, TUBA and TBP) and scaled to undifferentiated HUES8 cells. Values are means ±SEM, n=4-6. Suppl. Fig.5: Further differentiation potential of HUES4 cells differentiated as dispersed single cells into the definitive endoderm. HUES4 cells were differentiated towards the pancreatic lineage identically to the HUES8 cells. The CA-A protocol was applied until day four and further differentiation was either without small molecules (w/o) or in a medium containing the in Fig. 5A indicated small molecules (with SM). (A) Expression profiles of the embryonic transcription factors POU5f1, NANOG and SOX2 under the indicated conditions of the HUES4 cells line. Depicted is in (B) the gene expression profiles of the marker genes for the PS (GSC), in (C) for the definitive endoderm (SOX17 and FOXA2) and in (D) for the primitive gut tube (HNF1b and HNF6). Normalization was carried out against the stably expressed housekeeping genes (G6PDH, TUBA and TBP) and scaled to undifferentiated HUES4 cells. Values are means ± SEM, n=24.

Page 50 of 56


50 Suppl. Fig.6: Pancreatic differentiation potential of HUES4 cells differentiated as dispersed single cells into the definitive endoderm. (A) Depicted are the expression profiles for the pancreatic endoderm marker genes PDX1, PTF1A and MNX1 (HB9) and (B) NGN3, NKX6.1 and NKX2.2 as markers for their maturation into endocrine progenitors. Normalization was carried out as described and scaled to the expression of undifferentiated HUES4 cells with the exception of PDX1, which is depicted in arbitrary units because its expression in undifferentiated ES cells was not detectable. Values are means ±SEM, n=2-4.


51


Page 52 of 56

52


53


Page 54 of 56

54


55


Page 56 of 56

56

Improvement of Cell Survival During Human Pluripotent Stem Cell Definitive Endoderm Differentiation.

Efficient programming of human eye conjunctiva-derived induced pluripotent stem (ECiPS) cells into definitive endoderm-like cells.

Single-cell RNA-seq reveals novel regulators of human embryonic stem cell differentiation to definitive endoderm.

Differentiation of Definitive Endoderm from Human Induced Pluripotent Stem Cells on hMSCs Feeder in a Defined Medium.

Single-step protocol for the differentiation of human-induced pluripotent stem cells into hepatic progenitor-like cells.

Activin A can induce definitive endoderm differentiation from human parthenogenetic embryonic stem cells.

Collagen Type I Improves the Differentiation of Human Embryonic Stem Cells towards Definitive Endoderm.

Generation and Purification of Definitive Endoderm Cells Generated from Pluripotent Stem Cells.

Differentiation into Endoderm Lineage: Pancreatic differentiation from Embryonic Stem Cells.

Stauprimide Priming of Human Embryonic Stem Cells toward Definitive Endoderm.

Efficient Differentiation of Human Induced Pluripotent Stem Cell (hiPSC) Derived Hepatocyte-Like Cells on hMSCs Feeder.

Proneural transcription factor Atoh1 drives highly efficient differentiation of human pluripotent stem cells into dopaminergic neurons.

Protocol for the Differentiation of Human Induced Pluripotent Stem Cells into Mixed Cultures of Neurons and Glia for Neurotoxicity Testing.

Efficient endoderm induction from human pluripotent stem cells by logically directing signals controlling lineage bifurcations.

A Novel Protocol for Directed Differentiation of C9orf72-Associated Human Induced Pluripotent Stem Cells Into Contractile Skeletal Myotubes.

Improved efficiency of definitive endoderm induction from human induced pluripotent stem cells in feeder and serum-free culture system.

Functional differentiation of human pluripotent stem cells on a chip.

Human induced pluripotent stem cell differentiation and direct transdifferentiation into corneal epithelial-like cells.

Differentiation of pluripotent stem cells into hypothalamic and pituitary cells.

Differentiation of pluripotent stem cells into endothelial cells.

Differentiation potential of o bombay human-induced pluripotent stem cells and human embryonic stem cells into fetal erythroid-like cells.

Rapid and efficient differentiation of human pluripotent stem cells into intermediate mesoderm that forms tubules expressing kidney proximal tubular markers.

Rapid, efficient, and simple motor neuron differentiation from human pluripotent stem cells.

GATA6 is essential for endoderm formation from human pluripotent stem cells.