EX P ER I ME NTAL C EL L RE S E ARCH

3 22 (2014 ) 51 –61

Available online at www.sciencedirect.com

journal homepage: www.elsevier.com/locate/yexcr

Research Article

Efficient programming of human eye conjunctivaderived induced pluripotent stem (ECiPS) cells into definitive endoderm-like cells Mohammad Massumia,b,c,n, Elham Hoveizid, Parvaneh Baktasha, Abdollah Hootia, Leili Ghazizadeha, Samad Nadrib, Farzaneh Pourasgarie,f, Athena Hajarizadehf, Masoud Soleimanig, Mohammad Nabiunid, Mohammad R. Khorramizadehh,nn a

Induced Pluripotent Stem Cell Biotechnology Team, Stem Cells Department, National Institute of Genetic Engineering and Biotechnology, Tehran, Iran b Stem Cells Biology Department, Stem Cell Technology Research Center, Tehran, Iran c Department of Physiology, University of Toronto, Toronto, Ontario, Canada d Department of Biology, Faculty of Sciences, Kharazmi University (Tarbiat Moallem), Tehran, Iran e Department of Biotechnology, Razi Vaccine and Serum Research Center, Karaj, Iran f Molecular Biology and Genetic Engineering Department, Stem Cell Technology Research Center, Tehran, Iran g Department of Hematology, Faculty of Medical Science, Tarbiat Modares University, Tehran, Iran h Department of Medical Biotechnology, School of Advanced Medical Technologies, Tehran University of Medical Sciences, Tehran, Iran

article information

abstract

Article Chronology:

Due to pluripotency of induced pluripotent stem (iPS) cells, and the lack of immunological

Received 1 September 2013

incompatibility and ethical issues, iPS cells have been considered as an invaluable cell source for

Received in revised form

future cell replacement therapy. This study was aimed first at establishment of novel iPS cells,

15 December 2013

ECiPS, which directly reprogrammed from human Eye Conjunctiva-derived Mesenchymal Stem

Accepted 6 January 2014

Cells (EC-MSCs); second, comparing the inductive effects of Wnt3a/Activin A biomolecules to

Available online 13 January 2014 Keywords: Induced pluripotent stem cells Wnt3a Activin A Definitive endoderm IDE1

IDE1 small molecule in derivation of definitive endoderm (DE) from the ECiPS cells. To that end, first, the EC-MSCs were transduced by SOKM-expressing lentiviruses and characterized for endogenous expression of embryonic markers Then the established ECiPS cells were induced to DE formation by Wnt3a/Activin A or IDE1. Quantification of GSC, Sox17 and Foxa2 expression, as DE-specific markers, in both mRNA and protein levels revealed that induction of ECiPS cells by either Wnt3a/Activin A or IDE1 could enhance the expression level of the genes; however the levels of increase were higher in Wnt3a/Activin A induced ECiPS-EBs than IDE1 induced cells. Furthermore, the flow cytometry analyses showed no synergistic effect between Activin A and

Abbreviations: ECiPS, Eye conjunctiva-derived induced pluripotent stem; IDE1, Inducer of Definitive Endoderm1; DE, Definitive endoderm; GSC, Goosecoid n Correspondence to: Induced Pluripotent Stem Cell Biotechnology Team (iBT), Stem Cells Department, Division of Nanobiomaterials and Tissue Engineering, National Institute of Genetic Engineering and Biotechnology, 15th Km Tehran – Karaj Highway, P.O. Box 14965/161, Tehran, Iran. Fax: þ98 21 445 803 95. nn Correspondence to: Department of Medical Biotechnology, School of Advanced Technologies in Medicine, Tehran University of Medical Sciences, Eastern side of Tehran University, 88, Italia St, Tehran, Iran. Fax: þ98 21 889 911 17. E-mail addresses: [email protected] (M. Massumi), [email protected] (M.R. Khorramizadeh). URL: http://www.massumilab.com (M. Massumi).

0014-4827/$ - see front matter & 2014 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.yexcr.2014.01.006

52

E XP E RI ME N TAL C E L L R ES E ARC H

32 2 (2 014 ) 51 – 61

Wnt3a to derive DE-like cells from ECiPS cells. The comparative findings suggest that although both Wnt3a/Activin A signaling and IDE1 molecule could be used for differentiation of iPS into DE cells, the DE-inducing effect of Wnt3a/Activin A was statistically higher than IDE1. & 2014 Elsevier Inc. All rights reserved.

Introduction Embryonic stem (ES) cells isolated from inner cell mass of preimplanted blastocysts can be cultured in vitro indefinitely, and differentiated to all three-germ layers-derived cell lineages which is referred as pluripotency [1]. However, the immunological incompatibility and ethical issues have limited the idea of using ES cells for cell replacement therapy [2]. The induced Pluripotent Stem (iPS) cell technology, which firstly was introduced by Yamanaka, potentially could overcome these two important obstacles [3]. They demonstrated that mouse and human fibroblasts could be directly reprogrammed to iPS cells, which mimic phenotypes and genotypes of ES-cells, through induction by overexpression of OCT4, Sox2, Klf4 and c-Myc genes [3,4]. Furthermore, recent studies have demonstrated the efficient generation of patient-specific iPS cells from a variety of diseases, and subsequent differentiation of these cells into specialized cells replacing of defective cells. For instance, Melton0 s group established Type 1 Diabetes-specific iPS (DiPS) cells from fibroblasts isolated from two diabetic patients and differentiate them to insulin-producing cells [5]. In the other study, Jaenisch laboratory generated iPS cells from Parkinson0 s disease patients in a system free of viral reprogramming factors and differentiated them into dopaminergic neurons [6]. The potential of different cell types in reprogramming to pluripotent status has been evaluated by several investigations [7,8]. For instance, Aasen et al. demonstrated that derivation of iPS cells from keratinocytes is 100-fold more efficient and twofold faster in comparison with derivation from fibroblasts [8]. Recently, Tan et al. reported efficient reprogramming of muscle stem cells into iPS cells [7,8]. However, to the best of our knowledge there is no evidence to show iPS generation from human eye-derived stromal cells. The previous study has shown that eye conjunctiva derived mesenchymal stem cells [EC-MSCs, (CD105þ, CD73þ, CD44þ, CD166þ and CD13þ)], which express pluripotency markers such as OCT4, Nanog and Rex-1 in the level of transcription, could be isolated easily from conjunctival biopsies [9]. Conjunctival biopsy (CBX) has frequently used as a simple, safe, and diagnostic procedure for sarcoidosis [10,11]. As these cells express pluripotency-related transcription factors, they could be considered as a suitable eye-derived cell lineage for reprogramming into iPS cells. The subsequent differentiation of iPS cells into three germ layers (ectoderm, mesoderm and endoderm)-derived cell lineages has been enormously studied [5,6,12]. In this context, several investigations recently have been led to generate pancreatic insulin-producing-like cells from iPS cells [5,13,14]. Formation of definitive endoderm (DE) is the most important step in early development of pancreas [15,16]. As development progressing, epiblast cells internalize to the primitive streak and some of the internalized cells will eventually replace the visceral endoderm to give DE. Subsequently, DE cells will form the liver, pancreas and other organs of the gastrointestinal tract [15]. Therefore, any protocol, which can increase the efficiency of DE formation from

ES or iPS cells, would potentially result in efficient generation of eventual insulin-producing-like cells [17]. Indeed, the recent protocols, in which the in vivo pancreas development has been recapitulated sequentially in vitro, are more efficient in generation of insulin-producing cells from ES and iPS cells [5,18,19]. TGF-β superfamily signaling pathways play critical role in pancreas development. In mice, the signals from the notochord that include Activin-βB and FGF2 suppress Shh signaling within the endoderm, and promote pancreatic program [20]. Vincent et al. showed that endoderm during gastrulation with high levels of Nodal, a member of TGF-β super-family, will be specified to DE, and will give rise to mesoderm specification of endoderm when exposed lower levels of Nodal signaling [21]. However, another TGFβ family member, Activin A, which is simply accessible, binds the same receptors as Nodal, initiating similar intracellular signaling results, and thus can be used to mimic Nodal activity in vitro [22,23]. Wnt is another important signaling pathway involved in pancreas development. Several investigations demonstrated the direct participation of Wnt family members in regulating endoderm formation [24–26]. The lack of nodal expression in Wnt3a mutant mice, proposed that canonical Wnt3 signaling is involved in primitive streak and DE specification [24–26]. Recently, Toivonen et al. demonstrated that the timing and the length of Wnt3a induction of human pluripotent stem cells are determining factors in derivation of DE cells [27]. Considering the signaling pathways involved in DE formation and pancreas development, D’Amour et al. developed a five-step protocol for differentiation of hES cells into DE cell fate and subsequently to insulinexpressing cells [19]. They showed that hES-derived DE cells (Sox17þ/Cxcr4þ) could be differentiated into foregut endoderm (Hnf4aþ/Hnf1bþ), pancreatic endoderm (Nkx6.1þ/Pdx1þ) and endocrine precursors (Ngn3þ/Nkx2.2þ) and finally, insulinproducing cells [19]. Deriving endoderm from hES cells proved challenging, until incubation with Activin A and Wnt3a under low serum conditions resulted in cultures comprising 80% DE cells [18,19,28,29]. Melton0 s group showed that Activin A can be substituted by two cell-permeable small molecules, IDE1 and IDE2 (Inducer of Definitive Endoderm1 and 2) [30] for DE formation. These compounds induce nearly 80% of mouse and human ES cells to form DE; however, to the best of our knowledge, there is no available information about the effect of the components on human iPS cells. The use of these molecules should offer a more controllable and reproducible approach because they can be chemically synthesized in high purity allowing standardization between laboratories. The outstanding study in 2009 led in Melton0 s group demonstrated that established Type 1 Diabetes-specific iPS (DiPS) could be coaxed to DE formation by Activin A and Wnt3a induction [5]; however they did not report the ability of the DiPS in responding to IDE1. This study aims first at establishing novel iPS cells directly reprogrammed from human eye conjunctiva-derived MSCs, ECiPS cells, and second, comparing the inductive effects of Wnt3a/ Activin A to IDE1 in DE derivation from the ECiPS cells. Furthermore, in the present study for the first time, the response of iPS cells to IDE1 in DE differentiation is analyzed.

E XP E RI M ENTA L CE L L R E S EA RC H

Materials and methods Production of SOKM-harboring lentiviral particles To generate SOKM-harboring lentiviruses (LvSOKM), 293T cells (3  106 cells per 10 cm dish) were co-transfected with a mix of 10.2 μg of pMD2.G plasmid encoding the vesicular stomatitis virus glycoprotein (VSV-G) envelope, 10.2 μg of the psPAX2 packaging plasmid and 13.2 μg of the FUW-SOKM (Addgene plasmid 20325), a lentiviral Sox2-P2A-Oct4-T2A-Klf4-E2A-cMyc-harboring shuttle, using Lipofectamine2000 (Invitrogen) reagents according to manufacturer0 s instruction. To generate the GFP-harboring lentiviral particles (LvGFP) the GFP-carrying shuttle (pWPI, Trono lab, Switzerland) was co-transfected with psPAX2 and pMD2G plasmids into 293T cells as described above. The following day, the medium was changed with 7 ml of DMEM (Invitrogen) and further cultured for 24 h. The supernatant was then collected, cleared by centrifugation (3000 rpm, 15 min) and passed through a 0.8-μm filter. Viruses were further concentrated by ultracentrifugation at 25,000 rpm at 4 1C for 2 h and resuspend in 140 μl of DMEM/F12 supplemented with 10% FBS. To titer of the produced lentiviral particles, the 293T cells (3  105 cells per each well of 6-well plate) were transduced by 1, 5 or 10 μl of concentrated LvGFP suspension. Then, the cells were analyzed for GFP expression using flow cytometry and the viral titer was calculated.

Isolation and infection of human eye-derived stromal cells The stromal fibroblast-like cells were isolated as we previously described [9]. After characterizing of the cells by flow cytometry, 105 trypsinized EC-MSCs (CD105þ, CD73þ, CD44þ, CD166þ and CD13þ) cells (passage 3) were infected in a 60 mm dish by 3  106 LvOSKM particles, i.e. MOI (Multiplicity of Infection)¼30, diluted in 4 ml of DMEM/F12 medium supplemented by 10% FBS and polyberene (8 μg/ml). The cells were re-infected 24 h later by LvSOKM as above described. Three days after first infection, the cells were trypsinized and seeded on mitotically inactive MEF (mouse embryonic fibroblast) in 10 cm dish containing 10 ml of hES medium (DMEM/F12 supplemented with 15% KnockOut Serum Replacement (Invitrogen)) and 10 ng/ml bFGF (Invitrogen). Every individual human ES-like colony with distinctive border was picked up and transferred to a well of 24-well plate. After confluency, the ES-like cells were dissociated with collagenase type IV and transferred to 6-well plate and then to 75 cm2 flasks for further characterizations. After characterization of ECiPS clones, to void of a clone effect in further differentiation analyses, four clones were mixed together.

In vitro pluripotency analysis of generated ECiPS cells For spontaneous differentiation of ECiPS cells into endodermal and ectodermal cell lineages, the ECiPS cells were subjected to EB formation for 5 days in DMEM/F12 supplemented with 5% FBS. Then 30–50 EBs were plated in 24-well adhesive culture plates coated by gelatin (0.1%) and cultured in DMEM/F12 supplemented with 3% KnockOut Serum (Invitrogen) for ten more days. Then the differentiated cells were analyzed for the expression of endodermal-specific markers. To differentiate ECiPS cells into mesodermic cell lineages including osteocytes and chondrocytes, ECiPS cells were subjected to

322 (2014) 51 –61

53

EB formation in DMEM/F12 containing 20% knockout serum and 10 ng/ml bFGF for 5 days. Then 70–100 EBs were plated in 6-well adhesive culture plates coated by gelatin (0.1%) and cultured for two weeks in osteogenic medium (DMEM/F12 supplemented with 10% FBS, 10 mM β-glycerophosphate, 50 mg/mL ascorbic acid, and 100nM dexamethasone). Finally, the osteo-differentiated samples were fixed by 4% paraformaldehyde for 20 min and stained with Alizarin Red S for 2 min. The deposited calcium was detected in red by Alizarin Red S. For chondrogenic differentiation, the plated EBs were cultured in chondrogenic differentiation medium (DMEM/F12 supplemented with 2% FBS, 1  ITS, 50 mg/mL ascorbic acid, 100 nM dexamethasone, 40 mg/ml prolin, 10 ng/ml BMP-2 and 10 ng/ml TGF-β1) for three weeks. Then the differentiated cells were fixed with 4% formaldehyde for 20 min, and processed for Alcian blue staining. The adipogenic differentiation was induced as previously described [31]. Briefly, the monolayer ECiPS cells were cultured in adipogenic medium (DMEM/ F12 supplemented with, 10% FBS, 0.5 mM IBMX, 0.25 mM dexamethasone, 1 mg/ml insulin, 0.2 mM indomethacin and 1 mM pioglitazone) for three weeks. Then the differentiated cells were fixed and stained with Oil Red O.

Differentiation of ECiPS cells to DE-like cells The undifferentiated ECiPS cells were routinely cultured on MEF feeder cells in hES medium and split at the ratio of 1:10–1:12 every 8–10 days using 100 u/ml Collagenase type IV (Invitrogen). To differentiate the ECiPS cells onto DE-like cells, ECiPS cells [Passage 5 (P5)] were dissociated from MEF using Collagenase type IV and transferred to gelatin-coated 10 cm dishes in order to remove the MEF cells. After 15–30 min, the ECiPS cells-containing supernatants were collected and centrifuged for 5 min at 1000 rpm. Then, they were subjected to EB (Embryoid Body) formation in 6-well suspension-culture plate for 2 days at a density of 5  104 cells/ml in DMEM/F12 supplemented with 3% KnockOut Serum Replacement. Then 30–50 EBs were embedded in matrigel (0.1%; BD Biosciences, Bedford, UK)-containing DMEM/F12 supplemented with 3% KnockOut Serum Replacement for 5 min in a 15-ml tube by occasionally slow pipetting. Then the matrigel-embedded EBs were plated in 24well adhesive culture plates coated by matrigel (0.1%). To induce endodermal differentiation by signaling molecules, the day after plating, Activin A (100 ng/ml; R&D Systems) and Wnt3a (25 ng/ml; R&D System) were added to the medium. Two days later, the medium was replaced by DMEM/F12 supplemented with 1% KnockOut Serum Replacement and Activin A (100 ng/ml) and the differentiating-ECiPS cells were cultured for four days. To induce differentiation by small chemical molecule IDE1, the day after plating, IDE1 (1 μM) was added to the medium. The medium was changed every other day with IDE1-containig DMEM/F12 supplemented with 1% KnockOut Serum Replacement and the cells were analyzed six days after first treatment. The scheme of differentiation protocol has been summarized in Fig. 3.

Alkaline phosphatase staining and Immunocytochemistry (ICC) The Leukocyte Alkaline Phosphatase kit (Sigma-Aldrich) was used for Alkaline phosphatase staining. For immunocytochemistry, the differentiated and naïve human ECiPS cells were fixed with 4% paraformaldehyde (PFA, Sigma-Aldrich) for 25 min. After permebilization with 0.1% TX-100 in TBS (TBST), the cells were blocked

54

E XP E RI ME N TAL C E L L R ES E ARC H

32 2 (2 014 ) 51 – 61

for 30 min at room temperature with 5% BSA in TBST. Then, the cells were incubated with primary antibodies against OCT4 (Santa Cruz, sc-9081, 1:100), Nanog (Santa Cruz, sc-134218, 1:100), SSEA4 (AbCam, ab16287, 1:100), Tra-1-60 (AbCam, ab16288, 1:500), Sox17 (R&D Systems, AF1924, 1:200), Goosecoid (Santa Cruz, sc22234, 1:300), Foxa2 (Chemicon, AB4125, 1:500) diluted in 5% BSA in TBST overnight at 4 1C. Then the cells were washed and incubated with secondary antibodies: Alexa Fluor 488 donkey anti-mouse (Invitrogen, A-11001, 1:400), Alexa Fluor 594 donkey anti-rabbit (Invitrogen, A-21207, 1:400) or Alexa Fluor 488 donkey anti-goat (Invitrogen, A-11058, 1:400) for 45 min. The cells were washed again and incubated with DAPI (1:2000) during 5 min for nuclear staining.

differentiated ECiPS-EBs were trypsinized for 5 min with occasionally vigorous pipetting, and the single cells were collected by centrifugation. The pellets were washed twice with PBS and peremabilized by ice-cold MeOH for 20 min at room temperature. Then, the cells were incubated with DE-specific antibodies against Goosecoid (Santa Cruz, sc-22234, 1:100) or Foxa2 (Chemicon, AB4125, 1:200) diluted in 5% BSA in PBS overnight at 4 1C. Then the cells were washed twice with PBS and incubated with secondary antibodies: Alexa Fluor 488 donkey anti-goat (Invitrogen, A-11058, 1:400) or Alexa Fluor 488 donkey anti-rabbit (Invitrogen, A-21206, 1:200) diluted in PBS containing 1% BSA for 45 min at room temperature. Then the cells were washed twice with PBS and analyzed on Attune™ Acoustic Focusing Cytometer machine (Applied Biosystems).

Flow cytometry

Conventional and quantitative mRNA expression analysis

Flow cytometry analyses were accomplished to quantify the number of differentiated cells expressing DE-specific markers. To that end, the

To analyze the exogenous expression of SOKM genes after transduction, and the expression of pancreatic and hepatic

Table1 – Primers used for conventional and real time RT-PCR Gene

Accession no.

Primer sequence (50 –30 )

Size (bp)

exo-OCT4

NM_013633

233

56

exo-SOX2

NM_011443

157

55

exo-KLF4

NM_010637

212

57

exo-c-Myc

NM_010849

138

64

hNanog

NM_024865

82

60

hOCT4

NM_002701

284

57

hSOX2

NM_003106

153

62

hKLF4

NM_004235

303

57

hc-Myc

NM_002467

336

64

Pdx1

NM_000209

250

58

P48

NM_178161

156

60

TAT

NM_000353

140

60

TTR

NM_000371

140

60

Albumin

NM_000477

105

60

GSC

NM_173849

223

60

Foxa2

NM_153675.2

206

60

Sox17

NM_022454

102

60

HPRT

NM_000194

F:GGATGGCATACTGTGGAC R:CTTGGCAAACTGTTCTAGC F:CTGGAGAAGGGGAGAGATTTT R:CGTTAATTTGGATGGGATTGG F:ACTAACCGTTGGCGTGAG R:TAGCGAGTTGGAAAGGATAAA F:TGACCTAACTCGAGGAGGAGC TGGAATC R:AAGTTTGAGGCAGTTAAAATTA TGGCTGAAGC F:GCAGAAGGCCTCAGCACCTA R:AGGTTCCCAGTCGGGTTCA F:GCAGAAGGCCTCAGCACCTA R:AGGTTCCCAGTCGGGTTCA F:GGAAATGGGAGGGGTGCAAAA GAGG R: GCGTGAGTGTGGATGGGATT GGTG F:CCCAATTACCCATCCTTCC R:GTGCCTGGTCAGTTCATC F:CGTCCTGGGAAGGGAGATCCG GAGC R:GAGGGGCATCGTCGCGGGAG GCTG F:AAAGCTCACGCGTGGAAA R: GCTTCTTGTCCTCCTCCTT F: AGGCCCAGAAGGTCATCATC R: TCCAGACTTTGGCTGTTCGG F:CCCTTCTGGGGCTATGTACC R:TCGGGTACTCAAAGCACGTT F:ACCGGTGAATCCAAGTGTCC R:TCACTGGTTTTCCCAGAGGC F:TAAGGAGACCTGCTTTGCCG R:TCTCATGGTAGGCTGAGATGC F:GCTTCTCAACCAGCTGCAC R:CTGATGAGGACCGCTTCTG F:GTCTGAGGAGTCGGAGAG R:ACGGAGGAGTAGCCCTC F:ATGGTGTGGGCTAAGGAC R:AGCGCCTTCCACGACTTG F:AGCCAGACTTTGTTGGATTTGA R:GAACTCTCATCTTAGGCTTTGT

145

55–60

Annealing(1C)

E XP E RI M ENTA L CE L L R E S EA RC H

markers in the spontaneous differentiated ECiPS cells the conventional reverse transcriptase-polymerase chain reaction (RTPCR) were performed. Furthermore, The mRNA expression levels of the DE-specific markers in the ECiPS-derived DE-like cells were quantified by quantitative RT-PCR. To this end, total RNA was extracted by QIAzol lysis reagent and for genomic DNA digestion, it was treated with DNase I (Ambion). RNA (2–5 μg) was reverse transcribed by TaqMan Reverse Transcription Kit (Applied Biosystems) using random hexamer primer mix according to the manufacturer0 s instructions. Quantitative PCR reactions were performed in the 48-well optical reaction plates on StepOne™ Real-Time PCR System. For each reaction, the synthesized cDNA (40 ng) was subjected to PCR by mixing with 10 μL of Power SYBR Green master mix (2  , Applied Biosystems), 0.5 μM of each primer (Table 1) in a total volume of 20 μL at the annealing temperature mentioned in Table 1. The threshold cycle (Ct) of each target gene obtained from StepOne software (Applied Biosystems) was normalized by HPRT as internal standard gene. The comparative 2  ΔΔCt method was applied to calculate the relative quantity of target gene expression in each sample to control. The relative gene expression values were presented as mean of three independent experiments.

Statistical analysis For statistical analysis, Mann–Whitney U test type from twoindependent samples test was applied, and significant differences were expressed by p value. All the results in this study are presented as Means7SD.

Results Generation and characterization of human ECiPS cells We have already demonstrated that EC-MSCs could be characterized by presence of CD105, CD73, CD44, CD166 and CD13 markers on their cell surfaces [9]. The EC-MSCs were isolated as we previously described, and confirmed for the expression of cell surface markers using flow cytometry (data not shown). To generate ECiPS cells, the characterized EC-MSCs (passage 3) were transduced by LvSOKM (Sox2-P2A-Oct4-T2A-Klf4-E2A-cMyc-harboring lentiviruses) particles as MOI¼ 30. Four weeks after transduction, the iPS-like colonies with distinctive borders, and contain cells with high ratio of nucleus to cytoplasm (Fig. 1B) were picked up and analyzed for expression of endogenous and exogenous pluripotency markers using RT-PCR (Fig. 1A). As shown in Fig. 1A the expression of exogenous pluripotency inducing transcription factors including exo-OCT4, -SOX2, -KLF4 and –cMyc as monocistronic cassette could switch on the expression of endogenous SOX2, and c-Myc and up-regulate endogenous expression of OCT4, KLF4 and Nanog in different reprogrammed ECiPS clones. To avoid a clone effect on further differentiation analyses, four eye conjunctiva-derived iPS-like clones (clones ECiPS1-10, ECiPS2-14, ECiPS2-21 and ECiPS2-22 in Fig. 1A) were mixed and further characterized. The alkaline phosphatase staining for generated iPS-like clones showed a homogenous pattern amongst the colonies implying expression of the embryonic stem cell-specific alkaline phosphatase enzyme in the generated ECiPS cells (Fig. 1C). The expression of endogenous OCT4 and Nanog was

322 (2014) 51 –61

55

confirmed in ECiPS cells by immunofluroscent staining (Fig. 1D and E, respectively). Furthermore, the expression of SSEA4 (Fig. 1F) and Tra-1-60 (Fig. 1G) proteins as embryonic pluripotent stem cell markers [4] was detected in the ECiPS clones. All result together confirmed that the generated ECiPS resemble the features of human pluripotent stem cells including morphology, the expression of endogenous pluripotency transcription factors (OCT4, SOX2 and Nanog) and embryonic stem cell-specific proteins such as alkaline phosphatase, SSEA4 and Tra-1-60.

In vitro differentiation of ECiPS cells into three germ layer-derived cells To evaluate the pluripotency of the generated ECiPS cells, they were spontaneously differentiated into endodermal and ectodermal cell lineage fates. To that end, the ECiPS cells were subjected to EB formation for 5 days, and then ECiPS-EBs were spontaneously differentiated for ten days. The gene expression analysis of differentiated ECiPS-EBs revealed the expression of early panpancreatic endoderm gene Foxa2, Pdx1 as marker of posterior foregut endoderm, and p48 (Ptf1a) as early transcription factor involved in the development of pancreas [18] in the mRNA level (Fig. 2A). Furthermore, the early marker of hepatic differentiation Albumin and the late markers TAT (Tyrosine Aminoransferase) and TTR (Transthyretin) were expressed with low level in the differentiated ECiPS-EBs (Fig. 2A). The expression of Nestin (early neuroectoderm marker), MAP2 and Tau as mature neuron markers was confirmed in mRNA levels in spontaneously differentiated cells (Fig. 2A). Furthermore, the morphology monitoring of the spontaneous differentiated ECiPS-EBs showed neural-like cells with long neurite outgrowths in the edges of differentiating ECiPS-EBs (Fig. 2B). To evaluate the potency of generated ECiPS cells for derivation of mesodermic cell lineages including osteocytes, chondrocytes and adipocytes, the ECiPS were induced by signaling molecules. For osteogenic differentiation, the induced ECiPS-EBs were stained by Alizarin Red S for calcium deposition. Major of osteogenic-coaxed ECiPS-EBs were stained by Alizarin Red S, showing the ability of the generated iPS cells for undertaking the osteocyte fate (Fig. 2C). Furthermore, as shown by Alcian blue staining (Fig. 2D) the ECiPS-EBs induced by ascorbic acid, dexamethasone, Prolin, BMP-2 and TGF-β1 molecules were differentiated into chondrocytes implying the ability of the iPS cells in response into the standard chondrogenic signaling molecules. To prove the potency of the iPS cells in derivation of adipocytes, the monolayer of ECiPS cells were induced by IBMX, dexamethasone, insulin, indomethacin and pioglitazone as previously described [31]. The Oil Red O staining confirmed the abundant synthesis of lipids and triglycerides in the differentiated ECiPS cells (Fig. 2E). All of the in vitro differentiation results together confirmed that the established ECiPS cells are pluripotent and have ability to differentiate to all three-germ layer (ectoderm, mesoderm and endoderm)-derived specialized cells.

Derivation of DE from ECiPS cells using Wnt3a/Activin A or IDE1 For efficient derivation of DE from human ECiPS cells two protocols applied and the efficiencies were compared. To that end, the undifferentiated ECiPS cells (P5) were induced by either

56

E XP E RI ME N TAL C E L L R ES E ARC H

32 2 (2 014 ) 51 – 61

exo-OCT4 exo-SOX2 exo-KLF4 exo-c-Myc hNanog hOCT4 hSOX2 hKLF4 hc-Myc HPRT

Fig. 1 – Characterization of generated ECiPS cells. (A) RT-PCR analysis of exogenous (exo-, mouse) and endogenous (h, human) expression of Sox2, OCT4, KLF4, c-Myc (SOKM) and Nanog in different generated clones, four weeks after transduction. (B) The morphology of generated ECiPS cells. (C) Alkaline phosphatase staining. Immunofluorescent staining for endogenous pluripotency-related proteins OCT4 (D) and Nanog (E), and ES specific markers SSEA4 (F) and Tra-1-60 (G) in the generated ECiPS cells,

Wnt3a/ActivinA or IDE1 signaling molecules through a protocol illustrated in Fig. 3B. IDE1 and IDE2, which were firstly described by Melton laboratory, are two cell-permeable small molecules that induce differentiation of human and mouse ES cells into DE cells [30]. IDE1 functions through activation of TGF-ß signaling, as evident by Smad2 phosphorylation [30]. In the first step, the ECiPS cells were subjected to EB formation for two days (Fig. 3A). Then, the differentiating ECiPS cells were plated on Matrigel and induced by either Wnt3a/Activin A [two days with Wnt3a (25 ng/ ml) and Activin A (100 ng/ml) followed by four days with Activin A (100 ng/ml)], or IDE1 (1 μM) for four days (Fig. 3B). Expression analysis of GSC (Goosecoid) gene, expressed early in mesendoderm and later limited to DE, showed that although the expression increased in IDE1 treated ECiPS-EBs (21.12 folds), the level of increase even was (po0.05) higher in differentiated ECiPS-EBs treated by Wnt3a/Activn A (26.84 folds, Fig. 4). Quantification of mRNA levels of Sox17 and Foxa2 (HNF3ß), as early panendodermal transcription factors which are limited later into DE during embryogenesis, using RT-PCR revealed that induction of ECiPS-EBs by either Wnt3a/Activin A or IDE1 could enhance the transcripts level of the genes; however the levels of increase was

statistically higher in Wnt3a/Activin A induced ECiPS-EBs (Sox17¼ 18.53 folds, Foxa2¼ 27.96 folds) than IDE1 induced ECiPS-EBs (Sox17 ¼12.62 folds, Foxa2¼14.64). To evaluate the efficiency of DE differentiation protocols in the level of protein, the expression of the DE specific transcription factors, GSC, Sox17 and Foxa2 was studied by immunofluorescent staining (Fig. 5A–I). Furthermore, to quantify percentage of transcription factor-expressing EBs, the number of antigenpositive EBs was counted in 20 different fields and graphed (Fig. 5J). As shown in Fig. 5A–I, treatment of established ECiPS cells by either Wnt3a/Activin A or IDE1 could increase the expression and nuclear localization of GSC (Fig. 5A–C), Sox17 (Fig. 5D–F) and Foxa2 (Fig. 5G–I) transcription factors. However the number of GSCþ, Sox17þ or Foxa2þEBs in Wnt3a/ActivinA treated ECiPS-EBs cells were more than IDE1 treated ECiPS-EBs cells. Given the enhanced expression of DE-specific transcription factors (GSC, Sox17 and Foxa2) in the levels of mRNAs (Fig. 4) and proteins (Fig. 5), the results argue that although the treatment of ECiPS by either IDE1 or Wnt3a/Activin A could increase the efficacy of DE differentiation, Wnt3a/Activin A has more augmentative effect than IDE1 in driving the DE programming fate.

E XP E RI M ENTA L CE L L R E S EA RC H

57

322 (2014) 51 –61

Fig. 2 – The pluripotency analysis of generated ECiPS cells. (A) The gene expression analysis of spontaneous differentiated ECiPS-EBs by RTPCR for Pdx1, p48 and Foxa2 as pancreas development-related genes, and TAT, TTR and Albumin as hepatic specific markers in differentiated ECiPS-EBs. (B) The morphology monitoring of the spontaneous differentiated ECiPS-EBs into neural-like cells. (C–E) Alizarin Red S (C), Alcian blue (D) and Oil Red O (E) staining to determine respectively the osteogenic, chondrogenic and adipogenic differentiation.

Relative expression

35 30

*

25

ECiPS-EBs ECiPS-EBs/Wnt3a+AA ECiPS-EBs/IDE1

**

*

20 15 10 5 0 GSC

Suspension culture in DMEM/F12+ 3%SR

Plating on Matrigel DMEM/F12 +3%SR

2 days

1 day

ECiPS OCT4

Activin A/ Wnt3a or IDE1 in DMEM/F12 +3%SR 2 days

Activin A or IDE1 in DMEM/F12+3%S R

Sox17

Foxa2

Fig. 4 – Effect of Wnt3a/Activin A and IDE1 in derivation of DE cells from generated ECiPS cells. Relative expression of GSC, Sox17 and Foxa2 genes in Wnt3a/Activin A or IDE1 treated ECiPS-EBs to non-treated ECiPS-EBs was analyzed by RT-PCR (n¼ 3, nPo0.05, nnPo0.01).

4 days

DE

Foxa2

Nanog

GSC

SSEA4

Sox17

Tra-1-60

Fig. 3 – DE differentiation protocol scheme. (A) EBs, two days after formation. (B) The cells were induced by either Wnt3a/ Activin A or IDE1 mentioned in scheme. In the end of protocol, the expression of DE specific genes indicated in scheme was analyzed by real time RT-PCR.

differentiated cells could express GSC, early DE marker, after induction with Activin A or Wnt3a/Activin A respectively. Furthermore, 39% and 41.8% of differentiated ECiPS cells respectively treated by Activin A or Wnt3a/Activin A were positive for Foxa2 expression (Fig. 6B and D). Therefore, the flow cytometry analyses showed no significant differences in expression of DE markers in differentiated cells either by Activin A or Wnt3a/Activin A, implying the lack of augmentative effect of Wnt3a in derivation of DE-like cells from ECiPS cells.

Discussion The efficiency of DE derivation from human ECiPS in response to Activin A was compared to Wnt3a/Activin A treatment using flow cytometry. As shown in Fig. 6A and C, 23.6% and 24.7% of

We have already shown that EC-MSCs cells characterized by the presence of CD105, CD73, CD44, CD166 and CD13 cell surface

58

E XP E RI ME N TAL C E L L R ES E ARC H

ECiPS-EBs/Wnt3a+AA

ECiPS-EBs/IDE1

(Positive EBs/Total EBs)%

Foxa2/DAPI

Sox17/DAPI

GSC/DAPI

ECiPS-EBs

32 2 (2 014 ) 51 – 61

*

70 60

***

*

***

ECiPS-EBs ECiPS-EBs/Wnt3a+AA ECiPS-EBs/IDE1

***

50

*

40 30 20 10 0 GSC

Sox17

Foxa2

Fig. 5 – Detection of DE-markers in differentiated ECiPS cells. (A) Immunostaining of either Wnt3a/Activin A or IDE1 BBA treated/ differentiated ECiPS-EBs cells for GSC, Sox17 and Foxa2, showing that most of EBs could express these proteins and localize them in nuclei. The cells were co-stained by DAPI to show the nuclear localization. (B) Quantification of GSCþ, Sox17þ or Foxa2þ EBs showed more antigen-positive EBs in Wnt3a/Activin A treated than IDE1treated ECiPS-derived DE-like cells (n¼3, nPo0.05, nnnPo0.001).

markers [9], could express OCT4, Nanog and Rex-1 mRNAs in the low level as we also proved here in both mRNA (Fig. 1A) and protein (Fig. 1D and E) levels. The RT-PCR confirmed the low level expression of KLF4 in the EC-MSCs. As the cells express endogenously the low levels of OCT4, Nanog and KLF4, as pluripotency-related transcription factors, we suggested the suitability of the ECiPS cells to be reprogrammed into iPS cells. To that end, the pluripotency inducing mouse transcription factors were overexperresed in ECiPS via SOKM-expressing lentiviruses. The human iPS-like colonies were picked up in expected time and the mRNA profile confirmed the induction of endogenous c-Myc and SOX2 genes expression and up-regulation of endogenous OCT4,

Nanog and KLF4 in response to the ectopic SOKM expression. The alkaline phosphatase and immunofluorescent staining for OCT4 and SOX2 revealed the homogenous expression of the ES-specific alkaline phosphatase enzyme and endogenous OCT4 and Sox2 respectively, in generated ECiPS cells. Additionally, the expression of SSEA4 and Tra-1-60 proteins as ES cell surface markers [4] was detected in the generated ECiPS clones. The analyses of gene expression demonstrated the expression induction of Foxa2, early pan-pancreatic endoderm, Pdx1 as marker of posterior foregut endoderm, and p48 (Ptf1a) gene as early transcription factor involved in the development of pancreas [18] in spontaneous differentiated ECiPS cells (Fig. 2A). Furthermore, Albumin, the

E XP E RI M ENTA L CE L L R E S EA RC H

Count Count

ECiPS-EBs/Wnt3a+AA

ECiPS-EBs/AA

GSC

59

322 (2014) 51 –61

Foxa2

Control Treated

Control Treated

Control Treated

Control Treated

Fig. 6 – Flow cytometry analyses of induced ECiPS cells either by Activin A or Wnt3a/Activin for expression of DE-markers. (A, B) The number of Activin A-induced ECiPS cells expressing GSC (A) or Foxa2 (B). (D, E) The number of Wnt3a/Activin A-induced ECiPS cells expressing GSC (C) or Foxa2.

early marker of hepatic differentiation and the late markers TAT (Tyrosine Aminoransferase) and TTR (Transthyretin) were expressed in the differentiated ECiPS-EBs implying the ability of the cells in derivation of endodermal cell lineages. On the other hand, the morphological monitoring showed neural-like cells with long neurite outgrowths in the edges of differentiating ECiPS-EBs confirming the potential of neural differentiation of the generated ECiPS cells. Furthermore, high expression of Nestin, MAP2 and Tau as neuron-related genes in spontaneously differentiated ECiPS cells confirmed the potency of the cells in generation of ectoderm-derived cell lineages. The specific staining of the mesodermic differentiated ECiPS cells by Alizarin Red S, Alcian blue and Oil Red O to examine respectively, the osteogenic, chondrogenic and adipogenic programming of the cells demonstrated the potency of the cells in responding to the mesodermderived cell lineages inducing signaling molecules Given the characterization of the EC-MSCs-derived iPS cells for expression of stemness markers in mRNA and protein levels (Fig. 1), and the pluripotency of established cells (Fig. 2), our results demonstrated that the generated ECiPS cells resemble many features of fibroblast-derived iPS cells described by Yamanaka0 s and

Thomson0 s laboratories [4,32]. So, our results in this part demonstrated that EC-MSCs isolated easily from conjunctival biopsies, could be a suitable cell target for direct reprogramming and iPS generation. After confirmation of the pluripotency of established ECiPS cells, they were induced to DE formation by either Wnt3a/Activin A signaling molecules under low serum concentration as standard protocol (Fig. 3B) described by D0 Amour et al. [19] or IDE1 as small molecule, firstly described by Borowiak et al. [30]. They showed that in DE derivation from ES cells, IDE1 functions through activation of TGF-ß signaling, as evident by Smad2 phosphorylation [30]. They suggested that in the DE formation step in derivation of insulin-producing cells from human and mouse ES cells, Activin A can be substituted by two cell-permeable small molecules, IDE1 and IDE2. They found that these components induce nearly 80% of mouse and human ES cells to form DE, however to the best of our knowledge there was no available results in responding of the iPS cells to IDE1. DE derivation is the most critical step in the generation of insulin-producing cells from ES cells, the efficiency of eventual ß-like cell generation is attributed to the efficiency of DE formation [17–19,28,29]

60

E XP E RI ME N TAL C E L L R ES E ARC H

Quantification of GSC, Sox17 and Foxa2 mRNA levels, as DErelated transcription factors [16], by RT-PCR revealed that induction of ECiPS-EBs by either Wnt3a/Activin A or IDE1 could enhance the transcripts level of the genes; however the levels of increase was statistically higher in Wnt3a/Activin A induced ECiPS-EBs. The immunostaining of differentiated ECiPS cells for GSC, Sox17 and Foxa2 confirmed the results in the mRNA levels for these genes. The percentages of GSCþ, Sox17þ or Foxa2þEBs in IDE1 treated ECiPS-EBs cells were as 4, 4 and 7 times more than non-treated ECiPS-EBs; whereas this ratios were as about 5, 5, and 8 times for Wnt3a/Activin A treated ECiPS-EBs. Given the enhanced expression of DE-specific transcription factors (GSC, Sox17 and Foxa2) in the levels of mRNAs and proteins, the results imply that although the treatment of ECiPS by either IDE1 or Wnt3a/Activin A could increase the efficacy of DE differentiation, Wnt3a/Activin A has more augmentative effect than IDE1 in formation of DE cells from iPS cells. To determine the synergistic effect of Wnt3a and Activin A in derivation of DE-like cells from ECiPS, the numbers of GSC- or Foxa2-expressing cells were quantified in the cells induced either by only Activin A or Wnt3a/Activin A. Our finding revealed that Wnt3a could not augment the number of DE-like cells generated in response to Activin A; implying no synergistic effect between Wnt3a and Activin A in the step of DE derivation. Our data are consistent with the study done by Toivonel et al. in which they showed that Wnt3a has more crucial role in further commitment of pluripotent stem cells into hepatic- or pancreatic-like cells rather than generation of DE cells per se [27].

Conclusions According to the World Health Organization, approximately 350 million people worldwide suffer from diabetes [33]. Currently there is no generally accepted cure for IDDM (Diabetes mellitus type 1). Insulin injections are the most common therapy; however this does not restore patient insulin production. Clinical investigations have shown that transplantation of a pancreas or purified pancreatic islets can restore the production of insulin in type 1 diabetic individuals [34] However, islet transplantation efforts have limitations including the short supply of donor pancreata, the paucity of experienced islet isolation teams, side effects of immunosuppressant and poor long-term results. These limitations have led to investigate for other stem/progenitor cell sources to generate β-cells [35,36]. ES and recently iPS cells have been considered as renewable sources for cell replacement therapy of diabetes [5,18,22]. DE formation is the rate-limiting step in derivation of ß-like cells from ES and iPS cells and the efficiency of DE formation determines the efficiency of insulin-producing cell generation. Our comparative results showed that although both Wnt3a/Activin A signaling and IDE1 molecule could be used for differentiation of iPS into DE, the DE inductive effect of Wnt3a/ Activin A was statistically higher than IDE1. On the other hand, we introduced EC-MSCs as novel human eye-derived cell source for reprogramming into iPS cells and confirmed the responsiveness of the EC-iPS cells to DE inducing factors. Therefore, EC-MSCs could be considered as one of easily isolated and cultured cells for generation of insulin-producing cells through reprogramming. The result of this study may have impact on future stem cell therapy of IDDM.

32 2 (2 014 ) 51 – 61

Disclosure statement No competing financial interests exist.

Acknowledgments This work was supported by Iranian Council of Stem Cell Research and Technology (Project code: 1132), and National Institute of Genetic Engineering and Biotechnology (Grant no. M-421).

references [1] A.M. Wobus, K.R. Boheler, Embryonic stem cells: prospects for developmental biology and cell therapy, Physiol. Rev. 85 (2005) 635–678. [2] A.C. Piscaglia, Stem cells, a two-edged sword: risks and potentials of regenerative medicine, World J. Gastroenterol. 14 (2008) 4273–4279. [3] K. Takahashi, S. Yamanaka, Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors, Cell 126 (2006) 663–676. [4] K. Takahashi, K. Tanabe, M. Ohnuki, M. Narita, T. Ichisaka, K. Tomoda, S. Yamanaka, Induction of pluripotent stem cells from adult human fibroblasts by defined factors, Cell 131 (2007) 861–872. [5] R. Maehr, S. Chen, M. Snitow, T. Ludwig, L. Yagasaki, R. Goland, R.L. Leibel, D.A. Melton, Generation of pluripotent stem cells from patients with type 1 diabetes, Proc. Natl. Acad. Sci. U. S. A. 106 (2009) 15768–15773. [6] F. Soldner, D. Hockemeyer, C. Beard, Q. Gao, G.W. Bell, E.G. Cook, G. Hargus, A. Blak, O. Cooper, M. Mitalipova, O. Isacson, R. Jaenisch, Parkinson0 s disease patient-derived induced pluripotent stem cells free of viral reprogramming factors, Cell 136 (2009) 964–977. [7] K.Y. Tan, S. Eminli, S. Hettmer, K. Hochedlinger, A.J. Wagers, Efficient generation of iPS cells from skeletal muscle stem cells, PLoS One 6 (2011) e26406. [8] T. Aasen, J.C. Belmonte, Isolation and cultivation of human keratinocytes from skin or plucked hair for the generation of induced pluripotent stem cells, Nat. Protoc. 5 (2010) 371–382. [9] S. Nadri, M. Soleimani, J. Kiani, A. Atashi, R. Izadpanah, Multipotent mesenchymal stem cells from adult human eye conjunctiva stromal cells, Differentiation 76 (2008) 223–231. [10] R.F. Spaide, D.L. Ward, Conjunctival biopsy in the diagnosis of sarcoidosis, Br. J. Ophthalmol. 74 (1990) 469–471. [11] I. Caca, K. Unlu, H. Buyukbayram, S. Ari, Conjunctival deposits as the first sign of systemic sarcoidosis in a pediatric patient, Eur. J. Ophthalmol. 16 (2006) 168–170. [12] A. Moretti, M. Bellin, C.B. Jung, T.M. Thies, Y. Takashima, A. Bernshausen, M. Schiemann, S. Fischer, S. Moosmang, A.G. Smith, J.T. Lam, K.L. Laugwitz, Mouse and human induced pluripotent stem cells as a source for multipotent Isl1þ cardiovascular progenitors, FASEB J. 24 (2010) 700–711. [13] H. Saito, M. Takeuchi, K. Chida, A. Miyajima, Generation of glucose-responsive functional islets with a three-dimensional structure from mouse fetal pancreatic cells and iPS cells in vitro, PLoS One 6 (2011) e28209. [14] Z. Alipio, W. Liao, E.J. Roemer, M. Waner, L.M. Fink, D.C. Ward, Y. Ma, Reversal of hyperglycemia in diabetic mouse models using induced-pluripotent stem (iPS)-derived pancreatic beta-like cells, Proc. Natl. Acad. Sci. U. S. A. 107 (2010) 13426–13431. [15] J.R. Spence, J.M. Wells, Translational embryology: using embryonic principles to generate pancreatic endocrine cells from embryonic stem cells, Dev. Dyn. 236 (2007) 3218–3227.

E XP E RI M ENTA L CE L L R E S EA RC H

[16] R.I. Sherwood, C. Jitianu, O. Cleaver, D.A. Shaywitz, J.O. Lamenzo, A.E. Chen, T.R. Golub, D.A. Melton, Prospective isolation and global gene expression analysis of definitive and visceral endoderm, Dev. Biol. 304 (2007) 541–555. [17] H. Semb, Definitive endoderm: a key step in coaxing human embryonic stem cells into transplantable beta-cells, Biochem. Soc. Trans. 36 (2008) 272–275. [18] E. Kroon, L.A. Martinson, K. Kadoya, A.G. Bang, O.G. Kelly, S. Eliazer, H. Young, M. Richardson, N.G. Smart, J. Cunningham, A.D. Agulnick, K.A. D0 Amour, M.K. Carpenter, E.E. Baetge, Pancreatic endoderm derived from human embryonic stem cells generates glucose-responsive insulin-secreting cells in vivo, Nat. Biotechnol. 26 (2008) 443–452. [19] K.A. D0 Amour, A.G. Bang, S. Eliazer, O.G. Kelly, A.D. Agulnick, N.G. Smart, M.A. Moorman, E. Kroon, M.K. Carpenter, E.E. Baetge, Production of pancreatic hormone–expressing endocrine cells from human embryonic stem cells, Nat. Biotechnol. 24 (2006) 1392–1401. [20] M. Hebrok, S.K. Kim, D.A. Melton, Notochord repression of endodermal sonic hedgehog permits pancreas development, Genes Dev. 12 (1998) 1705–1713. [21] S.D. Vincent, N.R. Dunn, S. Hayashi, D.P. Norris, E.J. Robertson, Cell fate decisions within the mouse organizer are governed by graded Nodal signals, Genes Dev. 17 (2003) 1646–1662. [22] O. Naujok, C. Burns, P.M. Jones, S. Lenzen, Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet?, Mol. Ther. (2011). [23] J.F. Habener, D.M. Kemp, M.K. Thomas, Minireview: Transcriptional regulation in pancreatic development, Endocrinology 146 (2005) 1025–1034. [24] M.C. Nostro, F. Sarangi, S. Ogawa, A. Holtzinger, B. Corneo, X. Li, S.J. Micallef, I.H. Park, C. Basford, M.B. Wheeler, G.Q. Daley, A.G. Elefanty, E.G. Stanley, G. Keller, Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells, Development 138 (2011) 861–871. [25] L.C. Murtaugh, A.C. Law, Y. Dor, D.A. Melton, Beta-catenin is essential for pancreatic acinar but not islet development, Development 132 (2005) 4663–4674. [26] H. Lickert, A. Kispert, S. Kutsch, R. Kemler, Expression patterns of Wnt genes in mouse gut development, Mech Dev 105 (2001) 181–184. [27] S. Toivonen, K. Lundin, D. Balboa, J. Ustinov, K. Tamminen, J. Palgi, R. Trokovic, T. Tuuri, T. Otonkoski, Activin A and Wnt-dependent

322 (2014) 51 –61

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

61

specification of human definitive endoderm cells, Exp. Cell Res. 319 (2013) 2535–2544. A.B. McLean, K.A. D0 Amour, J.K.L. Krishnamoorthy, M. K.M.J., D.M. Reynolds, A.M. Sheppard, H. LIU, Y. Xu, E.E. Baetge, S. Dalton, Activin a efficiently specifies definitive endoderm from human embryonic stem cells only when phosphatidylinositol 3-kinase signaling is suppressed, Stem Cells 25 (2007) 29–38. K.A. D0 Amour, A.D. Agulnick, S. Eliazer, O.G. Kelly, E. Kroon, E.E. Baetge, Efficient differentiation of human embryonic stem cells to definitive endoderm, Nat. Biotechnol. 23 (2005) 1534–1541. M. Borowiak, R. Maehr, S. Chen, A.E. Chen, W. Tang, J.L. Fox, S.L. Schreiber, D.A. Melton, Small molecules efficiently direct endodermal differentiation of mouse and human embryonic stem cells, Cell Stem Cell 4 (2009) 348–358. D. Taura, M. Noguchi, M. Sone, K. Hosoda, E. Mori, Y. Okada, K. Takahashi, K. Homma, N. Oyamada, M. Inuzuka, T. Sonoyama, K. Ebihara, N. Tamura, H. Itoh, H. Suemori, N. Nakatsuji, H. Okano, S. Yamanaka, K. Nakao, Adipogenic differentiation of human induced pluripotent stem cells: comparison with that of human embryonic stem cells, FEBS Lett. 583 (2009) 1029–1033. T.E. Ludwig, M.E. Levenstein, J.M. Jones, W.T. Berggren, E.R. Mitchen, J.L. Frane, L.J. Crandall, C.A. Daigh, K.R. Conard, M.S. Piekarczyk, R.A. Llanas, J.A. Thomson, Derivation of human embryonic stem cells in defined conditions, Nat. Biotechnol. 24 (2006) 185–187. G. Danaei, M.M. Finucane, Y. Lu, G.M. Singh, M.J. Cowan, C.J. Paciorek, J.K. Lin, F. Farzadfar, Y.H. Khang, G.A. Stevens, M. Rao, M.K. Ali, L.M. Riley, C.A. Robinson, M. Ezzati, National, regional, and global trends in fasting plasma glucose and diabetes prevalence since 1980: systematic analysis of health examination surveys and epidemiological studies with 370 country-years and 2.7 million participants, Lancet 378 (2011) 31–40. A.C. Farney, E. Cho, E.J. Schweitzer, B. Dunkin, B. Philosophe, J. Colonna, S. Jacobs, B. Jarrell, J.L. Flowers, S.T. Bartlett, Simultaneous cadaver pancreas living-donor kidney transplantation: a new approach for the type 1 diabetic uremic patient, Ann. Surg. 232 (2000) 696–703. P. Burra, D. Bizzaro, R. Ciccocioppo, F. Marra, A.C. Piscaglia, L. Porretti, A. Gasbarrini, F.P. Russo, Therapeutic application of stem cells in gastroenterology: an up-date, World J. Gastroenterol. 17 (2011) 3870–3880. C. Aguayo-Mazzucato, S. Bonner-Weir, Stem cell therapy for type 1 diabetes mellitus, Nat. Rev. Endocrinol. 6 (2010) 139–148.