0021-972X/91/"7306-1374$03.00/0 Journal of Clinical Endocrinology and Metabolism Copyright © 1991 by The Endocrine Society
Vol. 73, No. 6 Printed in U.S.A.
A SOMATIC POINT MUTATION IN A PUTATIVE LIGAND BINDING DOMAIN OF THE TSH RECEPTOR IN A PATIENT WITH AUTOIMMUNE HYPERTHYROIDISM Nils-Erik Heldin1, Bengt Gustavsson1, Kerstin Westermark2 and Bengt Westermark1 'Department of Pathology and 2Department of Medicine, University Hospital, S-751 85 Uppsala, Sweden ABSTRACT. Nucleotide sequence analysis of PCR fragments of TSH receptor cDNA synthesized from thyroid RNA of a patient with autoimmune hyperthyroidism, revealed two different sequences in the first position of codon 36. In one of the sequences, there was a C for G substitution leading to the D 36 —> H substitution in the predicted peptide. Both variants were also found in genomic DNA of thyroid tissue. However, only the germ line sequence was found in other tissues representing all three different germ layers. The novel sequence is therefore likely to represent a somatic mutation in the thyroid tissue, of possible relevance for the pathogenesis of the patient's thyroid disorder.
INTRODUCTION
Thyrotropin (thyroid stimulating hormone, TSH) is the main regulator of thyroid function. The hormone acts via binding to specific cell surface receptors that are coupled to the Gs-adenylate cyclase signal transduction pathway; most, if not all of thyrotropin's cellular effects are mediated by cyclic AMP. The recent cloning of complementary DNA (cDNA) for the human thyrotropin receptor (1-3) is a major breakthrough in current research on thyroid function. The nucleotide sequence of thyrotropin receptor cDNA predicts a 744 amino acid long polypeptide, after subtraction of the hydrophobic leader peptide. The protein has the typical appearance of a receptor coupled to G proteins in that it has 7 hydrophobic transmembrane segments (4). The predicted extracellular N-terminal portion spans 395 amino acids and is presumably responsible for ligand binding, although one cannot exclude the possibility that one or several of the small extracellular loops intervening the transmembrane segment also influence protein-folding required for hormone recognition. Autoimmune hyperthyroidism (Graves' disease) relates to the presence in plasma of TSH receptor autoantibodies that mimic the hormone in receptor binding and activation (5). Recent studies by the use of synthetic peptides (6) or deletion and insertion mutants of the thyrotropin receptor (7) have led to the identification of a region encompassing amino acid residues 32 - 56 or 38 - 45, respectively as an autoimmune antibody and TSH binding epitope. In the present study we have obtained evidence for a somatic point mutation (D 36 -» H) in the thyrotropin receptor gene in the thyroid of a patient with Graves' disease. Since the amino acid substitution is located in a putative ligand binding domain, it is interesting to speculate that the mutation has a causal relationship to the patient's thyroid disorder.
MATERIALS AND METHODS Thyroid tissue was obtained from a 29 year old patient operated on for Graves' disease with bilateral thyroid resection. The diagnosis was made from strongly elevated triiodothyronine levels (8.9 nmol/1; ref. values 1.2 - 2.8 ^irnol/1) and elevated TSH-receptor stimulating antibodies. The patient showed no signs of ophtalmopathy, had been treated with thyrostatics and was euthyroid at the time of operation. Histopathological diagnosis showed signs of hyperfunction, in certain areas in combination with microfollicular arrangement of the cells as well as lymphoid cell infiltration. Total RNA was extracted from thyroid tissue. The tissue was
homogenized in 3 M lithium chloride, 6 M urea, 0.2 % sodium dodecyl sulphate (SDS) and 1 |il of Antifoam A per ml of buffer, and left on ice overnight (8). The resulting precipitate was centrifuged at 16,000 x g for 20 min and dissolved in a TES-buffer (10 mM triethanolamine pH 7.5, 1 mM EDTA and 0.5% SDS). After a sequential extraction with phenol and chloroform / isoamylalcohol 24:1, total RNA was precipitated with 0.1 vol of 3 M sodium acetate and 2.2 vol of ethanol. Prior to the cDNA synthesis the RNA was poly (A)+ enriched on oligo-dT cellulose (Pharmacia). First strand cDNA synthesis was performed using a cDNA synthesis kit (Amersham). For PCR amplification of TSH-receptor DNA from cells of different embryological origin, genomic DNA used as template was prepared by boiling cells from blood lymphocytes (mesodermal), tongue (endodermal) and epidermis (ectodermal) in water prior to the PCR (9). Thyroid DNA from the patient was extracted from the paraffinembedded tissue from the operation according to a method described by Wright and Manos (10). Oligonucleotide primers used for amplification of TSH-receptor DNA were CCGTGGAAAATGAGGCCGGCGGAC (residues 91 -114; sense strand) and AGTCACATCTATAGATACGTA (residues 343 - 363; anti sense strand). Nucleotide positions are according to Nagayama et al. (2). PCR amplification was done with 50-100 ng of cDNA or 100-500 ng of genomic DNA and 100 pmol of each PCR primer in 1 x PCR buffer (Perkin-Elmer Cetus) containing 200 \lM of deoxy-nucleotides and 5 units of Taq-polymerase (Perkin-Elmer Cetus) in a final volume of 100 |il. The amplification reaction was done in 35 cycles; each cycle consisted of 95 C for 20 s (denaturation), 55 C for 20 s (annealing) and 72 C for 30 s (extension). After amplification, the PCR-products were electrophoresed in an agarose gel, cut out and purified with a Gene Clean kit (from BIO 101), digested with EcoRl and Bam HI (acloning site in each primer) and ligated into Eco Rl / Bam HI digested M13 mp 18 plasmid for sequencing. Plasmids were inserted into bacteria and positive clones were sequenced with the dideoxy method using a Sequenase II kit from United State Biochemical Corporation. In order to screen many different PCR-fragments, we performed only the G-reaction of each clone, resulting in a C in the figure, since the complementary strand was sequenced.
RESULTS For the PCR-based amplification of TSH receptor DNA, primers were designed to encompass a sequence corresponding to the most extracellular part of the TSH receptor. When cDNA synthesized from
1374
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 13 November 2015. at 11:17 For personal use only. No other uses without permission. . All rights reserved.
RAPID COMMUNICATIONS T C G A
1375 Thyroid
T C G A
• f •
Asp Epidermis
Fig. 1.
Sequence analysis of the two types of TSH- receptors. Amplified PCR fragments from cDNA as template, were sequenced with the dideoxy method as described in Materials and Methods. The mutation is indicated by an usterix (•).
thyroid tissue RNA was used as template, two different nucleotide sequences were found. In one of the sequences there was a C for G substitution in the first position of codon 36. The wild-type receptor sequence GAC was thereby altered to CAC resulting in a shift from aspargine to histidine in the predicted peptide (D36—> H) (Fig. 1). In order to substantiate our finding, we also amplified genomic DNA extracted from paraffin-embedded thyroid tissue taken at operation. As seen in Fig. 2, we indeed found the same nucleotide substitution in TSH receptor DNA amplified from thyroid DNA in 49 out of 112 clones sequenced. In order to elucidate if the alteration in position 36 of the TSH receptor was present in tissue originating from all three germ layers, we performed PCR amplification of the TSH receptor from genomic DNA from tongue (endoderm), epidermis (ectoderm) and blood lymphocytes (mesoderm). In all fragments sequenced from tongue (21 clones), epidermis (46 clones) and blood lymphocytes (70 clones) only the germ line receptor sequence was found (Fig. 2).
DISCUSSION We report here a nucleotide substitution in codon 36 leading to an amino acid substitution D36 —> H in » 50% of the sequences of the thyrotropin receptor gene in the thyroid tissue of a patient with Graves' disease. We found it unlikely that the substitution reflects a polymorphism since it was not found in other tissues from the patient, representative of endoderm, ectoderm and mesoderm. Therefore, we interprete our finding as a somatic point mutation in one of the alleles of the thyrotropin receptor gene in the patient's thyroid tissue. The finding of the substitution, along with the germ line sequence, in cDNA derived from polyadenylated RNA from thyroid tissue showes that the mutated receptor is likely to be expressed together with the normal receptor. It is pertinent to ask the question whether the point mutation is related to the patient's thyroid disorder or only represents a fortuitous event. It is notable that the D36—» H substitution represents a shift from an acidic amino acid residue to a weakly basic one, and is likely to perturb the normal conformation of the protein. Moreover, the position is located in the 25 amino acid long stretch that was identified as a putative ligand and autoimmune antibody binding epitope (6) and 2 residues upstream of the 8-residue
Tongue
Fig. 2.
Lymphocyte
Analysis of the tissue distribution of the TSH-receptor mutation. Using DNA as template the TSH-receptor was amplified and a number of fragments from each tissue were sequenced. Only a G-reaction was performed for each clone (appears as a C in the Figure), and mutated clones with an extra C are indicated by an asterix (*).
long epitope independently identified by Wadsworth etal. (7). Studies of other receptor systems have shown that point mutations may lead to drastic changes in receptor function. Thus, specific point mutations in certain growth factor receptors (11,12) lead to constitutive activation and autonomous cell growth. Another possibility, to our knowledge as yet without precedence, is that the novel amino acid sequence functions as an autoantigen and therefore is directly implicated in the pathogenesis of the patient's autoimmune thyroid disorder. Our finding therefore warrants more extensive studies of thyrotropin receptor structure in relation to thyroid disease.
REFERENCES 1.
2.
3.
4.
5.
6.
7.
Libert F, Lefort A, Gerard C, Parmentier M, Perret J, LudgateM,DumontJE,VassartG 1989Cloning, sequencing and expression of the human thyrotropin (TSH) receptor: Evidence for binding of autoantibodies. Biochem Biophys ResCommun 165:1250-1255. Nagayama Y, Kaufman KD, Seto P, Rapoport B 1989 Molecular cloning, sequence and functional expression of the cDNA for the human thyrotropin receptor. Biochem Biophys Res Commun 165:1184-1190. Misrahi M, Loosfelt H, Atger M, Sar S, Guiochon-Mantel A, Milgrom E 1990 Cloning, sequencing and expression of human TSH receptor. Biochem Biophys Res Commun 166:394-403. LefkowitzRJ, Caron MG1988 Adrenergicreceptors. Models for the study of receptors coupled to guanine nucleotide regulatory proteins. J Biol Chem 263:4993- 4996. Rees Smith B, McLachlan SM, Furmaniak J 1988 Autoantibodies to the thyrotropin receptor. Endocrinol Rev 9:106-121. Murakami M, Mori M 1990 Identification of immunogenic regions in human thyrotropin receptor for immunoglobulin G of patients with Graves' disease. Biochem Biophys Res Commun 171:512-518. Wadsworth HL, Chazenbalk GD, Nagayama Y, Rapoport B 1990 An insertion in the human thyrotropin receptor critical for high affinity hormone binding. Science 249:1423-1425.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 13 November 2015. at 11:17 For personal use only. No other uses without permission. . All rights reserved.
1376 8.
9.
10.
RAPID COMMUNICATIONS AuffrayCRougeonF 1980 Purification of mouse immunoglobulin heavy-chain messenger RNAs from total myeloma tumor RNA. Eur J Biochem 107:303-314 Saiki R 1990 Amplification of genomic DNA. In: PCR protocols: A guide to methods and applications. Academic Press, Inc., p. 13-20. Wright DK, Manos MM 1990 Sample preparation from paraffin-embedded tissues. In: PCR protocols: A guide to methods and applications. Academic Press, Inc., p. 153-158.
11.
12.
JCE & M • 1991 Vol 73 • No 6
Yoshimura A, Longmore G, Lodish HF 1990 Point-mutation in the exoplasmic domain of the erythropoietin receptor resulting in hormone-independent activation and tumorigenicy. Nature 348:647-649. Bargmann CI, Hung M-C, Weinberg RA 1986 Multiple independent activations of the neu oncogene by a point mutation altering the transmembrane domain of pl85. Cell 45:649-657.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 13 November 2015. at 11:17 For personal use only. No other uses without permission. . All rights reserved.
Vol. 73, No. 6 Printed in U.S.A.
A SOMATIC POINT MUTATION IN A PUTATIVE LIGAND BINDING DOMAIN OF THE TSH RECEPTOR IN A PATIENT WITH AUTOIMMUNE HYPERTHYROIDISM Nils-Erik Heldin1, Bengt Gustavsson1, Kerstin Westermark2 and Bengt Westermark1 'Department of Pathology and 2Department of Medicine, University Hospital, S-751 85 Uppsala, Sweden ABSTRACT. Nucleotide sequence analysis of PCR fragments of TSH receptor cDNA synthesized from thyroid RNA of a patient with autoimmune hyperthyroidism, revealed two different sequences in the first position of codon 36. In one of the sequences, there was a C for G substitution leading to the D 36 —> H substitution in the predicted peptide. Both variants were also found in genomic DNA of thyroid tissue. However, only the germ line sequence was found in other tissues representing all three different germ layers. The novel sequence is therefore likely to represent a somatic mutation in the thyroid tissue, of possible relevance for the pathogenesis of the patient's thyroid disorder.
INTRODUCTION
Thyrotropin (thyroid stimulating hormone, TSH) is the main regulator of thyroid function. The hormone acts via binding to specific cell surface receptors that are coupled to the Gs-adenylate cyclase signal transduction pathway; most, if not all of thyrotropin's cellular effects are mediated by cyclic AMP. The recent cloning of complementary DNA (cDNA) for the human thyrotropin receptor (1-3) is a major breakthrough in current research on thyroid function. The nucleotide sequence of thyrotropin receptor cDNA predicts a 744 amino acid long polypeptide, after subtraction of the hydrophobic leader peptide. The protein has the typical appearance of a receptor coupled to G proteins in that it has 7 hydrophobic transmembrane segments (4). The predicted extracellular N-terminal portion spans 395 amino acids and is presumably responsible for ligand binding, although one cannot exclude the possibility that one or several of the small extracellular loops intervening the transmembrane segment also influence protein-folding required for hormone recognition. Autoimmune hyperthyroidism (Graves' disease) relates to the presence in plasma of TSH receptor autoantibodies that mimic the hormone in receptor binding and activation (5). Recent studies by the use of synthetic peptides (6) or deletion and insertion mutants of the thyrotropin receptor (7) have led to the identification of a region encompassing amino acid residues 32 - 56 or 38 - 45, respectively as an autoimmune antibody and TSH binding epitope. In the present study we have obtained evidence for a somatic point mutation (D 36 -» H) in the thyrotropin receptor gene in the thyroid of a patient with Graves' disease. Since the amino acid substitution is located in a putative ligand binding domain, it is interesting to speculate that the mutation has a causal relationship to the patient's thyroid disorder.
MATERIALS AND METHODS Thyroid tissue was obtained from a 29 year old patient operated on for Graves' disease with bilateral thyroid resection. The diagnosis was made from strongly elevated triiodothyronine levels (8.9 nmol/1; ref. values 1.2 - 2.8 ^irnol/1) and elevated TSH-receptor stimulating antibodies. The patient showed no signs of ophtalmopathy, had been treated with thyrostatics and was euthyroid at the time of operation. Histopathological diagnosis showed signs of hyperfunction, in certain areas in combination with microfollicular arrangement of the cells as well as lymphoid cell infiltration. Total RNA was extracted from thyroid tissue. The tissue was
homogenized in 3 M lithium chloride, 6 M urea, 0.2 % sodium dodecyl sulphate (SDS) and 1 |il of Antifoam A per ml of buffer, and left on ice overnight (8). The resulting precipitate was centrifuged at 16,000 x g for 20 min and dissolved in a TES-buffer (10 mM triethanolamine pH 7.5, 1 mM EDTA and 0.5% SDS). After a sequential extraction with phenol and chloroform / isoamylalcohol 24:1, total RNA was precipitated with 0.1 vol of 3 M sodium acetate and 2.2 vol of ethanol. Prior to the cDNA synthesis the RNA was poly (A)+ enriched on oligo-dT cellulose (Pharmacia). First strand cDNA synthesis was performed using a cDNA synthesis kit (Amersham). For PCR amplification of TSH-receptor DNA from cells of different embryological origin, genomic DNA used as template was prepared by boiling cells from blood lymphocytes (mesodermal), tongue (endodermal) and epidermis (ectodermal) in water prior to the PCR (9). Thyroid DNA from the patient was extracted from the paraffinembedded tissue from the operation according to a method described by Wright and Manos (10). Oligonucleotide primers used for amplification of TSH-receptor DNA were CCGTGGAAAATGAGGCCGGCGGAC (residues 91 -114; sense strand) and AGTCACATCTATAGATACGTA (residues 343 - 363; anti sense strand). Nucleotide positions are according to Nagayama et al. (2). PCR amplification was done with 50-100 ng of cDNA or 100-500 ng of genomic DNA and 100 pmol of each PCR primer in 1 x PCR buffer (Perkin-Elmer Cetus) containing 200 \lM of deoxy-nucleotides and 5 units of Taq-polymerase (Perkin-Elmer Cetus) in a final volume of 100 |il. The amplification reaction was done in 35 cycles; each cycle consisted of 95 C for 20 s (denaturation), 55 C for 20 s (annealing) and 72 C for 30 s (extension). After amplification, the PCR-products were electrophoresed in an agarose gel, cut out and purified with a Gene Clean kit (from BIO 101), digested with EcoRl and Bam HI (acloning site in each primer) and ligated into Eco Rl / Bam HI digested M13 mp 18 plasmid for sequencing. Plasmids were inserted into bacteria and positive clones were sequenced with the dideoxy method using a Sequenase II kit from United State Biochemical Corporation. In order to screen many different PCR-fragments, we performed only the G-reaction of each clone, resulting in a C in the figure, since the complementary strand was sequenced.
RESULTS For the PCR-based amplification of TSH receptor DNA, primers were designed to encompass a sequence corresponding to the most extracellular part of the TSH receptor. When cDNA synthesized from
1374
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 13 November 2015. at 11:17 For personal use only. No other uses without permission. . All rights reserved.
RAPID COMMUNICATIONS T C G A
1375 Thyroid
T C G A
• f •
Asp Epidermis
Fig. 1.
Sequence analysis of the two types of TSH- receptors. Amplified PCR fragments from cDNA as template, were sequenced with the dideoxy method as described in Materials and Methods. The mutation is indicated by an usterix (•).
thyroid tissue RNA was used as template, two different nucleotide sequences were found. In one of the sequences there was a C for G substitution in the first position of codon 36. The wild-type receptor sequence GAC was thereby altered to CAC resulting in a shift from aspargine to histidine in the predicted peptide (D36—> H) (Fig. 1). In order to substantiate our finding, we also amplified genomic DNA extracted from paraffin-embedded thyroid tissue taken at operation. As seen in Fig. 2, we indeed found the same nucleotide substitution in TSH receptor DNA amplified from thyroid DNA in 49 out of 112 clones sequenced. In order to elucidate if the alteration in position 36 of the TSH receptor was present in tissue originating from all three germ layers, we performed PCR amplification of the TSH receptor from genomic DNA from tongue (endoderm), epidermis (ectoderm) and blood lymphocytes (mesoderm). In all fragments sequenced from tongue (21 clones), epidermis (46 clones) and blood lymphocytes (70 clones) only the germ line receptor sequence was found (Fig. 2).
DISCUSSION We report here a nucleotide substitution in codon 36 leading to an amino acid substitution D36 —> H in » 50% of the sequences of the thyrotropin receptor gene in the thyroid tissue of a patient with Graves' disease. We found it unlikely that the substitution reflects a polymorphism since it was not found in other tissues from the patient, representative of endoderm, ectoderm and mesoderm. Therefore, we interprete our finding as a somatic point mutation in one of the alleles of the thyrotropin receptor gene in the patient's thyroid tissue. The finding of the substitution, along with the germ line sequence, in cDNA derived from polyadenylated RNA from thyroid tissue showes that the mutated receptor is likely to be expressed together with the normal receptor. It is pertinent to ask the question whether the point mutation is related to the patient's thyroid disorder or only represents a fortuitous event. It is notable that the D36—» H substitution represents a shift from an acidic amino acid residue to a weakly basic one, and is likely to perturb the normal conformation of the protein. Moreover, the position is located in the 25 amino acid long stretch that was identified as a putative ligand and autoimmune antibody binding epitope (6) and 2 residues upstream of the 8-residue
Tongue
Fig. 2.
Lymphocyte
Analysis of the tissue distribution of the TSH-receptor mutation. Using DNA as template the TSH-receptor was amplified and a number of fragments from each tissue were sequenced. Only a G-reaction was performed for each clone (appears as a C in the Figure), and mutated clones with an extra C are indicated by an asterix (*).
long epitope independently identified by Wadsworth etal. (7). Studies of other receptor systems have shown that point mutations may lead to drastic changes in receptor function. Thus, specific point mutations in certain growth factor receptors (11,12) lead to constitutive activation and autonomous cell growth. Another possibility, to our knowledge as yet without precedence, is that the novel amino acid sequence functions as an autoantigen and therefore is directly implicated in the pathogenesis of the patient's autoimmune thyroid disorder. Our finding therefore warrants more extensive studies of thyrotropin receptor structure in relation to thyroid disease.
REFERENCES 1.
2.
3.
4.
5.
6.
7.
Libert F, Lefort A, Gerard C, Parmentier M, Perret J, LudgateM,DumontJE,VassartG 1989Cloning, sequencing and expression of the human thyrotropin (TSH) receptor: Evidence for binding of autoantibodies. Biochem Biophys ResCommun 165:1250-1255. Nagayama Y, Kaufman KD, Seto P, Rapoport B 1989 Molecular cloning, sequence and functional expression of the cDNA for the human thyrotropin receptor. Biochem Biophys Res Commun 165:1184-1190. Misrahi M, Loosfelt H, Atger M, Sar S, Guiochon-Mantel A, Milgrom E 1990 Cloning, sequencing and expression of human TSH receptor. Biochem Biophys Res Commun 166:394-403. LefkowitzRJ, Caron MG1988 Adrenergicreceptors. Models for the study of receptors coupled to guanine nucleotide regulatory proteins. J Biol Chem 263:4993- 4996. Rees Smith B, McLachlan SM, Furmaniak J 1988 Autoantibodies to the thyrotropin receptor. Endocrinol Rev 9:106-121. Murakami M, Mori M 1990 Identification of immunogenic regions in human thyrotropin receptor for immunoglobulin G of patients with Graves' disease. Biochem Biophys Res Commun 171:512-518. Wadsworth HL, Chazenbalk GD, Nagayama Y, Rapoport B 1990 An insertion in the human thyrotropin receptor critical for high affinity hormone binding. Science 249:1423-1425.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 13 November 2015. at 11:17 For personal use only. No other uses without permission. . All rights reserved.
1376 8.
9.
10.
RAPID COMMUNICATIONS AuffrayCRougeonF 1980 Purification of mouse immunoglobulin heavy-chain messenger RNAs from total myeloma tumor RNA. Eur J Biochem 107:303-314 Saiki R 1990 Amplification of genomic DNA. In: PCR protocols: A guide to methods and applications. Academic Press, Inc., p. 13-20. Wright DK, Manos MM 1990 Sample preparation from paraffin-embedded tissues. In: PCR protocols: A guide to methods and applications. Academic Press, Inc., p. 153-158.
11.
12.
JCE & M • 1991 Vol 73 • No 6
Yoshimura A, Longmore G, Lodish HF 1990 Point-mutation in the exoplasmic domain of the erythropoietin receptor resulting in hormone-independent activation and tumorigenicy. Nature 348:647-649. Bargmann CI, Hung M-C, Weinberg RA 1986 Multiple independent activations of the neu oncogene by a point mutation altering the transmembrane domain of pl85. Cell 45:649-657.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 13 November 2015. at 11:17 For personal use only. No other uses without permission. . All rights reserved.
