Am. J. Hum. Genet. 50:1318-1327, 1992

Point Mutation in the DNA Binding Domain of the Androgen Receptor in Two Families with Reifenstein Syndrome Helmut Klocker, Felizia Kaspar, Johannes Eberle, Siegfried Uberreiter, Christian Radmayr, and Georg Bartsch Department of Urology, University of Innsbruck, Innsbruck

Summary

Inadequate androgen action in genetic and gonadal males causes an intersex phenotype. We have analyzed the androgen receptor (AR) gene in male pseudohermaphrodites with normal specific binding of dihydrotestosterone in their genital skin fibroblasts. In five patients with Reifenstein syndrome we have detected a point mutation in the DNA binding domain. They are from two unrelated families and presented with perineoscrotal hypospadias and undescended testes. After puberty they showed small testes, no palpable prostate, micropenis, azoospermia, and gynecomastia. The mutation was discovered when cDNA fragments from three brothers were sequenced. For rapid detection of the mutation in heterozygous and hemizygous carriers, allele-specific PCRs and restriction-analysis techniques have been developed. Relatives of the patients, a group of normal blood donors, and other patients were screened with these methods. Among 41 intersex patients with incomplete virilization, another two brothers presenting with this mutation were identified. The mutation is a guanine-to-adenine transition at nucleotide 2314, which changes the alanine codon (GCC) immediately after the first cysteine of the second zinc finger motif of the AR into a threonine codon (ACC). The mutation was recreated in an AR expression vector, and wild-type as well as mutant ARs were expressed in COS-7 cells. Cotransfection experiments were made using a mouse mammary tumor virus-chloramphenicol acetyltransferase reporter gene. The ability of the mutant receptor to stimulate transcription of the reporter gene was reduced by about two-thirds, as compared with the wild-type receptor. Introduction

Male sex differentiation and the development of a normal male phenotype depend on the secretion and action of fetal androgens (Jost 1970). Disturbances of normal androgen physiology in genetic and gonadal males result in defective virilization. The patients affected cover the whole spectrum from phenotypical females to patients with partial disorders and phenotypical males with infertility (Peres-Palacios et al. 1987; Griffin and Wilson 1989). The cardinal signs of male intersexuality include severe hypospadias with a perineoscrotal meatus frequently associated with a Received June 13, 1991; final revision received January 29, 1992. Address for correspondence and reprints: Dr. Helmut Klocker, Department of Urology, University of Innsbruck, Anichstrasse 35, A-6020 Innsbruck, Austria. i 1992 by The American Society of Human Genetics. All rights reserved. 0002-9297/92/5006-0021 $02.00

1318

bifid scrotum, microphallus, small gonads, and cryptorchidism. The different syndromes of hereditary male pseudohermaphroditism result either from deficient or delayed testosterone (T) secretion or from unresponsiveness of the target tissue to androgens (Griffin and Wilson 1989). A defective conversion of T to the more active androgen dihydrotestosterone (DHT) by means of 5a-reductase results in pseudovaginal perineoscrotal hypospadias (Imperato-McGinley et al. 1974). Patients who lack the specific binding sites for androgens in their target tissues suffer from the so-called complete androgen insensitivity syndrome, and patients with the X-linked Reifenstein syndrome often show quantitative and/or qualitative abnormalities of specific androgen binding and present with incomplete virilization (Hughes and Evans 1987; Peres-Palacios et al. 1987). On the other hand, there are patients with genital ambiguity who show normal specific binding

Mutation in Androgen Receptor in Reifenstein Syndrome

of androgens (receptor-positive androgen resistance). This may be caused by defects affecting an androgenaction step beyond the specific binding of the hormone to its receptor, e.g., binding of the hormone-receptor complex to the androgen-responsive elements. The androgen-receptor (AR) gene is localized on the long arm of the X chromosome and has eight exons (Brown et al. 1989; Lubahn et al. 1990). Exon A encodes the large N-terminal domain; exons B and C encode the DNA-binding domain; and exons D-H encode the ligand-binding domain. Investigations of the AR gene in patients with androgen insensitivity have identified mutations of the AR as the underlying molecular defect (Marcelli et al. 1990, 1991; Lubahn et al. 1990; Ris-Stalpers et al. 1990; Sai et al. 1990; McPhaul et al. 1991a, 1991b). We started to analyze the AR gene in patients with perineoscrotal hypospadias. In five Reifenstein syndrome patients from two unrelated families we detected a point mutation in the second zinc finger motif of the DNA binding domain of the AR. Patients and Methods Patients

The three surviving brothers of family N. - and also a fourth brother, who later died in an accident -were admitted to our department in their childhood, with perineoscrotal hypospadias and undescended testes. They had a normal male karyotype (46,XY). Their external genitalia were corrected by staged surgery and orchidopexy. Examination at 12, 15, and 18 years of age revealed incomplete virilization in the two postpubertal brothers, with flaccid phalli 2.5 and 3 cm in length, two small (1 ml) scrotally fixed testes, no palpable prostate, no ejaculate volume, and gynecomastia. In these two boys T serum levels were normal, whereas LH (luteinizing hormone) and FSH (follicle-stimulating hormone) serum levels were increased. T levels were 7.4 and 5.4 ng/ml (normal range 3-9 ng/ml), FSH levels were 51 and 71 mU/ml (normal range 1-14 mU/ml), and LH levels were 24 and 27 mU/ml (normal range 1.5-9.2 mU/ml). At the time of follow-up, fibroblasts were cultured from scrotal skin biopsies. Blood samples from the mother and sister of the patients, as well as from a maternal aunt and a maternal uncle, were obtained for analysis. In addition, skin fibroblasts from the mother were cultured and investigated. The two brothers of family U. showed similar clinical characteristics. They also presented with perineo-

1319

scrotal hypospadias and undescended testes. A correction of the penis was performed at the age of 2 years in one brother and at the age of 12 years in the other brother. Reevaluation at 19 and 29 years of age revealed intersex disorders including micropenis, no palpable prostate, gynecomastia, female pubic escutcheon, small (1 ml) testes, and azoospermia. FSH levels (39 and 26 mU/ml) and LH levels (12.8 and 11.6 mU/ml) were increased. Serum T level was normal in one of them (4.5 ng/ml), whereas it was slightly above the upper-normal level in the other one (9.7 ng/ml). Blood samples from these two brothers, as well as from their mother, were obtained for analysis. Methods

Specific binding of DHT.-Genital skin fibroblasts were cultured in Dulbecco's modified minimal essential medium (DMEM) supplemented with 10% FCS. Cells were grown to confluency, and, 24 h before the assay, medium was replaced with DMEM without FCS. Specific binding of 3H-DHT was determined by the dispersed-cell assay according to Terakawa et al. (1990), with the following modifications: Following incubation with 3H-DHT for 1 h at 37°C, the cells were extracted in a high-salt buffer (25 mM Tris-HCl, 1.5 mM EDTA, 0.55 M KCl, pH 7.4), unbound radioactivity was separated with the help of dextrancoated charcoal, and the samples were counted in a liquid scintillation counter. Maximum binding and dissociation constants were determined by means of Scatchard plots. The maximum binding sites were related to the amount of protein. Thermostability of DHT binding. - In order to determine the best temperature for this test, specific binding was measured in fibroblasts derived from a normal male at 37°C, 41 °C, and 420C, by means of the dispersed-cell assay. Compared with that at 370C, specific binding was slightly lower at 41 °C and decreased to 40%50% at 420C. Therefore a temperature of 41 °C was chosen to test the thermostability of DHT binding. Genital skin fibroblasts from the patients and from three normal males were incubated with 1.5 mM of 3H-DHT (total binding) and with 1.5 nM of 3H-DHT plus a 200-fold molar excess of unlabeled DHT (unspecific binding), at 370C and 410C. After 1 h the cells were pelleted, and samples were extracted and counted as described above. Specifically bound DHT was calculated for both temperatures, and the amount bound at 41 °C was expressed as a percentage of the amount bound at 37°C. Sa-Reductase activity. - Sa-reductase activity was de-

1320 termined in cell-free fibroblast extracts by measuring the conversion of I4C-T to DHT, at a substrate concentration of 100 nM, according to the method of Leshin et al. (1978). RNA isolation and reverse transcription. -Total RNA was isolated from fibroblasts by the guanidine thiocya-

nate-acid phenol extraction method (Chirgwin et al. 1979) and was reversely transcribed to cDNA by AMV reverse transcriptase and random hexanucleotide primers. About 0.2-0.5 jig of total RNA, 200 pmol of hexanucleotide primers, 10 units of AMV reverse transcriptase, and 50 units of RNase inhibitor were incubated in a total volume of 40 jl of AMV buffer (50 mM Tris-HCl [pH 8.3 at 42°C], 50 mM KC1, 8 mM MgCl2, 0.1 mg BSA/ml, 1 mM of each dNTP) for 8 min at 200C, followed by 8 min at 250C and 30 min at 420C. The reaction was stopped by boiling the sample for 2 min and cooling it on ice afterward. PCR amplification of AR cDNA.-Three overlapping AR cDNA fragments (depicted in fig. 1) were amplified by PCR with the following primer pairs: IAR457/21 (5'CTGTTGAACTCTTCTGAGCAA3') and AR1863 /21 as (5'ACACGGTCCATACAACTGGCC3'), II-AR1829/22 (5'TCACAGCCGAAGAAGGCCAGTT3') AR2474/22as (5'GTGGTGCTGGAAGCCTCTCCTT3'); and III-AR2113 / 19 (5'AGCTACTCCGGACCTTACG3') and AR3350/ 25as (5'ACAGGCAGAAGAGATCTGAAAGGG3'). The first number of the oligonucleotide primers indicates the 5' nucleotide position on the AR cDNA (Chang et al. 1988), and the second number represents the length of the primers. "As" indicates primers on the antisense strand. A 2.5-jl portion of cDNA solution and 47.5 jl of PCR mix (10 mM of Tris-HCI pH 9.0, 50 mM KCI, 0.1 mg gelatin/ml, 0.1% Triton X-100, 0.2 mM of each dNTP, 0.25 jM of each primer, 25 units Taq Polymerase/ml) were mixed, overlaid with 30 jl of mineral oil, and incubated in a thermocycler. Thirty cycles were performed with strand separation for 45 s at 94°C, followed by 15 s at 96°C, annealing for 1 min at 55°C, and DNA synthesis for 1.5 min at 73° C. For the amplification of fragments I and II, 2% and 4% dimethylsulfoxide, respectively, was added to the PCR mix to lower the strand separation temperature, because these fragments contain regions with extremely high GC content and could not be amplified under standard conditions. PCR amplification of genomic DNA. -DNA was isolated from either fibroblast cells or whole blood by

1Kocker et al.

phenol-chloroform extraction. The cell pellet or 100

gl blood was lysed in 500 il buffer (4 M guanidine thiocyanate, 0.5% sodium-N-lauroyl-sarcosine, 25 mM sodium citrate pH 7.0, 0.1 M P-mercaptoetha-

nol) and was extracted with 600 jil phenol:chloroform:isoamylalcohol (25:24:1). The DNA was precipitated with isopropanol, pelleted by centrifugation, washed with 75 % ethanol, and dissolved in TE buffer. From about 0.1 gg of DNA a 0.4-kb DNA fragment containing the third exon (exon C) of the AR gene was amplified with two primers annealing within the flanking introns (Lubahn et al. 1990). PCR conditions were the same as those described for cDNA fragments. DNA sequencing. - An automated sequencer was used for direct sequencing of the PCR fragments by the dideoxynucleotide chain termination method using fluorescent labels. From each fragment, overlapping single-strand fragments were synthesized from the coding strand, as well as from the noncoding strand, by asymmetric PCR using one primer at a concentration of 0.25 jiM and the other one at a concentration of 0.015 gM. Single-strand fragments were purified by ion-exchange columns and were sequenced with Taq polymerase sequencing kits, according to the protocols of the supplier (Applied Biosystems). PCR fragments III were sequenced with dye primer kits using the universal primer M13-21, whereas PCR fragments I and II, as well as exon C fragments, were sequenced with dye terminator kits using AR-specific primers. When primer sequencing kits were utilized, the universal Ml 3 primer sequence was introduced into the fragments during the asymmetric PCR by using one primer elongated with the universal primer sequence at the 5' end. The region encoding the glycine repeat of the N-terminal domain in cDNA fragments II could not be sequenced unequivocally, and the exact number of glycine repeats could not be determined. The number of glutamine repeats in the N-terminal cDNA fragments of our patients and two normal males is 21. Screening for the G-o-A2314 mutation. -For rapid detection of the mutant gene, an allele-specific PCR technique and a restriction-analysis method have been developed. Two allele-specific primers were chosen in such a way that their 3' ends-the starting points of the DNA polymerase -anneal at the site of the mutation (fig. 4). Both primers have a mismatch at the third nucleotide from the 3' end (A instead of the correct matching G). This mismatch increases the specificity of the reaction. When the normal AR sequence is present, the oligonucleotide AR 2299/18 (5'AACAGA-

Mutation in Androgen Receptor in Reifenstein Syndrome

AGTACCTGTACG3') yields PCR fragments, whereas, in case of mutation, PCR fragments are obtained with the oligonucleotide AR2299/18M (5'AACAGAAGTACCTGTACA3'). In both PCRs the second primer is the downstream primer of the exon C fragment. The PCRs were performed under the following conditions: strand separation for 45 s at 940C followed by 15 s at 950C, annealing for 75 s at 480C, and DNA synthesis for 30 s at 730C. After 30 cycles, 10 p1 of the sample were analyzed on a 2% agarose gel. Discrimination by restriction analysis was achieved with the restriction enzymes CfoI and Snol (fig. 4). CfoI (GCGC) only cuts the normal exon C fragment, whereas SnoI (GTGCAC) only cuts the exon C fragment carrying the mutation. Introduction of the mutation into an AR expression vector. -

A HindIII-AspI fragment (286 bp) containing the mutation was isolated from a PCR-cDNA fragment III of one of the patients and was replaced in the expression vector HAOa. HAOa contains the human AR open reading frame cloned into the BamHI site of the eucaryotic expression vector pSG-5 (Green et al. 1988) and was provided by Dr. A. C. B. Cato of Karlsruhe. The resulting expression vector HAOa-M2314 was analyzed by restriction digestion and DNA sequencing. Transient AR expression in COS-7 cells.-Either wildtype or mutant AR expression vectors and the transfection efficiency control plasmid pSV-Ogal were cotransfected into COS-7 cells by electroporation. A 15-g portion of AR expression plasmid and 2 gg of 3-galactosidase expression plasmid were mixed with about 3 x 106 COS-7 cells in 200 jl of HBS buffer (20 mM HEPES, 154 mM NaCl, 5 mM KCI, 0.7 mM Na2HPO4, 6 mM glucose, pH 7.05), and an electrical discharge was applied by an electroporation system (BioRad; settings were 150 V, 500 iF, resistance co) in a 2-mm electrode cuvette. The cells were suspended in DMEM supplemented with 10% FCS and were grown for 45 h, with one medium renewal after 16 h. Cells were harvested by trypsin digestion and were suspended in DMEM supplemented with 25 mM HEPES pH 7.2. Duplicate samples were incubated with 5 nM 3H-methyltrienolone (R1 881) in the presence or absence of a 100-fold molar excess of unlabeled R1881 for 1 h at 370C. Instead of DHT, R1881 was used in these experiments, to prevent metabolization of the androgen during incubation. Specific binding was measured according to the method described for determination of specific binding of DHT in fibroblasts. An aliquot of the cells was lysed in 0-galac-

1321

tosidase buffer by ultrasonication, and 3-galactosidase activity was determined by a photometric assay (Sambrook et al. 1989) to monitor transformation efficiency. Cotransfection experiments. -Either wild-type or mu-

tant AR expression vectors were introduced into COS-7 cells by electroporation, together with the reporter plasmid pHC-wt (Cato et al. 1988), and induction of chloramphenicol acetyltransferase (CAT) expression by DHT was measured. The reporter plasmid contains the CAT gene under the control of the hormone-inducible promoter from the long-terminal repeat (LTR) of the mouse mammary tumor virus (MMTV). A 30-gg portion of reporter plasmid and 3 gg of AR expression vector were mixed with about 6 x 106 COS-7 cells in 100 pl of HBS buffer, and an electrical discharge was applied (Biometra; settings were 150 V, 300 gF, resistance 00) in a 2-mm electrode cuvette. The cells were suspended in DMEM supplemented with 0.5% charcoal-stripped FCS and were distributed into six culture wells (0 = 3 cm). After incubation for 15 h the medium was renewed, 40 nM (end concentration) of DHT was added to three of the wells, and incubation was continued for 24 h. The cells were harvested, pelleted by centrifugation, and extracted with 100 gl of 0.3 M Tris.HCI pH 7.0 by ultrasonication. CAT activity in the cell extract was determined by a mixed-phase assay (Nielson et al. 1989). Background level was measured in the cell extract of mock-transfected fibroblasts and was subtracted from the samples. Results

Specific Binding of DHT, and Sa-Reductase Activity in Genital Skin Fibroblasts

The genital skin fibroblasts derived from the three brothers N. were incubated with increasing amounts of 3H-DHT, and specific binding of DHT was determined by Scatchard plot analysis (table 1). The dissociation constants (KD) were 0.1,0.2, and 0.1 nM, and in the maximum binding capacities (Bmax) were 22,61, and 65 fmol/mg of protein. Fibroblasts derived from the foreskin of males who underwent circumcision showed dissociation constants of 0.1-0.3 nM and maximum binding capacities of 21-138 fmol/mg of protein. This shows that the patients' ARs bind DHT with normal affinity and that maximum binding is within the range for normal males. The thermostabil-

Klocker et al.

1322

Table I Specific Binding of 'H-DHT, Determined by Scatchard Plot Analysis in Genital Skin Fibroblasts Obtained from the Three Brothers N. and from Seven Normal Males Who Underwent Circumcision DHT BINDING

SUBJECT(S) Patient M.N Patient H.N. ...... Patient P.N Normal males ..... .

.

KD

Bmax

(nM)

(fmol/mg protein)

.1

22

.2

61 65 21-138 (mean 41)

......

.1

.......

.1-.3 (mean .2)

THERMOSTABILITY OF DHT-RECEPTOR COMPLEX' (%) 79 86 85 74-101 (mean 87)

5a-REDUCTASEb (pmol/mg/h) 26 29 99

24-235 (mean 107)

aCalculated as (specific binding at 41'C)/(specific binding at 371C) x 100. b Determined in cell-free extracts of genital skin fibroblasts from the three patients and from three normal males, by measuring the conversion of T to DHT.

ity of DHT binding was also investigated. Specific binding was determined at 370C and at 41 0C. In the patients' fibroblasts, specific binding at 410C was 79%, 86%, and 85% of the specific binding at 370C (table 1). This was not different from the results for control fibroblasts, in which specific binding at 41 IC was 74%-101%. Sa-Reductase activity was determined by measuring the conversion of T to DHT in cell-free extracts. The fibroblasts of the three brothers showed normal 5a-reductase activity.

Subsequently, the fragments were sequenced directly with an automated DNA sequencer. In the three brothers a G- A substitution was found at nucleotide 2314 (nucleotide numbering is according to Chang et al. 1988) in the region encoding the DNA binding domain. This point mutation changes the alanine triplet (GCC) immediately after the first cysteine of the second zinc finger motif into a threonine triplet (ACC)

Sequencing of AR cDNA Total RNA was isolated from the fibroblasts of the three brothers N. and was reverse transcribed to cDNA. Three overlapping cDNA fragments that cover the entire coding region were amplified by PCR (fig. 1). The fragments in 2% agarose gels were of the size that could be expected from the AR cDNA sequence and were not different from those of normal males, which indicates that there are no large insertions or deletions in the AR cDNA of the patients.

In order to confirm the mutation on the genomic level as well, a fragment containing the third AR exon (exon C), which encodes the second zinc finger, was amplified from fibroblast DNA and was sequenced (fig. 3). The mutation was present in the fragments of each of the three brothers.

(fig. 2). Analysis of the Third Exon of the AR Gene

Q

C-DNA Fragments .m..

I: 457-1863 11: 1829-2474 ill 2113-3350

Figure I

N-TERMINAL

NA-n

iiiiIi < i -i _

AR cDNA fragments amplified by PCR. The coding region of the AR cDNA is broadened. Three overlapping cDNA fragments covering the entire coding region were amplified, by reverse-transcription PCR, from total RNA. The numbers indicate the starting and end points of the fragments, according, to Chang et al. (1988).

SECOND ZINC FINGER OF THE ANDROGEN RECEPTOR

Second zinc finger of the DNA binding domain of Figure 2 the AR. The amino acid sequence encoded by expn C and the proposed zinc finger structure is shown. The amino acid exchanged in the patients is indicated by an arrow. The amino acids between the first two cysteines identified to be the site of protein-protein interaction 'in steroid receptors (Hard et.al. 1990; Schwabe et al. 1990; Luisi et al. 1991) are depicted as rectangles.

Mutation in Androgen Receptor in Reifenstein Syndrome

*.L[

iIZ14' c

A

Exon C genomic DNA Iragment:

C

L _U T

G

cys T

G

aIa C

G

C

s

C

A

G

A~~~~~~~~~~~~~~~~~~~A 2314

C

A

arg G A

t h r A

A/G

Figure 3 Partial sequence of genomic exon C fragments. Fragments containing the exon C of the AR gene were amplified from fibroblast DNA of the three brothers N., from whole-blood DNA of their mother, and from fibroblast DNA of two normal males and were sequenced with the help of an automated fluorescence DNA sequencer. The figure shows the section around the mutated base 2314. =C-signal; -------- = T-signal; ......... = G-signal; and----= A-signal. A, Normal male. B. One of the three brothers N. C, Mother of the three brothers N.

Screening for the G--oA23'4 Mutation by Allete-specific Methods

For rapid detection ofthe mutation in other carriers, two specific screening techniques that distinguish between normal and mutant AR genes were developed: an allele-specific PCR and an allele-specific restriction analysis of the exon C genomic fragment. These techniques were used to analyze relatives of the patients, a group of 105 normal individuals, and other intersex patients presenting with a wide range of incomplete

virilization. Since the AR gene is located on the X chromosome (Brown et al. 1989), the three patients must have inherited the mutant gene from their mother. Therefore, DNA was isolated from her blood and was analyzed. The allele-specific PCRs, as well as the restriction analysis, revealed that she is heterozygous and has a mutant as well as a normal AR gene (fig. 4). This was confirmed by sequencing her exon C fragment. As shown in figure 3, a G signal and an A signal were

1323

obtained at the position of the mutation. The sister of the three patients also carries the mutant gene and is heterozygous, whereas a maternal uncle and a maternal aunt have the normal AR gene only (fig. 4). The group of normal individuals included 61 males and 44 females. DNA isolated from the blood of these persons was analyzed with the allele-specific PCR technique. In all of them, only the normal AR gene was identified, which indicates that the AR gene present in the three brothers is probably not a rare normal AR allele. Among the 41 intersex patients who were screened for the mutation, another two brothers (family U.) with the G--A2314 mutation were detected (fig. 4). They also presented with Reifenstein syndrome. Their clinical symptoms as well as their endocrine status were almost identical to those found in the three brothers of family N. Their mutation was confirmed by isolating and sequencing the AR exon C genomic fragment and by analyzing the DNA of their mother. As in family N., the mother was found to be heterozygous (fig. 4). All the other intersex patients investigated had the normal G nucleotide at site 2314. The two families with this AR mutation are obviously not related. In their histories there are no indications of a possible common maternal ancestry. For at least four generations their members have come from different places - members of family N. from the Austrian part of the Tyrol and members of family U. from the Italian part of the Tyrol. Nor is there any reported history of hypospadias in the maternal ancestors of both families. Transient Expression of AR in COS-7 Cells, and Induction of a Hormone-inducible Promoter in Cotransfection Experiments

The mutation is within a 286-bp HindIII-AspI restriction fragment. This fragment was isolated from cDNA of one of the patients and was replaced in the AR expression vector HAOa. The ability of both HAOa and the resulting expression vector HAOaM2314 to induce expression of functionally active AR was tested by determination of androgen binding after transient expression of wild-type or mutant AR in COS-7 cells. Either wild-type or mutant expression vectors were transfected into the cells by electroporation together with a transfection-efficiency control plasmid. After incubation for 45 h, specific binding of the androgen methyltrienolone (R1881) and 13-galactosidase activity expressed from the control plasmid were measured. The synthetic androgen R1881 was

1324

* U:E=*l;:C298b

------ - -

AR EXON C

-|-

-

- - - - - - - -

1Kocker et al.

-- - -

-. CTGTGCA.CCAGC.

PCR 1 PCR2 L 1

4

3

2

EX C rc primer

CTGTACG CTGTACAl 6

5

.

--

-

-

A

__

- 298 bp -234 bp

a

CTGTGCGCCAGC---- NORMAL Cfo I (A) .CTGTGCACCAGC---- MUTANT Sno I (B)

1 2 3 4 -

9 10 8 * *

*7

AR EXON C

.

I

f6Xrc primer

B

1 2 3 4

-

-

-_.

P

234 bp

Screening for the G2314 -A mutation by allele-specific PCR and restriction analysis. Top, Allele-specific PCR. DNA was Figure 4 isolated from fibroblasts or whole blood, and two PCRs were performed with the primers indicated at the top of the panel. The first PCR (left lane of each sample) yielded a fragment with the normal AR gene, while the second one (right lane of each sample) yielded a fragment with the mutated AR gene. A 10-p1 aliquot of each reaction was separated on a 2% agarose gel, and the fragments were visualized by ethidium bromide staining. 1 = Normal male; 2-7 = family N. (2-4 = the three affected brothers; 5 = mother; 6 = maternal aunt; and 7 = maternal uncle); and 8-10 = family U. (8 and 9 = the two affected brothers; and 10 = mother). Bottom, Allele-specific restriction analysis of the exon C fragment. DNA was isolated from fibroblasts or whole blood, and the exon C fragment of the AR gene was amplified. Ten-microliter aliquots of the PCR reactions were then cut with the restriction endonucleases CfoI (A) or Snol (B) and were analyzed on a 2% agarose gel. 1 = Normal male; 2 = one of the patients; 3 = sister of the three brothers N.; and 4 = mother of the three brothers N.

used instead of DHT, to minimize metabolization during incubation. Cells transfected with wild-type AR expression vector specifically bound 379 fmol R1 88 1 / mg protein, and cells transfected with mutant AR expression vector bound 406 fmol R1881 /mg protein (fig. SA). Thus the levels of AR expressed in transfected cells were very similar for both expression vectors. Transfection efficiencies also were similar, as indicated by the 3-galactosidase activities (304 vs. 271 mU).

In order to test the ability of the mutant receptor to activate a hormone-dependent promoter, either wildtype or mutant AR expression vectors were cotransfected into COS-7 cells, together with a reporter plasmid, and the induction of CAT expression by DHT was determined (fig. SB). The reporter plasmid contained a CAT gene controlled by the hormone-inducible promoter from the LTR of the MMTV virus. A 7.7-fold increase in CAT expression was induced by DHT when the wild-type AR was coexpressed with

Mutation in Androgen Receptor in Reifenstein Syndrome

B

A U00

mf~~~~~~~3

20

X0.1

200 11

1

IE

DHAON-t

1 100A

DHTf

+401

f

*HAOs-- 1M4

Transient expression of cloned AR, and induction Figure 5 of a hormone-inducible promoter in COS-7 cells. The mutation was introduced into the AR expression vector HAOa by replacing the HindIIl-AspI restriction fragment with the same fragment from one patient's cDNA. = Wild-type AR expression vector; and OM = mutant AR expression vector. A, Specific androgen binding of transiently expressed AR. Either wild-type or mutant AR expression plasmids were transfected into COS-7 cells, together with the transfection control plasmid pSV-Ogal, and cells were cultured for 45 h. Afterward cells were harvested and incubated in medium containing 5 nM 'H-methyltrienolone (R1881) in the absence or presence of a 100-fold excess of unlabeled methyltrienolone, and specifically bound radioactivity was determined (left). In order to monitor transfection efficiency, 13-galactosidase activity expressed from the control plasmid was determined in the cell extracts (right). B, Induction of a hormone-inducible promoter in cotransfection experiments. Wild-type or mutant AR expression plasmids and the reporter plasmid pCW-wt carrying a CAT gene which is controlled by the hormone-inducible promoter from the LTR of MMTV were cotransfected into COS-7 cells by electroporation, and the cells were cultured in DMEM supplemented with 0.5% charcoal-stripped FCS. After 15 h the medium was renewed, and 40 nM of DHT was added to half of the samples. After 24 h, cells were harvested, and CAT activity was determined in the cell extracts. CAT activities are given in arbitrary units.

the reporter plasmid, whereas only a 2.4-fold increase noted when the mutant AR was coexpressed with the reporter plasmid. These results indicate that the G--A2314 mutation reduces the ability of the AR to activate transcription from a hormone-inducible pro-

was

moter.

Discussion

Defective virilization in genetic and gonadal males results from inadequate androgen action. In addition to reduced synthesis of T and DHT, qualitative and quantitative abnormalities of the intracellular hormone-binding sites, as well as post-ligand-binding defects, are responsible for intersex phenotypes. In some patients with complete testicular feminization, point mutations in the hormone-binding domain of the AR that result in a loss of hormone-binding ability were

1325

identified as the underlying molecular defect (Lubahn et al. 1990; Marcelli et al. 1990; Ris-Stalpers et al. 1990; Sai et al. 1990; McPhaul et al. 1991b). Binding assays can only evaluate the first step of androgen action - i.e., the binding of androgens to the receptor-and cannot evaluate the subsequent steps of signal transduction. We therefore started to analyze, by means of molecular-biological techniques, male patients who presented with severe malformations of the external genitalia despite normal specific binding of DHT. In three brothers with Reifenstein syndrome a point mutation that leads to the substitution of one amino acid in the AR DNA binding domain was detected. We have developed allele-specific assays that allow rapid detection of this mutation in heterozygous and hemizygous carriers. With the help of these methods the same mutation was found in another two brothers suffering from Reifenstein syndrome. The clinical symptoms of the patients of both families are almost identical. They include perineoscrotal hypospadias, undescended testes, gynecomastia, azoospermia, no palpable prostate, and elevated levels of FSH and LH. The mutations seem to have occurred independently in both families, since their histories do not indicate a common maternal ancestry. The patients have inherited the mutant gene from their mothers, who are heterozygous and carry a normal as well as a mutant gene. A sister of the patients also carries the mutant gene and is heterozygous. A maternal aunt and a phenotypically normal maternal uncle, as well as all 105 phenotypically normal individuals who were analyzed, carried the normal gene only. This indicates that the mutation detected in our patients is not a rare normal AR allele but indeed is associated with defective virilization. The G2314--A mutation occurred in the region between the first and second cysteine of the second zinc finger motif of the DNA binding domain, which is the site of interaction between the hormone-receptor complex and the androgen-responsive element. Binding of DHT to the receptor -the first step of androgen action - seems not to be affected. The mutant receptor has a normal ability to bind DHT, and the thermostability of the receptor-DHT complex is also normal. As shown by the cotransfection experiment the mutation reduces the ability of the AR to stimulate transcription from a hormone-inducible promoter. The remaining transactivation activity of the mutant receptor is approximately one-third that of the wild-type receptor. This is in good agreement with the clinical findings indicating that the response to androgens is strongly

KMocker et al.

1326

reduced in the patients but not completely absent. The mutation described in the present report is different from AR mutations in the hormone-binding region found in patients with complete androgen insensitivity. Whereas these mutations prevent hormone binding to the receptor and result in a female phenotype, the mutation detected in our patients affects a step beyond hormone binding and leads to a partial reduction of androgen function, which results in incomplete virilization in patients with a male gender. Another mutation in the second zinc finger of the AR has been described by Marcelli et al. (1991). That mutation leads to replacement of the third amino acid after the last cysteine of the zinc finger and results in a loss of AR function. Consequently, the affected patient shows complete testicular feminization. The region in which the mutation occurred is highly conserved among the members of the steroid-receptor family and is invariably present in the AR of several species (Carson-Jurica et al. 1990; He et al. 1990). In vitro mutagenesis experiments and analyses of the three-dimensional structure of steroid hormone receptors showed that this region is essential for correct discrimination between different hormone-responsive elements, as well as for protein-protein interaction (Umesono and Evans 1989; Hard et al. 1990; Schwabe et al. 1990). All steroid receptors except the estrogen receptor have an alanine at the site corresponding to the site of the mutation in the AR of our patients. In the glucocorticoid receptor this alanine is involved in receptor dimerization (Liusi et al. 1991). The mutation introduces an additional polar OHgroup at this site by exchanging alanine with threonine and thereby probably affects protein-protein interactions. Identification of the molecular mechanisms that cause the various forms of sex ambiguity will greatly improve diagnosis and therapy in affected patients. Until recently little was known about defects affecting the steps of androgen action that occur after hormone binding. The AR mutation described here and the mutation described by Marcelli et al. (1991) are mutations of this kind. Rapid screening techniques such as the allele-specific PCR described in the present report allow early identification of known mutant AR genes in affected families, both in patients and in phenotypically normal heterozygous carriers. This will facilitate both diagnosis and genetic counseling. The decision about sex assignment in intersex patients should be made immediately after birth, to ensure normal psychosexual orientation and develop-

ment of the child. Since all male individuals with the Ala--Thr mutation who are described in the present study have severe malformations of the external genitalia and-despite surgical corrections-exhibit a severe form of intersexuality after puberty, newborns with this mutation should be raised as females and should undergo feminizing genitoplasty as early as possible.

Acknowledgments We gratefully acknowledge the contribution of Dr. Reier, who provided blood samples of his patients, and of Dr. Cato, who provided an AR expression vector. We also thank Drs. Utermann, Auer, Schweiger, and Doppler for helpful suggestions and discussions; S. Jobstl, T. Sierek, G. Holzl, and P. Dejaco for their technical assistance; and P. J. Oefner for the synthesis of oligonucleotide primers. This work was supported by Jubilaumsfonds der Osterreichischen Nationalbank grant 3776.

References Brown CJ, Goss SJ, Lubahn DB, Joseph DR, Wilson EM, French FS, Willard HF (1989) Androgen receptor locus on the human X chromosome: regional localization to Xql1-12 and description of a DNA polymorphism. Am J Hum Genet 44:264-269 Carson-Jurica MA, Schrader WT, O'Malley BW (1990) Steroid receptor family: structure and functions. Endocr Rev 11:201-220 Cato ACB, Skroch P, Weinmann J, Butkeraitis P, Ponta H (1988) DNA sequences outside the receptor binding sites differentially modulate the responsiveness of the mouse mammary tumour virus promoter to various steroid hormones. EMBO J 7:1403-1410 Chang C, Kokontis J, Liao S (1988) Structural analysis of complementary DNA and amino acid sequences of human and rat androgen receptors. Proc Natl Acad Sci USA 85: 7211-7215 Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ (1979) Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18: 5294-5299 Green S, Issemann I, Sheer E (1988) A versatile in vivo and in vitro eukaryotic expression vector for protein engineering. Nucleic Acids Res 16:369 Griffin JE, Wilson JD (1989) The androgen resistance syndromes: St-reductase deficiency, testicular feminization, and related syndromes. In: Scriver CR, Beaudet AL, Sly WS, Valle D (eds) The metabolic basis of inherited disease, 6th ed. McGraw-Hill, New York, pp 1919-1944 Hard T, Kellenbach E, Boelens R, Maler BA, Dahlman K, Freedman LP, Carlstedt-Duke J, et al (1990) Solution

Mutation in Androgen Receptor in Reifenstein Syndrome structure of the glucocorticoid receptor DNA binding domain. Science 249:157-160 He WW, Fischer LM, Sun S, Bilhartz DL, Zhu X, Young XY, Kelley DB, et al (1990) Molecular cloning of androgen receptors from divergent species with a polymerase chain reaction technique: complete cDNA sequence of the mouse androgen receptor and isolation of androgen receptor cDNA probes from dog, guinea pig, rat and frog. Biochem Biophys Res Commun 171:697-704 Hughes IA, Evans BAJ (1987) Androgen insensitivity in forty-nine patients: classification based on clinical and androgen receptor phenotypes. Horm Res 28:25-29 Imperato-McGinley J, Guerrero L, Gautier T, Peterson RE (1974) Steroid Sa-reductase deficiency in men: an inherited form of male pseudohermaphroditism. Science 186: 1213-1215 Jost A (1970) Hormonal factors in the sex differentiation of the mammalian foetus. Philos Trans R Soc Lond [B] 259: 119-130 Leshin M, Griffin JE, Wilson JD (1978) Hereditary male pseudohermaphroditism associated with an unstable form of Sct-reductase. J Clin Invest 62:685-691 Lubahn DB, Brown TR, Simental JA, Higgs HN, Migeon CJ, Wilson EM, French RS (1990) Sequence of the intron/ exon junctions of the coding region of the human androgen receptor gene and identification of a point mutation in a family with complete androgen insensitivity. Proc Natl Acad Sci USA 86:9534-9538 Luisi BF, Xu WX, Otwinowski Z, Freedman LP, Yamamoto KR, Sigler PB (1991) Crystallographic analysis of the interaction of the glucocorticoid receptor with DNA. Nature 352:497-505 McPhaul MJ, Marcelli M, Tilley WD, Griffin JE, IsidoroGuiteres RF, WilsonJD (1991a) Molecular basis of androgen resistance in a family with a qualitative abnormality of the AR and responsive to high-dose androgen therapy. J Clin Invest 87:1413-1416 McPhaul MJ, Marcelli M, Tilley WD, Griffin JE, WilsonJD (1991b) Androgen resistance caused by mutations in the androgen receptor gene. FASEB J 5:2910-2915 Marcelli M, Tilley WD, Wilson CM, Wilson JD, Griffin

1327

JE, McPhaul MJ (1990) A single nucleotide substitution introduces a premature termination codon into the androgen receptor gene of a patient with receptor-negative androgen resistance. J Clin Invest 85:1522-1528 Marcelli M, Zoppi S, Grino PB, Griffin JE, Wilson JD, McPhaul MJ (1991) A mutation in the DNA-binding domain of the androgen receptor gene causes complete testicular feminization in a patient with receptor-positive androgen resistance. J Clin Invest 87:1123-1126 Nielson DA, Chang TC, Shapiro DJ (1989) A highly sensitive mixed-phase assay for chloramphenicol acetyltransferase activity in transfected cells. Anal Biochem 179:1923 Peres-Palacios G, Chavez B, Mendez JP, McGinley JI, Ulloa-Aguirre A (1987) The syndromes of androgen resistance revisited. J Steroid Biochem 27:1101-1108 Ris-Stalpers C, Kuiper PW, Faber PW, Schweikert H-U, van Rooij HCJ, Zegers ND, Hodgins MB, et al (1990) Aberrant splicing of androgen receptor mRNA results in synthesis of a nonfunctional receptor protein in a patient with androgen insensitivity. Proc Nati Acad Sci USA 87: 7866-7870 Sai T, Seino S, Chang C, Trifiro M, Pinsky L, Mhatre A, Kaufman M, et al (1990) An exonic point mutation of the androgen receptor gene in a family with complete androgen insensitivity. Am J Hum Genet 46:1095-1100 Sambrook J, Fritsch EF, Maniatis T (1989) Assay for 3-galactosidase in extracts of mammalian cells. In: Molecular cloning: a laboratory manual, 2d ed. Cold Spring Harbor Laboratory, Press, Cold Spring Harbor, NY, pp 16.6616.67 SchwabeJWR, Neuhaus D, Rhodes D (1990) Solution structure of the DNA-binding domain of the oestrogen receptor. Nature 348:458-461 Terakawa T, Shima H, Yabumoto H, Koyama K, Ikoma F (1990) Androgen receptor levels in patients with isolated hypospadias. Acta Endocrinol 123:24-29 Umesono K, Evans RM (1989) Determinants of target gene specificity for steroid/thyroid hormone receptors. Cell 57:1139-1146