G Model
ARTICLE IN PRESS
VIRMET 12751 1–4
Journal of Virological Methods xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
A TaqMan-based real-time PCR for detection and quantification of porcine parvovirus 4
1
2
3 4 5 6 7
Q1
Danielle Gava a,∗ , Carine K. Souza b , Rejane Schaefer a , Amy L. Vincent c , Maurício E. Cantão a , Arlei Coldebella a , Janice R. Ciacci-Zanella a a
Embrapa Swine and Poultry, Animal Health Laboratory, Concordia, SC, Brazil Universidade Federal do Rio Grande do Sul – UFRGS, Porto Alegre, RS, Brazil c Virus and Prion Disease Research Unit, National Animal Disease Center, USDA-ARS, Ames, IA, USA b
8
a b s t r a c t
20 9 10 11 12 13 14
Article history: Received 26 May 2014 Received in revised form 13 March 2015 Accepted 13 March 2015 Available online xxx
15
19
Keywords: TaqMan qPCR Porcine parvovirus 4 Swine
21
1. Introduction
16 17 18
22 23 24 25 26 27 28 29 30 31 32 33 34 35 36
Porcine parvovirus 4 (PPV4) is a DNA virus, and a member of the Parvoviridae family within the Bocavirus genera. It was detected recently in swine, but its epidemiology and pathology remain unclear. A TaqManbased real-time PCR (qPCR) targeting a conserved region of the ORF3 gene of PPV4 was developed. The qPCR detection limit was 9.5 × 101 DNA copies/L. There was no cross-reaction with porcine parvovirus, torque teno virus 1, torque teno virus 2, porcine circovirus type 1, porcine circovirus type 2, or with pseudorabies virus. Two hundred and seventy-two samples, including serum, semen, lungs, feces, ovarian follicular fluids, ovaries and uterus, were evaluated by qPCR and PPV4 was detected in 36 samples (13.2%). When compared with a conventional PCR (cPCR), the qPCR assay was 10 times more sensitive and the detection of PPV4 DNA in field samples was increased 2.5 times. Partial sequencing of PPV4 ORF3 gene, obtained from two pooled samples of uterus and ovaries, revealed a high nucleotide identity (98–99%) with a reference PPV4 sequence. The qPCR can be used as a fast and accurate assay for the detection and quantification of PPV4 in field samples and for epidemiological studies in swine herds. © 2015 Published by Elsevier B.V.
Parvoviruses are ubiquitous DNA viruses and infect a wide variety of animal species. Some of them cause severe clinical disease, but the majority cause only mild or subclinical infections and do not have any related disease (Tijssen et al., 2011; Xiao et al., 2013b). The viruses belong to the Parvoviridae family, Parvovirinae subfamily which has five genera included: Dependovirus, Erythrovirus, Amdovirus, Bocavirus and Parvovirus (Tijssen et al., 2011). Several viruses characterized in these genera infect swine, but their classification is not well established and the same names have been used apparently for different groups of viruses within the Parvovirinae subfamily (Csagola et al., 2012; Xiao et al., 2013b). A new classification was proposed for the Parvoviridae family and it is under review by the International Committee on Taxonomy of Viruses (ICTV) (Cotmore et al., 2014). Up to now, based on molecular evolutionary genetics, Xiao et al. (2013b) classified the genera
∗ Corresponding author at: Embrapa Swine and Poultry, Animal Health Laboratory, BR 153, Km 110, Vila Tamanduá, 89700-000, Concórdia, Santa Catarina, Brazil. Tel.: +55 49 34413276; fax: +55 49 34410497. E-mail address: [email protected] (D. Gava).
that infect swine in: Parvovirus represented by porcine parvovirus (PPV1); Bocavirus which includes seven viruses: porcine bocavirus 1 (PBoV1), porcine bocavirus 2 (PBoV2), porcine bocavirus 3A (PBoV3A), porcine bocavirus 3B (PBoV3B), porcine bocavirus 3C (PBoV3C), porcine bocavirus 3D (PBoV3D) and porcine bocavirus 3E (PBoV3E); PARV4-like virus that includes porcine parvovirus 2 (PPV2) and porcine parvovirus 3 (PPV3); and a novel clade 2 which comprises porcine parvovirus 4 (PPV4), porcine parvovirus 5 (PPV5) and porcine parvovirus 6 (PPV6). PPV4 is a non-enveloped and single-stranded DNA virus, with a linear genome of approximately 5–6 kilobases (kb) (Manteufel and Truyen, 2008; Cheung et al., 2010). The genome encodes two major open reading frames (ORFs) coding for the non-structural protein located at the 5 -end and the capsid protein located at the 3 -end and an additional and exclusive ORF3 located between the two major ORFs (Cheung et al., 2010). Based on phylogenetic analysis of the ORF1 and ORF2 genes, PPV4 is most closely related to bovine parvovirus 2 (BPV2). Despite this similarity, BPV2 does not contain the ORF3 that PPV4 carries, and this region is also quite distinct from the ORF3 of Bocaviruses (Cheung et al., 2010). Initially, PPV4 was detected in lung lavage from pigs infected with porcine circovirus type 2 (PCV2) in USA (Cheung et al., 2010). After that, the virus was described in different countries and
http://dx.doi.org/10.1016/j.jviromet.2015.03.011 0166-0934/© 2015 Published by Elsevier B.V.
Please cite this article in press as: Gava, D., et al., A TaqMan-based real-time PCR for detection and quantification of porcine parvovirus 4. J. Virol. Methods (2015), http://dx.doi.org/10.1016/j.jviromet.2015.03.011
37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59
G Model VIRMET 12751 1–4
ARTICLE IN PRESS
2
D. Gava et al. / Journal of Virological Methods xxx (2015) xxx–xxx
76
biological samples. PPV4 was described in Chinese herds in serum and tissues from various organs of sick and healthy weanling pigs (Huang et al., 2010; Zhang et al., 2011), in feces, fetuses and semen in pigs in Hungary (Csagola et al., 2012) and in lung, fecal and serum samples in pigs with different ages in USA (Xiao et al., 2013a; Opriessnig et al., 2014). Recently, the virus was detected in serum of bushpigs in Uganda (Blomstrom et al., 2013) and in pooled tissue from various organs in wild boars in Romania (Cadar et al., 2013). PPV4 has not been successfully cultivated and serological tests are not available, whereas only a conventional PCR (cPCR) (Huang et al., 2010; Zhang et al., 2011; Csagola et al., 2012) and a duplex TaqMan-based real-time PCR (qPCR) (Xiao et al., 2013a) were described. To provide a rapid and reliable molecular diagnostics for this novel virus, the aim of this study was to develop a TaqManbased real-time PCR, comparing the results obtained by qPCR with cPCR in the analysis of distinct swine samples, as serum, semen, feces, lungs and reproductive organs.
77
2. Material and methods
A 25 L cPCR reaction was prepared with 3 mM MgCl2 , 1× PCR buffer, 0.4 mM dNTP, 0.2 M of each primer (PPV4 Forward and PPV4 Reverse) and 0.75U Platinum Taq DNA Polimerase (Invitrogen® , São Paulo, SP, Brazil). The cPCR cycling conditions consisted of an initial denaturing step at 95 ◦ C for 5 min followed by 35 cycles at 95 ◦ C for 45 s, 63 ◦ C for 1 min and 72 ◦ C for 1 min followed by a final extension at 72 ◦ C for 10 min. The amplicons were analyzed by electrophoresis through a 1% agarose-TBE gel and stained with ethidium bromide. The qPCR was performed in a 25 L reaction containing 12.5 L of TaqMan Universal PCR Master Mix (Applied Biosystems® , Branchburg, NJ, USA), 20 M of ORF3 PPV4 Forward and ORF3 PPV4 Reverse primers and 10 M of ORF PPV4 probe (Table 1). Detections were carried out with an ABI Prism 7500 sequence detection system under the following conditions: uracil-N-glycosylase was activated at 50 ◦ C for 2 min, followed by PCR activation at 95 ◦ C for 10 min and 40 cycles of amplification at 95 ◦ C for 15 s and 60 ◦ C for 1 min.
78
2.1. Primers and probe design
2.4. Limit of detection and specificity assay
The ORF3 gene sequences of PPV4 were retrieved from the GenBank database and aligned using SeqMan from DNASTAR Lasergene (http://www.dnastar.com – Madison, WI, USA) software package. The primers were designed targeting a conserved region within the aligned ORF3 gene sequences. The TaqMan probe was labeled with 6-carboxy-4 ,5 -dichloro-2 ,7 -dimethoxyfluorescein (JOE – NHS Ester) at the 5 -end and with Iowa Black® RQ-Sp at 3 -end. The primers and probe were synthesized by IDT (Coralville, IA, USA) and the primers and probe sequences are shown in Table 1.
To determine the limit of detection (LOD) of the assay, tenfold dilutions of the pPPV4, containing 9.5 × 108 down to 9.5 × 100 DNA copies per micro liter were analyzed by cPCR. The same pPPV4 dilutions were tested in duplicate, in three different times in order to evaluate the coefficients of variation (CVs) of the qPCR. Intra- and inter-assay CVs for quantification cycle (Cq) values were calculated. The LOD of the qPCR was compared to the cPCR assay. To test the specificity of both PCR assays, the PPV4 standard curve and other DNA viruses as porcine parvovirus (PPV), torque teno virus 1 (TTV1), torque teno virus 2 (TTV2), porcine circovirus type 1 (PCV1), PCV2 and pseudorabies virus (PRV) were run under optimal conditions of the assays. A negative control (sterile water) was also included in the assay.
60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75
79 80 81 82 83 84 85 86 87
88
89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105
2.2. Production of a standard for TaqMan qPCR A PPV4 positive control, based on the partial ORF3 gene sequence of 440 base pairs (bp), was amplified from a field sample using specific primers (Table 1) and cloned into pCR 2.1 TOPO vector (TOPO TA Cloning kit, Invitrogen® , Carlsbad, CA, USA). Plasmids were transformed into DH5␣ Escherichia coli cells following the manufacturer’s recommendations (Invitrogen® , Carlsbad, CA, USA). Briefly, plasmid DNA was purified by PureLinkTM Quick Plasmid Miniprep Kit (Invitrogen® , Löhne, Germany). The positive clone containing the targeted sequence of ORF3 gene was confirmed by sequencing using M13 primers (Invitrogen® , Carlsbad, CA, USA). The PPV4 plasmid (pPPV4) DNA was quantified by spectrophotometric analysis (NanoDrop ND-1000) and the DNA copy number was calculated according to Yun et al. (2006). Tenfold dilutions of the pPPV4, containing 9.5 × 108 down to 9.5 × 100 DNA copies per micro liter of template, were prepared in sterile water and aliquots of each dilution were stored at −80 ◦ C. Each aliquot was used only once in each assay.
Table 1 Primers and probe for PPV4 detection. Primers Conventional PCR PPV4 forward PPV4 reverse Real-time PCR ORF3 PPV4 forward ORF3 PPV4 reverse ORF3 PPV4 probe a
Sequences (5 –3 )
a
Position
TATGTGGGCTGGGCAAGGAATGTC GTTGCGGAATGCTATCAGGCTCTT
2851–2874 3267–3290
TTTGCCAATAGTGCACAAGG AGGCATCCATGGGTCTATCA JOE (NHS Ester) CAGAAAGCAAACTGAGATGTCC – Iowa Black® RQ-Sp
3002–3021 3079–3100 3051–3072
Based on PPV4 reference sequence (GenBank accession number NC 014665).
2.3. Conventional PCR and TaqMan qPCR
2.5. Detection of PPV4 in clinical samples 2.5.1. Sampling A total of 272 clinical swine samples, including 31 serum, 13 semen, 30 lungs, 44 feces, 83 ovaries and uterus (pooled) and 71 ovarian follicular fluids were tested in both PCR assays, in optimized reaction conditions. 2.5.2. DNA extraction Viral DNA was extracted from serum, semen, lungs and feces samples using DNeasy Blood & Tissue Kit, according to the manufacturer’s instructions (Qiagen® , Hilden, Germany). The pool of ovaries and uterus and ovarian follicular fluids were minced and treated with lysis buffer (200 mM NaCl, 100 mM Tris Base, pH 7.5, 20 mM EDTA 0.5 M, pH 8.0, 1% SDS), digested with 20 g/L of proteinase K (Invitrogen® , Carlsbad, CA, USA) and incubated at 56 ◦ C for 4 h. DNA was extracted twice with phenol (Invitrogen® , Carlsbad, CA, USA), chloroform (Sigma® , St. Louis, MO, USA) and isoamyl alcohol (Vetec Quimica Fina® , Duque de Caxias, RJ, Brazil) (25:24:1), precipitated with 3 M sodium acetate and cold 100% ethanol (twice the final volume) and stored at −20 ◦ C for 20 h. The DNA pellet was washed in 70% ethanol, air dried, resuspended in TE (10 mM Tris Base, pH 7.5, 1 mM EDTA 0.5 M, pH 8.0) and stored at −80 ◦ C. 2.5.3. PPV4/ORF3 gene sequencing and analysis Three cPCR amplicons (from uterus and ovaries pools #54, 68 and 69) were gel-purified using BigDye XTerminator Purification Kit (Applied Biosystems® , Foster City, USA) and the ORF3 gene sequence was determined using an ABI 3130xl Genetic Analyzer.
Please cite this article in press as: Gava, D., et al., A TaqMan-based real-time PCR for detection and quantification of porcine parvovirus 4. J. Virol. Methods (2015), http://dx.doi.org/10.1016/j.jviromet.2015.03.011
106
107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123
124
125 126 127 128 129 130 131 132 133 134 135 136 137
138
139 140 141 142 143
144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159
160 161 162 163 164
G Model
ARTICLE IN PRESS
VIRMET 12751 1–4
D. Gava et al. / Journal of Virological Methods xxx (2015) xxx–xxx
170
Quality assessment and sequence analyses were determined by Phred (Ewing et al., 1998) and Lucy (Chou and Holmes, 2001) software. The obtained sequences were assembled using Cap3 (Ewing et al., 1998) to generate a consensus sequence. Contigs with sequence similarity to known viral sequences were identified using BLAST (Altschul et al., 1997).
171
3. Results
172
3.1. TaqMan qPCR standard curve and dynamic range
165 166 167 168 169
Table 3 Comparative results of clinical samples tested by cPCR and TaqMan qPCR for PPV4 detection. Clinical sample
cPCR
qPCR
Serum (n = 31) Semen (n = 13) Lungs (n = 30) Feces (n = 44) Uterus and ovaries (n = 83) Ovarian follicular fluid (n = 71) Total (n = 272)
0/31 1/13 7/30 1/44 6/83 0/71 15/272a
0/31 5/13 8/30 8/44 15/83 0/71 36/272
a
173 174 175 176 177 178
179
Tenfold serial dilutions of pPPV4 were used to perform a standard curve by plotting the logarithm of the plasmid copy number against the measured Cq values. The Cq values ranged from 12.0 to 37.3 cycles (Table 2) with a linear correlation (R2 ) of 0.998 (slope = −3.788) between the Cq value and the logarithm of the pPPV4 copy number. 3.2. Limit of detection of cPCR and TaqMan qPCR
183
The LOD of the cPCR and qPCR were evaluated by testing tenfold serial dilutions of the DNA standards (9.5 × 108 down to 9.5 × 100 ). Quantitative analysis identified a LOD of approximately 950 copies of viral DNA for cPCR and 95 copies of viral DNA for qPCR.
184
3.3. Specificity of cPCR and TaqMan qPCR
180 181 182
187
Strong fluorescent signals were detected for pPPV4 used as positive control in the present qPCR assay as well as in cPCR. No cross-reactivity was detected with other DNA viruses.
188
3.4. Reproducibility of TaqMan qPCR
185 186
189 190 191 192 193
194 195
196 197 198 199 200 201 202 203 204
The intra and inter-assay reproducibility was assessed using tenfold serial dilutions of standard pPPV4 DNA ranging from 9.5 × 108 up to 9.5 × 100 copies, in duplicate in three different days. The intra-assay CVs of qPCR ranged from 0.81 to 4.01%, while the inter-assay CVs ranged from 0.91 to 9.62% (Table 2). 3.5. Detection of PPV4 in clinical samples by cPCR and TaqMan qPCR A total of 272 samples were tested simultaneously by cPCR and qPCR. Fifteen out of 272 samples (5.5%) were positive for PPV4 by cPCR. When these samples were tested by qPCR, 36 out of 272 (13.2%) were positive. All samples positive to PPV4 by cPCR were also positive by qPCR (Table 3). All ovarian follicular fluids and serum samples were negative for PPV4 by both PCR assays. PPV4 was detected in 38.5% of semen samples, followed by lungs (26.6%), feces (18.2%) and ovaries and uterus pooled samples (18.1%). In general, the Cq values ranged from 24.2 to 39.9 cycles (Table 3). Table 2 Intra- and inter-assay variability of the TaqMan qPCR for PPV4 detection. Viral copies
9.5 × 108 9.5 × 107 9.5 × 106 9.5 × 105 9.5 × 104 9.5 × 103 9.5 × 102 9.5 × 101 9.5 × 100
Cq mean
12.01 15.28 19.35 22.70 26.56 30.24 34.78 37.33 39.19
Intra-assay
Inter-assay
CV
SD
CV
SD
4.01 1.99 1.52 0.84 0.98 0.81 1.74 1.98 –
0.48 0.30 0.29 0.19 0.26 0.24 0.60 0.74 –
0.91 9.47 4.58 6.95 7.83 9.62 0.93 3.51 –
0.11 1.45 0.89 1.58 2.08 2.91 0.33 1.31 –
3
Cq range – 31.9–38.5 24.2–39.3 28.7–38.4 32.7–39.9 – 24.2–39.9
All PPV4 positive samples in cPCR were also positive in qPCR.
3.6. PPV4 ORF3 gene sequencing and analysis Partial (436 bp) ORF3 gene sequences from two pooled samples of uterus and ovaries (pool #54 = GenBank accession number KJ601710 and pool #69 = GenBank accession number KJ601711) were obtained. When these sequences were compared to a complete PPV4 reference sequence (nucleotide position 2853–3288, according to the GenBank accession number NC 014665), a high nucleotide similarity (98–99%) was observed. Sample KJ601710 had a single synonymous nucleotide substitution (2935 T → C) and sample KJ601711 had two single synonymous nucleotide substitutions (2935 T → C and 2989 T → C). Both samples clustered with other 14 PPV4 sequences available up to date in GenBank, which include three from USA (GQ387500, GQ387499, NC 014665), seven from China (GU978964, GU978965, HM031134, HM031135, GU978966, GU978967, GU978968) and four from Romania (JQ868713, JQ868714, JQ868715, JQ868716). Multiple alignment results showed that the ORF3 gene sequences from our study were highly conserved among distinct PPV4 samples (98–100% of nucleotide and 99–100% of amino acid similarity). A 100% nucleotide similarity was observed in 10 out of 14 clustered PPV4 sequences, including all PPV4 sequences from Romania, five sequences from China and one from USA. 4. Discussion In the present study, we developed a qPCR assay using a TaqMan probe platform for PPV4 detection, based on a highly conserved region of the ORF3 gene. So far, only conventional PCR (cPCR) assays have been described for PPV4 detection (Huang et al., 2010; Zhang et al., 2011; Csagola et al., 2012). Recently, a duplex qPCR for PPV4 and PPV5 detection was described, but using different fluorophores and quenchers (Xiao et al., 2013a). In addition, this qPCR targets the replicase gene of PPV4, while the qPCR developed in our study has targeted the ORF3 gene. Conventional PCR is time-consuming and often requires confirmation by other methods. Furthermore, it does not estimate the amount of virus DNA copies, which can be an important factor for viral diagnosis and to correlate with viremia or clinical disease (Mackay et al., 2002). On the other hand, qPCR has been used widely as a diagnostic method for its apparent advantage over cPCR assay as high sensitivity, high specificity, and real-time quantification without the requirement of post-PCR detection procedures (Mackay et al., 2002). The qPCR developed in the present study showed to be a sensitive and specific technique. Besides, the number of detections of PPV4 DNA in field samples was increased 2.5 times when the qPCR assay was employed. Nucleic acids extracted from different biological samples, mainly semen and feces may contain unknown additional molecules, usually referred to as PCR inhibitors, which can interfere with the PCR amplification. So, the presence of PCR inhibitors can lead to false negative results. An effective feature to monitor for the presence of PCR inhibitors is to include an internal amplification control in the PCR assay (Bustin et al., 2009). However, the
Please cite this article in press as: Gava, D., et al., A TaqMan-based real-time PCR for detection and quantification of porcine parvovirus 4. J. Virol. Methods (2015), http://dx.doi.org/10.1016/j.jviromet.2015.03.011
205
206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226
227
228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254
G Model VIRMET 12751 1–4
ARTICLE IN PRESS
4
D. Gava et al. / Journal of Virological Methods xxx (2015) xxx–xxx
use of internal controls can increase the PCR reaction costs when the standardization of the assay involves a large number of samples, as well as making the standardization more laborious (Bustin 257 et al., 2009). Despite an internal control was not used in this study, 258 all plates were run with a set of standard controls, including a DNA 259 extraction control. 260 This work describes the first detection of PPV4 in Brazilian herds 261 using qPCR in the analysis of different types of biological sam262 ples from pigs. Furthermore, this technique also allowed the first 263 detection of PPV4 in reproductive tissues from sows. PPV4 was 264 detected for the first time in 2010 in lung lavage of pigs infected 265 with PCV2 (Cheung et al., 2010), and in 1996 in a retrospective study 266 (Opriessnig et al., 2014). The positivity rates of PPV4 infection in 267 American and Chinese swine herds remain low, between 2.09% (in 268 fecal samples) and 6.6% (in lung samples) (Huang et al., 2010; Zhang 269 et al., 2011; Xiao et al., 2013a). The same profile was observed in 270 pigs in Hungary, where the incidence rate was 6.4%. Based on DNA 271 detection we have found a higher prevalence (18.1%) of PPV4 in 272 ovaries and uterus, suggesting that a vertical transmission could be 273 implicated in the spread of the virus in pig herds. This finding is 274 consistent with the results shown by Csagola et al. (2012), in which 275 PPV4 was detected in semen and in fetuses. Nevertheless, Xiao et al. 276 (2013a) did not detect PPV4 in fetus, suckling piglets or in mature 277 pigs. These results may have been different due to differences in 278 sensitivity between assays or assay conditions used. 279 Despite the PPV4 being detected in swine herds, until now no 280 clinical disease associated to the virus was described. Some authors 281 have found a higher incidence of PPV4 in sick pigs (2.1 and 8%) when 282 compared with healthy pigs (0.8% and 3.9%) (Huang et al., 2010; 283 Zhang et al., 2011). Furthermore, co-infection with other viruses 284 as PCV2, TTV1, TTV2, PPV1, PPV2, PPV3 and PRRSV (porcine repro285 Q2 ductive and respiratory syndrome virus) has been reported (Huang 286 et al., 2010; Zhang et al., 2011; Opriessnig and Halbur, 2012; Xiao 287 et al., 2013a). In our study we have also detected co-infection of 288 PPV4 with PCV1, TTV1, TTV2 and PPV1 (data not shown). Partial 289 sequencing of the PPV4 ORF3 gene showed a high identity with 290 PPV4 sequences from other countries as Romania, China and USA. 291 However, due to the few PPV4 sequences available in GenBank it 292 is difficult to draw any epidemiological panel. In addition, it would 293 be interesting to evaluate other complete genome regions in order 294 to assess the genetic variability of PPV4 in the swine population. 295 In conclusion, the TaqMan-based qPCR assay developed in this 296 study demonstrated high sensitivity, specificity and reproducibility 297 for PPV4 detection and quantification in a variety of swine sam298 ples and it might be useful for the diagnosis, epidemiology and 299 pathogenesis studies of PPV4. 300 255 256
301
302 303
Competing interests The authors declare that they have no competing interests. Mention of trade names or commercial products in this article is solely for the purpose of providing specific information and does not
imply recommendation or endorsement by the EMBRAPA, Brazilian Agriculture Research Corporation. Acknowledgements The authors thank Camila Sá Rocha and Giseli Aparecida Ritterbusch for samples collection and Neide Lisiane Simon for technical assistance. We also thank Dr. Andrew Cheung for PPV4 genomic sequence. Funding was provided by EMBRAPA, and CNPq/Brazil. Q3 References Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402. Blomstrom, A.L., Stahl, K., Okurut, A.R., Masembe, C., Berg, M., 2013. Genetic characterisation of a porcine bocavirus detected in domestic pigs in Uganda. Virus Genes 47, 370–373. Bustin, S.A., Benes, V., Garson, J.A., Hellemans, J., Huggett, J., Kubista, M., Mueller, R., Nolan, T., Pfaffl, M.W., Shipley, G.L., Vandesompele, J., Wittwer, C.T., 2009. The MIQE guidelines: minimum information for publication of quantitative realtime PCR experiments. Clin. Chem. 55, 611–622. Cadar, D., Csagola, A., Kiss, T., Tuboly, T., 2013. Capsid protein evolution and comparative phylogeny of novel porcine parvoviruses. Mol. Phylogenet. Evol. 66, 243–253. Cheung, A.K., Wu, G., Wang, D., Bayles, D.O., Lager, K.M., Vincent, A.L., 2010. Identification and molecular cloning of a novel porcine parvovirus. Arch. Virol. 155, 801–806. Chou, H.H., Holmes, M.H., 2001. DNA sequence quality trimming and vector removal. Bioinformatics 17, 1093–1104. Cotmore, S.F., Agbandje-McKenna, M., Chiorini, J.A., Mukha, D.V., Pintel, D.J., Qiu, J., Soderlund-Venermo, M., Tattersall, P., Tijssen, P., Gatherer, D., Davison, A.J., 2014. The family Parvoviridae. Arch. Virol. 159, 1239–1247. Csagola, A., Lorincz, M., Cadar, D., Tombacz, K., Biksi, I., Tuboly, T., 2012. Detection, prevalence and analysis of emerging porcine parvovirus infections. Arch. Virol. 157, 1003–1010. Ewing, B., Hillier, L., Wendl, M.C., Green, P., 1998. Base-calling of automated sequencer traces using phred. I. Accuracy assessment. Genome Res. 8, 175–185. Huang, L., Zhai, S.L., Cheung, A.K., Zhang, H.B., Long, J.X., Yuan, S.S., 2010. Detection of a novel porcine parvovirus, PPV4, in Chinese swine herds. Virol. J. 7, 333. Mackay, I.M., Arden, K.E., Nitsche, A., 2002. Real-time PCR in virology. Nucleic Acids Res. 30, 1292–1305. Manteufel, J., Truyen, U., 2008. Animal bocaviruses: a brief review. Intervirology 51, 328–334. Opriessnig, T., Xiao, C.T., Gerber, P.F., Halbur, P.G., 2014. Identification of recently described porcine parvoviruses in archived North American samples from 1996 and association with porcine circovirus associated disease. Vet. Microbiol. 173, 9–16. Tijssen, P., Agbandje-McKenna, M., Almendral, J.M., Bergoin, M., Flegel, T.W., Hedman, K., Kleinschmidt, J., Li, Y., Pintel, D.J., Tattersall, P., 2011. Family Parvoviridae. In: King, A.M.Q., Adams, M.J., Carstens, E.B., Lefkowitz, E.J. (Eds.), Virus Taxonomy. Ninth Report of the International Committee on Taxonomy of Viruses. , pp. 405–425. Xiao, C.T., Gimenez-Lirola, L.G., Jiang, Y.H., Halbur, P.G., Opriessnig, T., 2013a. Characterization of a novel porcine parvovirus tentatively designated PPV5. PLoS One 8, e65312. Xiao, C.T., Halbur, P.G., Opriessnig, T., 2013b. Molecular evolutionary genetic analysis of emerging parvoviruses identified in pigs. Infect. Genet. Evol. 16, 369–376. Yun, J.J., Heisler, L.E., Hwang, I.I., Wilkins, O., Lau, S.K., Hyrcza, M., Jayabalasingham, B., Jin, J., McLaurin, J., Tsao, M.S., Der, S.D., 2006. Genomic DNA functions as a universal external standard in quantitative real-time PCR. Nucleic Acids Res. 34, e85. Zhang, H.B., Huang, L., Liu, Y.J., Lin, T., Sun, C.Q., Deng, Y., Wei, Z.Z., Cheung, A.K., Long, J.X., Yuan, S.S., 2011. Porcine bocaviruses: genetic analysis and prevalence in Chinese swine population. Epidemiol. Infect. 139, 1581–1586.
Please cite this article in press as: Gava, D., et al., A TaqMan-based real-time PCR for detection and quantification of porcine parvovirus 4. J. Virol. Methods (2015), http://dx.doi.org/10.1016/j.jviromet.2015.03.011
304 305
306
307 308 309 310
311
312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364
ARTICLE IN PRESS
VIRMET 12751 1–4
Journal of Virological Methods xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
A TaqMan-based real-time PCR for detection and quantification of porcine parvovirus 4
1
2
3 4 5 6 7
Q1
Danielle Gava a,∗ , Carine K. Souza b , Rejane Schaefer a , Amy L. Vincent c , Maurício E. Cantão a , Arlei Coldebella a , Janice R. Ciacci-Zanella a a
Embrapa Swine and Poultry, Animal Health Laboratory, Concordia, SC, Brazil Universidade Federal do Rio Grande do Sul – UFRGS, Porto Alegre, RS, Brazil c Virus and Prion Disease Research Unit, National Animal Disease Center, USDA-ARS, Ames, IA, USA b
8
a b s t r a c t
20 9 10 11 12 13 14
Article history: Received 26 May 2014 Received in revised form 13 March 2015 Accepted 13 March 2015 Available online xxx
15
19
Keywords: TaqMan qPCR Porcine parvovirus 4 Swine
21
1. Introduction
16 17 18
22 23 24 25 26 27 28 29 30 31 32 33 34 35 36
Porcine parvovirus 4 (PPV4) is a DNA virus, and a member of the Parvoviridae family within the Bocavirus genera. It was detected recently in swine, but its epidemiology and pathology remain unclear. A TaqManbased real-time PCR (qPCR) targeting a conserved region of the ORF3 gene of PPV4 was developed. The qPCR detection limit was 9.5 × 101 DNA copies/L. There was no cross-reaction with porcine parvovirus, torque teno virus 1, torque teno virus 2, porcine circovirus type 1, porcine circovirus type 2, or with pseudorabies virus. Two hundred and seventy-two samples, including serum, semen, lungs, feces, ovarian follicular fluids, ovaries and uterus, were evaluated by qPCR and PPV4 was detected in 36 samples (13.2%). When compared with a conventional PCR (cPCR), the qPCR assay was 10 times more sensitive and the detection of PPV4 DNA in field samples was increased 2.5 times. Partial sequencing of PPV4 ORF3 gene, obtained from two pooled samples of uterus and ovaries, revealed a high nucleotide identity (98–99%) with a reference PPV4 sequence. The qPCR can be used as a fast and accurate assay for the detection and quantification of PPV4 in field samples and for epidemiological studies in swine herds. © 2015 Published by Elsevier B.V.
Parvoviruses are ubiquitous DNA viruses and infect a wide variety of animal species. Some of them cause severe clinical disease, but the majority cause only mild or subclinical infections and do not have any related disease (Tijssen et al., 2011; Xiao et al., 2013b). The viruses belong to the Parvoviridae family, Parvovirinae subfamily which has five genera included: Dependovirus, Erythrovirus, Amdovirus, Bocavirus and Parvovirus (Tijssen et al., 2011). Several viruses characterized in these genera infect swine, but their classification is not well established and the same names have been used apparently for different groups of viruses within the Parvovirinae subfamily (Csagola et al., 2012; Xiao et al., 2013b). A new classification was proposed for the Parvoviridae family and it is under review by the International Committee on Taxonomy of Viruses (ICTV) (Cotmore et al., 2014). Up to now, based on molecular evolutionary genetics, Xiao et al. (2013b) classified the genera
∗ Corresponding author at: Embrapa Swine and Poultry, Animal Health Laboratory, BR 153, Km 110, Vila Tamanduá, 89700-000, Concórdia, Santa Catarina, Brazil. Tel.: +55 49 34413276; fax: +55 49 34410497. E-mail address: [email protected] (D. Gava).
that infect swine in: Parvovirus represented by porcine parvovirus (PPV1); Bocavirus which includes seven viruses: porcine bocavirus 1 (PBoV1), porcine bocavirus 2 (PBoV2), porcine bocavirus 3A (PBoV3A), porcine bocavirus 3B (PBoV3B), porcine bocavirus 3C (PBoV3C), porcine bocavirus 3D (PBoV3D) and porcine bocavirus 3E (PBoV3E); PARV4-like virus that includes porcine parvovirus 2 (PPV2) and porcine parvovirus 3 (PPV3); and a novel clade 2 which comprises porcine parvovirus 4 (PPV4), porcine parvovirus 5 (PPV5) and porcine parvovirus 6 (PPV6). PPV4 is a non-enveloped and single-stranded DNA virus, with a linear genome of approximately 5–6 kilobases (kb) (Manteufel and Truyen, 2008; Cheung et al., 2010). The genome encodes two major open reading frames (ORFs) coding for the non-structural protein located at the 5 -end and the capsid protein located at the 3 -end and an additional and exclusive ORF3 located between the two major ORFs (Cheung et al., 2010). Based on phylogenetic analysis of the ORF1 and ORF2 genes, PPV4 is most closely related to bovine parvovirus 2 (BPV2). Despite this similarity, BPV2 does not contain the ORF3 that PPV4 carries, and this region is also quite distinct from the ORF3 of Bocaviruses (Cheung et al., 2010). Initially, PPV4 was detected in lung lavage from pigs infected with porcine circovirus type 2 (PCV2) in USA (Cheung et al., 2010). After that, the virus was described in different countries and
http://dx.doi.org/10.1016/j.jviromet.2015.03.011 0166-0934/© 2015 Published by Elsevier B.V.
Please cite this article in press as: Gava, D., et al., A TaqMan-based real-time PCR for detection and quantification of porcine parvovirus 4. J. Virol. Methods (2015), http://dx.doi.org/10.1016/j.jviromet.2015.03.011
37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59
G Model VIRMET 12751 1–4
ARTICLE IN PRESS
2
D. Gava et al. / Journal of Virological Methods xxx (2015) xxx–xxx
76
biological samples. PPV4 was described in Chinese herds in serum and tissues from various organs of sick and healthy weanling pigs (Huang et al., 2010; Zhang et al., 2011), in feces, fetuses and semen in pigs in Hungary (Csagola et al., 2012) and in lung, fecal and serum samples in pigs with different ages in USA (Xiao et al., 2013a; Opriessnig et al., 2014). Recently, the virus was detected in serum of bushpigs in Uganda (Blomstrom et al., 2013) and in pooled tissue from various organs in wild boars in Romania (Cadar et al., 2013). PPV4 has not been successfully cultivated and serological tests are not available, whereas only a conventional PCR (cPCR) (Huang et al., 2010; Zhang et al., 2011; Csagola et al., 2012) and a duplex TaqMan-based real-time PCR (qPCR) (Xiao et al., 2013a) were described. To provide a rapid and reliable molecular diagnostics for this novel virus, the aim of this study was to develop a TaqManbased real-time PCR, comparing the results obtained by qPCR with cPCR in the analysis of distinct swine samples, as serum, semen, feces, lungs and reproductive organs.
77
2. Material and methods
A 25 L cPCR reaction was prepared with 3 mM MgCl2 , 1× PCR buffer, 0.4 mM dNTP, 0.2 M of each primer (PPV4 Forward and PPV4 Reverse) and 0.75U Platinum Taq DNA Polimerase (Invitrogen® , São Paulo, SP, Brazil). The cPCR cycling conditions consisted of an initial denaturing step at 95 ◦ C for 5 min followed by 35 cycles at 95 ◦ C for 45 s, 63 ◦ C for 1 min and 72 ◦ C for 1 min followed by a final extension at 72 ◦ C for 10 min. The amplicons were analyzed by electrophoresis through a 1% agarose-TBE gel and stained with ethidium bromide. The qPCR was performed in a 25 L reaction containing 12.5 L of TaqMan Universal PCR Master Mix (Applied Biosystems® , Branchburg, NJ, USA), 20 M of ORF3 PPV4 Forward and ORF3 PPV4 Reverse primers and 10 M of ORF PPV4 probe (Table 1). Detections were carried out with an ABI Prism 7500 sequence detection system under the following conditions: uracil-N-glycosylase was activated at 50 ◦ C for 2 min, followed by PCR activation at 95 ◦ C for 10 min and 40 cycles of amplification at 95 ◦ C for 15 s and 60 ◦ C for 1 min.
78
2.1. Primers and probe design
2.4. Limit of detection and specificity assay
The ORF3 gene sequences of PPV4 were retrieved from the GenBank database and aligned using SeqMan from DNASTAR Lasergene (http://www.dnastar.com – Madison, WI, USA) software package. The primers were designed targeting a conserved region within the aligned ORF3 gene sequences. The TaqMan probe was labeled with 6-carboxy-4 ,5 -dichloro-2 ,7 -dimethoxyfluorescein (JOE – NHS Ester) at the 5 -end and with Iowa Black® RQ-Sp at 3 -end. The primers and probe were synthesized by IDT (Coralville, IA, USA) and the primers and probe sequences are shown in Table 1.
To determine the limit of detection (LOD) of the assay, tenfold dilutions of the pPPV4, containing 9.5 × 108 down to 9.5 × 100 DNA copies per micro liter were analyzed by cPCR. The same pPPV4 dilutions were tested in duplicate, in three different times in order to evaluate the coefficients of variation (CVs) of the qPCR. Intra- and inter-assay CVs for quantification cycle (Cq) values were calculated. The LOD of the qPCR was compared to the cPCR assay. To test the specificity of both PCR assays, the PPV4 standard curve and other DNA viruses as porcine parvovirus (PPV), torque teno virus 1 (TTV1), torque teno virus 2 (TTV2), porcine circovirus type 1 (PCV1), PCV2 and pseudorabies virus (PRV) were run under optimal conditions of the assays. A negative control (sterile water) was also included in the assay.
60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75
79 80 81 82 83 84 85 86 87
88
89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105
2.2. Production of a standard for TaqMan qPCR A PPV4 positive control, based on the partial ORF3 gene sequence of 440 base pairs (bp), was amplified from a field sample using specific primers (Table 1) and cloned into pCR 2.1 TOPO vector (TOPO TA Cloning kit, Invitrogen® , Carlsbad, CA, USA). Plasmids were transformed into DH5␣ Escherichia coli cells following the manufacturer’s recommendations (Invitrogen® , Carlsbad, CA, USA). Briefly, plasmid DNA was purified by PureLinkTM Quick Plasmid Miniprep Kit (Invitrogen® , Löhne, Germany). The positive clone containing the targeted sequence of ORF3 gene was confirmed by sequencing using M13 primers (Invitrogen® , Carlsbad, CA, USA). The PPV4 plasmid (pPPV4) DNA was quantified by spectrophotometric analysis (NanoDrop ND-1000) and the DNA copy number was calculated according to Yun et al. (2006). Tenfold dilutions of the pPPV4, containing 9.5 × 108 down to 9.5 × 100 DNA copies per micro liter of template, were prepared in sterile water and aliquots of each dilution were stored at −80 ◦ C. Each aliquot was used only once in each assay.
Table 1 Primers and probe for PPV4 detection. Primers Conventional PCR PPV4 forward PPV4 reverse Real-time PCR ORF3 PPV4 forward ORF3 PPV4 reverse ORF3 PPV4 probe a
Sequences (5 –3 )
a
Position
TATGTGGGCTGGGCAAGGAATGTC GTTGCGGAATGCTATCAGGCTCTT
2851–2874 3267–3290
TTTGCCAATAGTGCACAAGG AGGCATCCATGGGTCTATCA JOE (NHS Ester) CAGAAAGCAAACTGAGATGTCC – Iowa Black® RQ-Sp
3002–3021 3079–3100 3051–3072
Based on PPV4 reference sequence (GenBank accession number NC 014665).
2.3. Conventional PCR and TaqMan qPCR
2.5. Detection of PPV4 in clinical samples 2.5.1. Sampling A total of 272 clinical swine samples, including 31 serum, 13 semen, 30 lungs, 44 feces, 83 ovaries and uterus (pooled) and 71 ovarian follicular fluids were tested in both PCR assays, in optimized reaction conditions. 2.5.2. DNA extraction Viral DNA was extracted from serum, semen, lungs and feces samples using DNeasy Blood & Tissue Kit, according to the manufacturer’s instructions (Qiagen® , Hilden, Germany). The pool of ovaries and uterus and ovarian follicular fluids were minced and treated with lysis buffer (200 mM NaCl, 100 mM Tris Base, pH 7.5, 20 mM EDTA 0.5 M, pH 8.0, 1% SDS), digested with 20 g/L of proteinase K (Invitrogen® , Carlsbad, CA, USA) and incubated at 56 ◦ C for 4 h. DNA was extracted twice with phenol (Invitrogen® , Carlsbad, CA, USA), chloroform (Sigma® , St. Louis, MO, USA) and isoamyl alcohol (Vetec Quimica Fina® , Duque de Caxias, RJ, Brazil) (25:24:1), precipitated with 3 M sodium acetate and cold 100% ethanol (twice the final volume) and stored at −20 ◦ C for 20 h. The DNA pellet was washed in 70% ethanol, air dried, resuspended in TE (10 mM Tris Base, pH 7.5, 1 mM EDTA 0.5 M, pH 8.0) and stored at −80 ◦ C. 2.5.3. PPV4/ORF3 gene sequencing and analysis Three cPCR amplicons (from uterus and ovaries pools #54, 68 and 69) were gel-purified using BigDye XTerminator Purification Kit (Applied Biosystems® , Foster City, USA) and the ORF3 gene sequence was determined using an ABI 3130xl Genetic Analyzer.
Please cite this article in press as: Gava, D., et al., A TaqMan-based real-time PCR for detection and quantification of porcine parvovirus 4. J. Virol. Methods (2015), http://dx.doi.org/10.1016/j.jviromet.2015.03.011
106
107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123
124
125 126 127 128 129 130 131 132 133 134 135 136 137
138
139 140 141 142 143
144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159
160 161 162 163 164
G Model
ARTICLE IN PRESS
VIRMET 12751 1–4
D. Gava et al. / Journal of Virological Methods xxx (2015) xxx–xxx
170
Quality assessment and sequence analyses were determined by Phred (Ewing et al., 1998) and Lucy (Chou and Holmes, 2001) software. The obtained sequences were assembled using Cap3 (Ewing et al., 1998) to generate a consensus sequence. Contigs with sequence similarity to known viral sequences were identified using BLAST (Altschul et al., 1997).
171
3. Results
172
3.1. TaqMan qPCR standard curve and dynamic range
165 166 167 168 169
Table 3 Comparative results of clinical samples tested by cPCR and TaqMan qPCR for PPV4 detection. Clinical sample
cPCR
qPCR
Serum (n = 31) Semen (n = 13) Lungs (n = 30) Feces (n = 44) Uterus and ovaries (n = 83) Ovarian follicular fluid (n = 71) Total (n = 272)
0/31 1/13 7/30 1/44 6/83 0/71 15/272a
0/31 5/13 8/30 8/44 15/83 0/71 36/272
a
173 174 175 176 177 178
179
Tenfold serial dilutions of pPPV4 were used to perform a standard curve by plotting the logarithm of the plasmid copy number against the measured Cq values. The Cq values ranged from 12.0 to 37.3 cycles (Table 2) with a linear correlation (R2 ) of 0.998 (slope = −3.788) between the Cq value and the logarithm of the pPPV4 copy number. 3.2. Limit of detection of cPCR and TaqMan qPCR
183
The LOD of the cPCR and qPCR were evaluated by testing tenfold serial dilutions of the DNA standards (9.5 × 108 down to 9.5 × 100 ). Quantitative analysis identified a LOD of approximately 950 copies of viral DNA for cPCR and 95 copies of viral DNA for qPCR.
184
3.3. Specificity of cPCR and TaqMan qPCR
180 181 182
187
Strong fluorescent signals were detected for pPPV4 used as positive control in the present qPCR assay as well as in cPCR. No cross-reactivity was detected with other DNA viruses.
188
3.4. Reproducibility of TaqMan qPCR
185 186
189 190 191 192 193
194 195
196 197 198 199 200 201 202 203 204
The intra and inter-assay reproducibility was assessed using tenfold serial dilutions of standard pPPV4 DNA ranging from 9.5 × 108 up to 9.5 × 100 copies, in duplicate in three different days. The intra-assay CVs of qPCR ranged from 0.81 to 4.01%, while the inter-assay CVs ranged from 0.91 to 9.62% (Table 2). 3.5. Detection of PPV4 in clinical samples by cPCR and TaqMan qPCR A total of 272 samples were tested simultaneously by cPCR and qPCR. Fifteen out of 272 samples (5.5%) were positive for PPV4 by cPCR. When these samples were tested by qPCR, 36 out of 272 (13.2%) were positive. All samples positive to PPV4 by cPCR were also positive by qPCR (Table 3). All ovarian follicular fluids and serum samples were negative for PPV4 by both PCR assays. PPV4 was detected in 38.5% of semen samples, followed by lungs (26.6%), feces (18.2%) and ovaries and uterus pooled samples (18.1%). In general, the Cq values ranged from 24.2 to 39.9 cycles (Table 3). Table 2 Intra- and inter-assay variability of the TaqMan qPCR for PPV4 detection. Viral copies
9.5 × 108 9.5 × 107 9.5 × 106 9.5 × 105 9.5 × 104 9.5 × 103 9.5 × 102 9.5 × 101 9.5 × 100
Cq mean
12.01 15.28 19.35 22.70 26.56 30.24 34.78 37.33 39.19
Intra-assay
Inter-assay
CV
SD
CV
SD
4.01 1.99 1.52 0.84 0.98 0.81 1.74 1.98 –
0.48 0.30 0.29 0.19 0.26 0.24 0.60 0.74 –
0.91 9.47 4.58 6.95 7.83 9.62 0.93 3.51 –
0.11 1.45 0.89 1.58 2.08 2.91 0.33 1.31 –
3
Cq range – 31.9–38.5 24.2–39.3 28.7–38.4 32.7–39.9 – 24.2–39.9
All PPV4 positive samples in cPCR were also positive in qPCR.
3.6. PPV4 ORF3 gene sequencing and analysis Partial (436 bp) ORF3 gene sequences from two pooled samples of uterus and ovaries (pool #54 = GenBank accession number KJ601710 and pool #69 = GenBank accession number KJ601711) were obtained. When these sequences were compared to a complete PPV4 reference sequence (nucleotide position 2853–3288, according to the GenBank accession number NC 014665), a high nucleotide similarity (98–99%) was observed. Sample KJ601710 had a single synonymous nucleotide substitution (2935 T → C) and sample KJ601711 had two single synonymous nucleotide substitutions (2935 T → C and 2989 T → C). Both samples clustered with other 14 PPV4 sequences available up to date in GenBank, which include three from USA (GQ387500, GQ387499, NC 014665), seven from China (GU978964, GU978965, HM031134, HM031135, GU978966, GU978967, GU978968) and four from Romania (JQ868713, JQ868714, JQ868715, JQ868716). Multiple alignment results showed that the ORF3 gene sequences from our study were highly conserved among distinct PPV4 samples (98–100% of nucleotide and 99–100% of amino acid similarity). A 100% nucleotide similarity was observed in 10 out of 14 clustered PPV4 sequences, including all PPV4 sequences from Romania, five sequences from China and one from USA. 4. Discussion In the present study, we developed a qPCR assay using a TaqMan probe platform for PPV4 detection, based on a highly conserved region of the ORF3 gene. So far, only conventional PCR (cPCR) assays have been described for PPV4 detection (Huang et al., 2010; Zhang et al., 2011; Csagola et al., 2012). Recently, a duplex qPCR for PPV4 and PPV5 detection was described, but using different fluorophores and quenchers (Xiao et al., 2013a). In addition, this qPCR targets the replicase gene of PPV4, while the qPCR developed in our study has targeted the ORF3 gene. Conventional PCR is time-consuming and often requires confirmation by other methods. Furthermore, it does not estimate the amount of virus DNA copies, which can be an important factor for viral diagnosis and to correlate with viremia or clinical disease (Mackay et al., 2002). On the other hand, qPCR has been used widely as a diagnostic method for its apparent advantage over cPCR assay as high sensitivity, high specificity, and real-time quantification without the requirement of post-PCR detection procedures (Mackay et al., 2002). The qPCR developed in the present study showed to be a sensitive and specific technique. Besides, the number of detections of PPV4 DNA in field samples was increased 2.5 times when the qPCR assay was employed. Nucleic acids extracted from different biological samples, mainly semen and feces may contain unknown additional molecules, usually referred to as PCR inhibitors, which can interfere with the PCR amplification. So, the presence of PCR inhibitors can lead to false negative results. An effective feature to monitor for the presence of PCR inhibitors is to include an internal amplification control in the PCR assay (Bustin et al., 2009). However, the
Please cite this article in press as: Gava, D., et al., A TaqMan-based real-time PCR for detection and quantification of porcine parvovirus 4. J. Virol. Methods (2015), http://dx.doi.org/10.1016/j.jviromet.2015.03.011
205
206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226
227
228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254
G Model VIRMET 12751 1–4
ARTICLE IN PRESS
4
D. Gava et al. / Journal of Virological Methods xxx (2015) xxx–xxx
use of internal controls can increase the PCR reaction costs when the standardization of the assay involves a large number of samples, as well as making the standardization more laborious (Bustin 257 et al., 2009). Despite an internal control was not used in this study, 258 all plates were run with a set of standard controls, including a DNA 259 extraction control. 260 This work describes the first detection of PPV4 in Brazilian herds 261 using qPCR in the analysis of different types of biological sam262 ples from pigs. Furthermore, this technique also allowed the first 263 detection of PPV4 in reproductive tissues from sows. PPV4 was 264 detected for the first time in 2010 in lung lavage of pigs infected 265 with PCV2 (Cheung et al., 2010), and in 1996 in a retrospective study 266 (Opriessnig et al., 2014). The positivity rates of PPV4 infection in 267 American and Chinese swine herds remain low, between 2.09% (in 268 fecal samples) and 6.6% (in lung samples) (Huang et al., 2010; Zhang 269 et al., 2011; Xiao et al., 2013a). The same profile was observed in 270 pigs in Hungary, where the incidence rate was 6.4%. Based on DNA 271 detection we have found a higher prevalence (18.1%) of PPV4 in 272 ovaries and uterus, suggesting that a vertical transmission could be 273 implicated in the spread of the virus in pig herds. This finding is 274 consistent with the results shown by Csagola et al. (2012), in which 275 PPV4 was detected in semen and in fetuses. Nevertheless, Xiao et al. 276 (2013a) did not detect PPV4 in fetus, suckling piglets or in mature 277 pigs. These results may have been different due to differences in 278 sensitivity between assays or assay conditions used. 279 Despite the PPV4 being detected in swine herds, until now no 280 clinical disease associated to the virus was described. Some authors 281 have found a higher incidence of PPV4 in sick pigs (2.1 and 8%) when 282 compared with healthy pigs (0.8% and 3.9%) (Huang et al., 2010; 283 Zhang et al., 2011). Furthermore, co-infection with other viruses 284 as PCV2, TTV1, TTV2, PPV1, PPV2, PPV3 and PRRSV (porcine repro285 Q2 ductive and respiratory syndrome virus) has been reported (Huang 286 et al., 2010; Zhang et al., 2011; Opriessnig and Halbur, 2012; Xiao 287 et al., 2013a). In our study we have also detected co-infection of 288 PPV4 with PCV1, TTV1, TTV2 and PPV1 (data not shown). Partial 289 sequencing of the PPV4 ORF3 gene showed a high identity with 290 PPV4 sequences from other countries as Romania, China and USA. 291 However, due to the few PPV4 sequences available in GenBank it 292 is difficult to draw any epidemiological panel. In addition, it would 293 be interesting to evaluate other complete genome regions in order 294 to assess the genetic variability of PPV4 in the swine population. 295 In conclusion, the TaqMan-based qPCR assay developed in this 296 study demonstrated high sensitivity, specificity and reproducibility 297 for PPV4 detection and quantification in a variety of swine sam298 ples and it might be useful for the diagnosis, epidemiology and 299 pathogenesis studies of PPV4. 300 255 256
301
302 303
Competing interests The authors declare that they have no competing interests. Mention of trade names or commercial products in this article is solely for the purpose of providing specific information and does not
imply recommendation or endorsement by the EMBRAPA, Brazilian Agriculture Research Corporation. Acknowledgements The authors thank Camila Sá Rocha and Giseli Aparecida Ritterbusch for samples collection and Neide Lisiane Simon for technical assistance. We also thank Dr. Andrew Cheung for PPV4 genomic sequence. Funding was provided by EMBRAPA, and CNPq/Brazil. Q3 References Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402. Blomstrom, A.L., Stahl, K., Okurut, A.R., Masembe, C., Berg, M., 2013. Genetic characterisation of a porcine bocavirus detected in domestic pigs in Uganda. Virus Genes 47, 370–373. Bustin, S.A., Benes, V., Garson, J.A., Hellemans, J., Huggett, J., Kubista, M., Mueller, R., Nolan, T., Pfaffl, M.W., Shipley, G.L., Vandesompele, J., Wittwer, C.T., 2009. The MIQE guidelines: minimum information for publication of quantitative realtime PCR experiments. Clin. Chem. 55, 611–622. Cadar, D., Csagola, A., Kiss, T., Tuboly, T., 2013. Capsid protein evolution and comparative phylogeny of novel porcine parvoviruses. Mol. Phylogenet. Evol. 66, 243–253. Cheung, A.K., Wu, G., Wang, D., Bayles, D.O., Lager, K.M., Vincent, A.L., 2010. Identification and molecular cloning of a novel porcine parvovirus. Arch. Virol. 155, 801–806. Chou, H.H., Holmes, M.H., 2001. DNA sequence quality trimming and vector removal. Bioinformatics 17, 1093–1104. Cotmore, S.F., Agbandje-McKenna, M., Chiorini, J.A., Mukha, D.V., Pintel, D.J., Qiu, J., Soderlund-Venermo, M., Tattersall, P., Tijssen, P., Gatherer, D., Davison, A.J., 2014. The family Parvoviridae. Arch. Virol. 159, 1239–1247. Csagola, A., Lorincz, M., Cadar, D., Tombacz, K., Biksi, I., Tuboly, T., 2012. Detection, prevalence and analysis of emerging porcine parvovirus infections. Arch. Virol. 157, 1003–1010. Ewing, B., Hillier, L., Wendl, M.C., Green, P., 1998. Base-calling of automated sequencer traces using phred. I. Accuracy assessment. Genome Res. 8, 175–185. Huang, L., Zhai, S.L., Cheung, A.K., Zhang, H.B., Long, J.X., Yuan, S.S., 2010. Detection of a novel porcine parvovirus, PPV4, in Chinese swine herds. Virol. J. 7, 333. Mackay, I.M., Arden, K.E., Nitsche, A., 2002. Real-time PCR in virology. Nucleic Acids Res. 30, 1292–1305. Manteufel, J., Truyen, U., 2008. Animal bocaviruses: a brief review. Intervirology 51, 328–334. Opriessnig, T., Xiao, C.T., Gerber, P.F., Halbur, P.G., 2014. Identification of recently described porcine parvoviruses in archived North American samples from 1996 and association with porcine circovirus associated disease. Vet. Microbiol. 173, 9–16. Tijssen, P., Agbandje-McKenna, M., Almendral, J.M., Bergoin, M., Flegel, T.W., Hedman, K., Kleinschmidt, J., Li, Y., Pintel, D.J., Tattersall, P., 2011. Family Parvoviridae. In: King, A.M.Q., Adams, M.J., Carstens, E.B., Lefkowitz, E.J. (Eds.), Virus Taxonomy. Ninth Report of the International Committee on Taxonomy of Viruses. , pp. 405–425. Xiao, C.T., Gimenez-Lirola, L.G., Jiang, Y.H., Halbur, P.G., Opriessnig, T., 2013a. Characterization of a novel porcine parvovirus tentatively designated PPV5. PLoS One 8, e65312. Xiao, C.T., Halbur, P.G., Opriessnig, T., 2013b. Molecular evolutionary genetic analysis of emerging parvoviruses identified in pigs. Infect. Genet. Evol. 16, 369–376. Yun, J.J., Heisler, L.E., Hwang, I.I., Wilkins, O., Lau, S.K., Hyrcza, M., Jayabalasingham, B., Jin, J., McLaurin, J., Tsao, M.S., Der, S.D., 2006. Genomic DNA functions as a universal external standard in quantitative real-time PCR. Nucleic Acids Res. 34, e85. Zhang, H.B., Huang, L., Liu, Y.J., Lin, T., Sun, C.Q., Deng, Y., Wei, Z.Z., Cheung, A.K., Long, J.X., Yuan, S.S., 2011. Porcine bocaviruses: genetic analysis and prevalence in Chinese swine population. Epidemiol. Infect. 139, 1581–1586.
Please cite this article in press as: Gava, D., et al., A TaqMan-based real-time PCR for detection and quantification of porcine parvovirus 4. J. Virol. Methods (2015), http://dx.doi.org/10.1016/j.jviromet.2015.03.011
304 305
306
307 308 309 310
311
312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364
