Cell, Vol. 71,

1029-1040,

December 11,

1992,

Copyright 0 1992 by Cell Press

A TBP Complex Essential for Transcription from TATA-Less but Not TATA-Containing RNA Polymerase Ill Promoters Is Part of the TFIIIB Fraction Susan M. Lobo, Masafumi Tanaka, Maureen L. Sullivan, and Nouria Hernandez Cold Spring Harbor Laboratory Cold Spring Harbor, New York 11724

Summary The TATA box-binding protein TBP directs transcription by all three eukaryotlc RNA polymerases. In mammalian cells, TBP is found in at least three different complexes: SLl, D-TFIID, and B-TFIID. While SLl and D-TFIID are involved in RNA polymerase I and II transcription, respectively, no unique function has been assigned to the B-TFIID complex. Here we show that the TFIIIB fraction required for RNA polymerase Ill transcription contains two separable components, one of which is a Tap-containing complex that may correspond to 5TFIID. For transcription of TATA-less RNA polymerase Ill genes such as the VAI, 5S, and 7SL genes, this complex cannot be replaced by either TBP alone or the D-TFIID complex. In contrast, TBP alone is active for basal transcription from the TATAcontaining U6 promoter. This indicates different requirements for recruiting TBP to TATA-less and TATAcontaining RNA polymerase Ill promoters. Introduction In eukaryotes, correct transcription initiation requires the prior recognition of basal promoter elements by a number of accessory transcription factors. Because RNA polymerase I, II, and Ill promoters have very different structures, they have long been thought to bind distinct classes of accessory factors. But in the past few years, several RNA polymerase Ill promoters have been found to contain elements typical of RNA polymerase II promoters. The most extreme example is probably the U6 promoter, which is constituted exclusively of RNA polymerase II promoter elements positioned upstream of the transcriptional start site (for reviews, see Dahlberg and Lund, 1968; Hernandez, 1992). These elements include the proximal sequence element located around position -56 that is also found in the RNA polymerase II snRNA promoters and a TATA box located around position -25 that determines the RNA polymerase III specificity of the promoter (Mattaj et al., 1988; Lobo and Hernandez, 1989). The presence of RNA polymerase II promoter elements in RNA polymerase Ill promoters suggested that certain transcription factors may be shared by different RNA polymerases. Indeed, the TATA box-binding protein (TBP), a subunit of the TFIID complex that recognizes the TATA box of mRNA promoters and directs the assembly of RNA polymerase II initiation complexes (see Sawadogo and Sentenac, 1990, for a review), is required for U6 transcription (Lobo et al., 1991; Margottin et al., 1991; Simmen et al., 1991). TBP binds to the U6 TATA box but not to mu-

tated TATA boxes that convert the U6 promoter into an RNA polymerase II promoter, suggesting that, paradoxically, in the context of the U6 promoter it is the binding of TBP to the TATA box that recruits RNA polymerase Ill to the promoter (Lobo et al., 1991). Thus, it is the particular combination of transcription factors present in an initiation complex rather than the identity of any individual transcription factor(s) that results in the recruitment of a specific RNA polymerase. This and other observations led us to propose that TBP might be a general factor involved in transcription from promoters recognized by all three polymerases, including TATA-less RNA polymerase III promoters (Lobo et al., 1991). That TBP is indeed a transcription factor used by all three RNA polymerases has recently been shown both by biochemical and genetic methods (Comai et al., 1992; White et al., 1992; Cormack and Struhl, 1992; Schultz et al., 1992). In yeast, transcription from various TATA-less RNA polymerase Ill promoters such as the tRNA and 5s promoters is greatly reduced in TBP conditional mutants at the nonpermissive temperature, as well as in extracts prepared from such mutants (Cormack and Struhl, 1992; Schultz et al., 1992). In HeLa cell extracts, transcription from such promoters is inhibited by addition of TATA boxcontaining oligonucleotides and by heat treatment, and addition of TBP is necessaryto restore transcription (White et al., 1992). While these experiments clearly indicate a requirement for TBP, they leave unresolved the question of how TBP is recruited to TATA-less RNA polymerase Ill promoters. RNA polymerase Ill TATA-less promoters include the internal control region of the 5S genes and the A and B boxes of tRNA and the Adenovirus 2 (Ad2) VAI genes. The factors required by these promoters have been fractionated by phosphocellulose chromatography into fractions A, B, and C, which contain TFIIIA, TFIIIB, and TFIIIC, respectively (Segall et al., 1980; Shastry et al., 1982). TFIIIA binds to the internal control region of 5s genes and allows the subsequent binding of TFIIIC and TFIIIB. In contrast, TFIIIC can bind to the A and B boxes of the tRNA and VAI genes and recruit TFIIIB on its own (Engelke et al., 1980; Braun et al., 1989; Gabrielsen et al., 1989; Kassavetis et al., 1989, 1990; see Geiduschek and Kassavetis, 1992, for a review). TFIIIB is the key factor required for RNA polymerase III transcription, in that it seems to contact the enzyme directly (Kassavetis et al., 1990). While TFIIIA is a single polypetide whose corresponding cDNA has been cloned (Engelke et al., 1980; Ginsberg et al., 1984) the components of TFIIIB and TFIIIC are much less well defined. Mammalian TFIIIB has been reported to consist of a single polypeptide of 60 kd (Waldschmidt et al., 1988) but yeast TFIIIB consists of at least two polypeptides of 70 and 90 kd (Bartholomew et al., 1991; Kassavetis et al., 1991) suggesting that mammalian TFIIIB may be more complex. TFIIIC can be separated into TFIIICl and TFIIICP, which are both required for transcription of the VAI gene (Dean and Berk, 1987; Yoshinagaet al., 1987,1989). TFIIICP

Cell 1030

B /

TBP+ 282C + 244C

/

aX$g FF?Ji$fN,

198C

-46K

I

2

3

4

5

6

7 8

Figure 1, Mapping of TBP Sequences the SL Monoclonal Antibodies

-

30K

Required for Recognition

by

9

IO II 12 13 14

(A) Schematic representation of the human TBP structure (339 amino acids) showing the stretch of 38 glutamines, the five PMT repeats, and theevolutionarilyconserved 180aminoacid DNA-bindingdomain. The arrows represent the N-termini of the TBP truncations that were used in Figure 1 B. (B) lmmunoprecipitation of N-terminally truncated TBP proteins. Lanes 6-9 show the products of in vitro translation reactions programmed with RNA encoding full-length TBP (lane 6) or the N-terminally truncated versions of TBP 282C (lane 7) 244C (lane S), and 198C (lane 9). Lanes l-5; immunoprecipitations of a mixture containing in vitro translated TBP, 282C, and 244C with the MAbs indicated above the lanes. The prefix SL denotes MAbs raised against human TBP; 12CA5 was raised against a peptide derived from the influenza virus hemagglutinin protein (Niman et al., 1983). Lanes 10-14; immunoprecipitations of the 198C truncation of human TBP with the MAbs indicated above the lanes.

has been purified to five polypeptides (Yoshinaga et al., 1989) but the active components of TFlllCl have not been identified. At present, it is not clear which, if any, of the known components involved in RNA polymerase Ill transcription contains TBP. The majority and perhaps all of mammalian TBP is found complexed with other proteins. So far, three complexes have been identified: a 300 kd complex referred to as B-TFIID (Timmers and Sharp, 1991), a 750 kd complex referred to as TFIID (Matsui et al., 1980; Samuels et al., 1982; Nakajima et al., 1988; Conaway et al., 1990, 1991) or D-TFIID (Timmers and Sharp, 1991), and a 230 kd complex referred to as SLl (Comai et al., 1992). TBP, B-TFIID, and D-TFIID can all sustain basal RNA polymerase II transcription from TATAcontaining promoters in vitro. However, only D-TFIID can mediate efficient transactivation by upstream binding factorssuch as Spl , GALC AH, and MLTFlUSF (Hoey et al., 1990; Hoffman et al., 1990b; Peterson et al., 1990; Pugh and Tjian, 1990; Timmers and Sharp, 1991), and this activity can be attributed to the TATA box-associated factors (TAFs) present in the D-TFIID complex (Dynlacht et al., 1991; Tanese et al., 1991). Similarly, SLl, which is required for RNA polymerase I transcription, cannot be substituted by TBP, sug-

gesting that the TAFs in SLl play an essential role (Comai et al., 1992). However, unlike D-TFIID and SLl, B-TFIID has no known properties that aredistinct from those of TBP alone; thus, the specific function of B-TFIID is at present unknown. To determine which forms of TBP are involved in transcription by RNA polymerase Ill and whether TBPcontaining complexes might correspond to previously described RNA polymerase III transcription factors, we developed a panel of anti-TBP monoclonal antibodies (MAbs). Using these reagents, we show that the TFIIIB fraction can be chromatographically separated into two components, one of which is a TBP-containing complex required for transcription of TATA-less RNA polymerase Ill genes with internal promoter elements. For these genes, this complex cannot be replaced by either free TBP or D-TFIID. In contrast, all three forms of TBP can mediate basal transcription from the U8 promoter. Nondenaturing immunoprecipitations with anti-TBP antibodies suggest that specific TBP-associated proteins mediate the recruitment of TBP to TATA-less RNA polymerase Ill promoters. Results The MAbs SL3, SL30, SL33, and SL35 Raised against Human TBP Recognize the Nonconserved N-Terminal Domain The amino acid sequence comparison of TBP from different species has revealed a structure consisting of an N-terminal hypervariable domain and a C-terminal conserved domain of 180 amino acids that contains an imperfect direct repeat and is sufficient for DNA binding (Fikes et al., 1990; Gasch et al., 1990; Hoffmann et al., 1990a, 1990b; Horikoshi et al., 1990; Kao et al., 1990; Peterson et al., 1990; see Greenblatt, 1991, for a review). Figure 1A shows a schematic representation of human TBP, whose N-terminal domain contains a unique stretch of 38 glutamine residues and a region consisting of five imperfect repeats of the motif proline-methionine-threonine (PMT repeats) (Hoffmann et al., 1990b; Kao et al., 1990; Peterson et al., 1990). To determine which regions of the protein were needed for recognition by the four monoclonal antibodies used in this study, RNA templates were synthesized in vitro from polymerase chain reaction (PCR) fragments carrying either the SP8 or the T7 promoter and then translated in a rabbit reticulocyte lysate (see Experimental Procedures for details). Full-length TBP as well as truncated molecules containing the last 282, 244, or 198 carboxy-terminal amino acids were generated (see Figures 1 A and 1 B, lanes 8-9) and used for two sets of immunoprecipitations. In one set, a mixture of full-length TBP and the 282C and 244C truncations was tested with each anti-TBP MAb (denoted with the prefix SL) as well as with 12CA5 (Niman et al., 1983) a MAb directed against an irrelevant peptide derived from the influenza virus hemagglutinin protein (Figure lB, lanes l-5). The 198C truncation was tested separately in a second set of immunoprecipitations (Figure 1 B, lanes 1 O-l 4) because translation of the longer versions of TBP generated an unidentified comigrating product (see Figure 1 B, lanes 6-9). All four SL

fO;yP-Containing

Complex

o< -ama

Is a Component

SL30

of TFIIIB

SL33 SL35 12CA5

Ml-/lAAA

123 IIO-

I, I

404 -

-

309 -

Am-

’ -5s

160 147 -

U6

ML

404 -

@ I

2

3 4

Figure 2. The Anti-TBP Polymerases II and Ill

5

6

7

8

9

IO II 12

MAbs Inhibit In Vitro Transcription

by RNA

Transcription from the VAI, ES, 7SL, U6, and Ad2 major late (ML) promoters was tested either in extracts without added MAbs (lanes 24) or in extracts preincubated with 47 Kg/ml (lanes 5, 7, 9, and 11) or 63 pglml (lanes 6, 6, 10, and 12) of the indicated MAbs. a-amanitin was added to a final concentration of 4 (lane 3) and 300 pg/ml (lane 4) to inhibit RNA polymerase II and III, respectively. Lane 1 contains labeled pBR322 Hpall fragments as markers whose sizes are indicated on the left. Owing to uneven electrophoresis in the gel shown in the bottom panel, the samples on the left migrated significantly further than those on the right.

MAbs immunoprecipitated full-length TBP, as expected (lanes l-5). SL33 and SL35 immunoprecipitated in addition both the 282C and 244C TBP truncations (lanes 3 and 4). None of the MAbs immunoprecipitated the 198C truncation (lanes 10-13). These results show that MAbs SL3 and SL30 require sequences upstream of the glutamine stretch to recognize TBP, while MAbs SL33 and SL35 require sequences between the glutamine stretch and the PMT repeats. In immunoblots of HeLa cell nuclear extracts, the four SL MAbs recognize a single polypeptide migrating with the mobility of TBP (45 kd), indicating that they are highly specific and do not cross-react with other proteins in the extract (data not shown and Figure 48, lane 5). As expected, the MAb 12CA5 did not cross-react with any of the TBP domains (Figure 1 B, lanes 5 and 14) and was therefore used as a control antibody in the experiments described below.

The SL MAbs Inhibit RNA Polymerase II and RNA Polymerase Ill Transcription In Vitro Because the SL MAbs were raised against denatured TBP, we next determined whether they could recognize transcriptionally active forms of the protein by testing their effect on transcription of different genes. Nuclear HeLa cell extract was preincubated with two different amountsof SL30, SL33, SL35, and 12CA5, and tested for transcription from RNA polymerase Ill promoters that do (U6) or do not (VAI, 5S, and 7SL) contain a TATA box, as well as from the RNA polymerase II TATA box-containing Ad2 major late promoter. The a-amanitin titrations in Figure 2, lanes 3 and 4, show that as expected, in vitro transcription from the Ad2 major late promoter is directed by RNA polymerase II, whereas in vitro transcription from the VAI, 5S, 7SL, and U6 promoters is directed by RNA polymerase Ill. As noted previously, some residual U6 transcription is observed even with high levels of a-amanitin (lane 4), which may be directed by RNA polymerase I (Lobo et al., 1991). The anti-TBP MAbs SL30, SL33, and SL35 reduced transcription from the VAI, 5S, 7SL, U6, and Ad2 major late promoters to undetectable levels (Figure 2, compare lanes 5-10 with lane 2), and so did SL3, although in this case higher concentrations were needed for complete inhibition (data not shown). In contrast, the 12CA5 antibody had no deleterious effect (lanes 11 and 12); in fact, addition of 12CA5 resulted in stimulation of transcription, perhaps owing to the increased protein concentration in antibodycontaining reactions over the control reaction (lane 2), to which no antibody was added. These results are consistent with biochemical (Lobo et al., 1991; Margottin et al., 1991; Simmen et al., 1991; White et al., 1992) and genetic (Cormack and Struhl, 1992; Schultz et al., 1992) data suppotting a role for TBP in RNA polymerase Ill transcription. In addition, they indicate that MAbs directed against the hypervariable region of TBP can inhibit its activity in both RNA polymerase II and Ill transcription. The Phosphocellulose B Fraction Contains Two Components Required for RNA Polymerase Ill Transcription from the VAI Promoter The data described above support a role for TBP in transcription of TATA-less as well as TATA-containing RNA polymerase Ill promoters. The typical fractionation of RNA polymerase III transcription factors by phosphocellulose chromatography is into a 0.1 M KCI flow through (A fraction), a 0.1-0.35 M KCI step elution (B fraction), and a 0.35-0.6 M KCI step elution (C fraction), which contain TFIIIA, TFIIIB, and TFIIIC, respectively (Segall et al., 1980; Shastry et al., 1982). Transcription of the VAI gene can be reconstituted with the phosphocellulose Band C fractions, which supply RNA polymerase Ill (present in both fractions), TFIIIB, and TFlllC(Segall et al., 1980). Interestingly, both the Band C fractions also contain TBP, as determined by immunoblot, the B fraction in much larger amounts than the C fraction (data not shown); while the TBP in the C fraction has not been characterized, most if not all the TBP in the Bfraction is in the 300 kd B-TFIID complex (Timmers and Sharp, 1991). To identify which fraction contains the TBP Component

Cdl 1032

O IM 06M Y--r

038M D.38M-TFm0

048M 048M-TFmB

C(TBP-1

03M D-TFILD

I

0.38M-TFIltB

(TBP-)

Figure 3. Fractionation Scheme Used to Obtain the A, 8, C, D. 0.38MTFIIIB, O.SSM-TFIIIB(TBP-), 0.48M-TFIIIB, C(TBP-). and D-TFIID Fractions The 0.3SM-TFlllB(TBP-) and C(TBP-) fractions were depleted of TBP by incubation with 0.125-0.25 vol of packed protein G-Sepharose beads coated with MAb SL33. The supernatants were then used for transcriptions (see Experimental Procedures for details).

required for RNA polymerase III transcription, we fractionated an extract by phosphocellulose chromatography as shown in Figure 3 to obtain the A, 6, and C fractions. In addition, we eluted the column with 0.85 M KCI to obtain the D fraction, which is required for RNA polymerase II transcription and contains the D-TFIID complex (Matsui et al., 1980; Samuels et al., 1982; Sumimoto et al., 1990). We then depleted the C fraction of TBP by passage over an SL33 MAb affinity column and obtained a fraction devoid of TBP as determined by immunoblot (see below, Figure 4F, lane 2), which we refer to as “C(TBP-)” (see Figure 3). These various fractions were tested for reconstitution of VAI transcription, and the results are shown in Figure 4A. Although C(TBP-) had no transcriptional activity on its own, as expected (lane 4), it was able to sustain efficient VAI transcription when combined with the 6 fraction (lane 11). This transcription was as efficient as that obtained in a combination of the B fraction and a nondepleted C fraction (data not shown). This result suggests that the TBP in the 6 fraction is functional for VAI transcription and is a component of TFIIIB. To test this hypothesis, we further fractionated the B fraction by chromatography over a Mono Cl column eluted with a 0.1 M to 0.8 M KCI gradient and tested the resulting fractions for their ability to complement a nondepleted C fraction for transcription of the VAI gene. We found that the peak of activity eluted at 0.48 M KCI (Figure 48, fraction 72) a fraction we therefore refer to as the 0.48M-TFIIIB fraction (see Figure 3). This activity did not correspond to RNA polymerase Ill, because the 0.48M-TFIIIB fraction did not contain any RNA polymerase Ill activity (data not

shown). We next determined whether this peak of activity could be correlated with the presence of TBP by assaying the same Mono Q fractions by immunoblot and for stimulation of RNA polymerase II transcription from the Ad2 major late promoter. Surprisingly, the peak of TBP was found in an earlier fraction that elutes at 0.38 M KCI (Figure 4C, fraction 84) and is referred to as 0.38M-TFIIIB (see Figure 3) because, as shown below, it is a component of TFIIIB. No TBP could be detected in the 0.48M-TFIIIB fraction. Similarly, the 0.38M-TFIIIB fraction could stimulate RNA polymerase II transcription from the major late promoter, while the 0.48M-TFIIIB fraction had no activity in this assay (Figure 4D, compare lanes 8 and 4). Thus, as determined by both assays, the 0.48M-TFIIIB fraction contained no TBP, and yet TBP is required for VAI transcription (White et al., 1992; see also Figure 2 above) and can be provided by the B fraction (Figure 4A, lane 11). A possible explanation for these apparently contradictory results was that the Mono Q fractions had been tested for their ability to reconstitute VAI transcription in combination with a C fraction that had not been depleted of TBP. The C fraction contains small amounts of TBP and could therefore conceivably provide the TBP needed for VAI transcription. To test this possibility, we combined increasing amounts of the 0.48M-TFIIIB or 0.38M-TFIIIB fractions with C(TBP-) (see Figure 3). As shown in Figure 4E, even the largest amounts of the 0.38M-TFIIIB or 0.48M-TFIIIB fractions could not confer significant transcriptional activity to the C(TBP-) fraction in the absence of the other fraction (lanes 2-6 and 7-l 1). In striking contrast, however, very efficient VAI transcription was obtained in a combination of the three fractions (Figure 4E, lane 12 and Figure 4A, lane 8) and this transcription was directed by RNA polymerase Ill, as shown by its sensitivity to high but not to low levels of a-amanitin (Figure 4A, lanes 9 and 10). Figure 4F shows an immunoblot in which each of the fractions described above was assayed for the presence of TBP. As expected, the B and 0.38M-TFIIIB fractions contained TBP while the 0.48M-TFIIIB and the C(TBP-) fractions did not (lanes l-4). Together, these results indicate that the TFIIIB fraction can be separated into two components required for transcription of the VAI gene, and they strongly suggest that one of these components contains TBP. The TBP in the 0.38%TFIIIB Fraction Is Essential for Activity and Is Required for Transcription of Several RNA Polymerase Ill Genes with Internal Promoter Elements The 0.38M-TFIIIB fraction is a complex mixture of polypeptides. To confirm that the active component of this fraction contains TBP, we used SL33, which recognizes an epitope downstream of the glutamine stretch of TBP (see Figure lB), to deplete the 0.38M-TFIIIB fraction and generate a fraction we refer to as 0.38M-TFIIIB(TBP-) (see Figure 3). Figure 5B shows that the depletion was successful; while TBP is detectable in the 0.38M-TFIIIB fraction by immunoblot, it is undetectable in the 0.38M-TFIIIB(TBP-) fraction (compare lanes 3 and 4). 0.38M-TFIIIB(TBP-) was then compared with 0.38M-TFIIIB for reconstitution of VAI,

A TBP-Containing 1033

Complex

Is a Component

of TFIIIB

W-am0 0.48M-TF

- - 242 217 201 190 180-

- - - - -

-

0.38M-TF C(TBP-1 I+

VA1

I

VA1

-

160 l47-

1

IB

I

2 3

4

5 6

7

8 9 IO I I 12 13 I4

1

I

2

3

4

5

6

7 8

9

IO II

622p.w 527--

M

I 2 3 4 5 6

7

8 9 IO II 12 I3 14

I23456789101112

C(TBP-1 0.38M-TFlIt8 0.48M-TFIIIB

a

I

2 3

4

5

6

7

Figure 4. The Phosphocellulose merase Ill

I

VA1 -

8 9 IO I I I2

+]TBP

I23456

B Fraction Can Be Resolved into Two Components

Required for Transcription

of the VAI Gene by RNA Poly-

(A) Transcription reactions were performed with 2 pl of each of the fractions as indicated above the lanes. Each reaction was adjusted to a final volume of 10 ul with buffer D. In lanes 9 and 10, a-amanitin was added to a final concentration of 4 and 306 us/ml, respectively. The VAI gene gives rise to two bands; the major one corresponds to correctly terminated VA RNA, while the minor one corresponds to a product extended to a second termination signal 39 nt downstream (Weil et al., 1979). (B) VAI transcription was reconstituted by combining 3 ul of the Mono Q fractions indicated above the lanes (lanes 1 to 12) buffer D (lane 13) or the phosphocellulose B fraction (lane 14) with 3 pl of phosphocellulose C (0.35-0.6 M KCI) fraction. (C) Thirty microliters of each Mono Q fraction indicated above lanes 1 to 11 or 10 ul of HeLa nuclear extract (lane 12) were fractionated by SDSPAGE and transferred to nitrocellulose. The filter was then probed with MAb SL30. (0) Transcription from the Ad2 major late promoter was assayed in combinations of a TFIIA fraction (Sumimoto et al., 1990) a phosphocellulose 0.3 to 0.5 M step elution fraction that provided TFIIB, TFIIE, TFIIF, and RNA polymerase II (Sumimoto et al., 1990), and either 2.4 ul of the Mono 0 fractions indicated above the lanes (lanes l-12). 2.4 pl of buffer D (Dignam et al., 1963: lane 13) or 2.4 pl of D-TFIID (lane 14). In lane 5, part of the sample was lost upon loading the gel. (E) Three microliters of the C(TBP-) fraction was combined with the indicated amounts of 0.36 M TFIIIB or 0.46 M TFIIIB fractions, and the different combinations were used to transcribe the VAI gene. (F) Twenty microliters of the B, 30 ul of the C(TBP-), 30 ul of the 0.36 M TFIIIB, and 30 ul of the 0.46 M TFIIIB fractions as well as 10 ul of nuclear extract (NE) and 40 ng of recombinant human TBP (TBP) were fractionated by SDS-PAGE and transferred to nitrocellulose. The filter was probed with MAb SL30.

5s and, 7SL transcription in a nuclear extract depleted of TBP with the SL3 MAb, which recognizes an epitope upstream of the glutamine stretch of TBP (Figure 1 B). The use of MAbs with different specificities to deplete the 0.38M-TFIIIB fraction and the nuclear extract ensured that

the effects observed were due to depletion of TBP and not to depletion of another protein with a cross-reacting epitope. As shown in Figure 5A, the extract depleted with the SL3 MAb had residual transcriptional activity, indicating that depletion of TBP was not complete (lane 4). Never-

Cdl 1034

1

VA1

- 5s

I234

- 7SL 123456 Figure 5. The TBP in the 0.36M-TFIIIB

Fraction Is Essential for Activity

(A) HeLa nuclear extract was either mock depleted with MAb 12CA5 (lanes l-3) or depleted of TBP with MAb SL3 (lanes 4-6) and used to transcribe the VAI, 5S, and 7SL genes. Each reaction contained 6 ul of extract and was complemented with either 2 ul of buffer D (lanes 1 and 4) 2 ul of 0.36M-TFIIIE (lanes 2 and 5). or 2 pl of 0.36W TFIIIB(TBP-) (lanes 3 and 6). (8) 30 ul of 0.36WTFIIIB(TBP-), 30 ul of 0.36M-TFIIIB, as well as 10 ul of nuclear extract and 20 ng of recombinant TBP were fractionated by SDS-polyacrylamide gel electrophoresis, transferred to nitrocellulose, and the filter was probed with MAb SL30.

theless, it is clear that the 0.38M-TFIIIB fraction, but not the 038MTFIIIB(TBP-) fraction, restored transcriptional activity to the levels of a mock-depleted extract for the VAI, 7SL, and 5s genes (compare lanes 5 and 8 to lane 1). We also obtained stimulation of transcription with 0.38MTFIIIB but not with 0.38M-TFIIIB(TBP-) in the mock depleted extract, suggesting that 0.38M-TFIIIB was limiting in this extract (compare lanes 2 and 3 with lane 1). These results confirm that the active component in the 0.38MTFIIIB fraction includes TBP, and they show that the 0.38MTFIIIB fraction stimulates transcription of all three genes with internal promoters tested. Different Forms of TBP Are Involved in Transcription of Different RNA Polymerase Ill Genes The observation that 0.38M-TFIIIB is required for transcription of the VAI, 5S, and 7SL genes raised an interesting question: are other forms of TBP also functional in transcription of these genes? To address this possibility, we further fractionated the high-salt phosphocellulose D fraction by chromatography over a DE52 column as described by Sumimoto et al. (1990) to obtain the D-TFIID fraction (see Figure 3). To ascertain that D-TFIID as well as 0.38MTFIIIB and recombinant TBP were active, we

tested them for their ability to direct basal transcription from the Ad2 major late promoter, which can use all three forms (Hoeyet al., 1990; Hoffman et al., 19906; Peterson et al., 1990; Pugh and Tjian, 1990; Timmers and Sharp, 1991). Figure 6A shows that TBP, 0.38M-TFIIIB, and D-TFIID all stimulated RNA polymerase II transcription from the Ad2 major late promoter in a Tap-depleted nuclear extract by 3-5.fold. We then tested the three fractions for their ability to restore transcription of different RNA polymerase Ill genes in the Tap-depleted nuclear extract; the results are shown in Figure 6B. Transcription of the U6 gene was stimulated by addition of increasing amounts of all three sources of TBP: TBP alone, 0.38M-TFIIIB, and D-TFIID (compare lanes 3-l 1 with lane 2). The highest activity was obtained with TBP alone (lanes 34, probably reflecting the higher concentration of TBP in this fraction as compared with 0.38M-TFIIIB and D-TFIID (see below). In striking contrast, even the highest amounts of TBP and D-TFIID could not stimulate transcription from the VAI and 5S genes (lanes 3-5 and 9-11). Transcription of these genes was, however, restored to levels close to those observed in the nondepleted extract (lane 1) by addition of increasing amounts of 0.38M-TFIIIB (lanes 6-8). Figure 6C shows an immunoblot with different amounts of the TBP, 0.38MTFIIIB, and D-TFIID fractions. Although this assay is not linear, it shows that of the three fractions, 0.38M-TFIIIB is the least concentrated in TBP (see legend of Figure 6B for quantitations). Thus, the inability of the D-TFIID and TBP fractions to stimulate VAI and 5S transcription does not result from insufficient TBP in these fractions. Nor is the inability to stimulate due to titration of limiting factors by excess of free D-TFIID or TBP, because VAI or 5S transcription was not observed even with lower levels of these fractions (data not shown). It remained possible, however, that the TBP and D-TFIID fractions contained inhibitors that specifically suppressed transcription of the VAI and 5S genes and thereby masked the activities of TBP and D-TFIID. To exclude this possibility, a Tap-depleted nuclear extract was complemented with either the 0.38MTFIIIB fraction alone, or with mixtures of the 0.38M-TFIIIB and D-TFIID or 0.38MTFIIIB and TBP fractions. As shown in Figure 6D, mixtures of 0.38MTFIIIB and D-TFIID (lane 6) or 0.38M-TFIIIB and TBP (lane 7) fractions were as active in restoring VAI transcription as the 0.38M-TFIIIB fraction alone (lane 3) indicating that they do not contain inhibitors of VAI transcription. Together, these results strongly suggest that only one form of TBP, that present in the 0.38MTFIIIB fraction, is active for transcription of RNA polymerase Ill genes with gene internal promoter elements such as the VAI and 5S genes. The TBP Complex in the 0.38M-TFIIIB Fraction Contains an 82 kd TBP-Associated Protein As a first step toward characterizing the polypeptide composition of the Tap-containing complex in the 0.38MTFIIIB fraction, we performed nondenaturing immunoprecipitations with an immunoaffinity-purified anti-TBP polyclonal antibody (obtained from N. Tanese and Ft. Tjian)

;O;;P-Containing

Complex

r*

-ML

Is a Component

of TFIIIB

I234567 e 3

TBP

0.3aMTFIlTB

D-TFIID

L125.121)61121 -THP

I

/

1 -

II,

Figure 7. lmmunoprecipitation 036M-TFIIIB Fraction

VA1

2

3

4

of the TBP-Containing

Complex in the

lmmunoprecipitations were carried out as described in Experimental Procedures using the antibodies indicated above the lanes. The arrow indicates an 62 kd TAF and the dots indicate 150 and 54 kd TAF candidates.

5s

123456789Dll

C

1

VA1

0

or

1234567

12345678

Figure 6. Different Forms of TBP

RNA

Polymerase

III Promoters

Use Different

(A) The activity of the TBP, 0.36M-TFIIIB, and D-TFIID fractions was assayed by addition of 2 ul of each fraction as indicated above the lanes to a nuclear extract depleted of TBP with the MAbs SL30 and SL35. In lane 1,2 ul of buffer D was added. The reactions in lanes 3, 5, and 7 contained 4 uglml of a-amanitin. (6) Different amounts (as indicated above the lanes in ul) of TBP (lanes 3-5). 0.36M-TFIIIB (lanes 6-6) and D-TFIID (lanes 9-11) were added to 6 ul of SLdO-depleted nuclear extract (lane 2), and the resulting mixtures were used to transcribe the U6, VAI, and 5s genes. In lane 1, 3 ul of HeLa extract (not depleted) was used for transcription. Each reaction was adjusted to a final volume of 10 ul with buffer D. By comparison with TBP, whose concentration is 20 nglul, the 0.36M TFIIIB and D-TFIID fractions were estimated to contain 0.04 nglul and 0.11 nglul, respectively, from the immunoblot shown in (C). (C) lmmunoblot probed with SL30 and visualized by enhanced chemiluminescence (ECL). The volumesof recombinant TBP, 0.36M-TFIIIB, and D-TFIID used are indicated above the lanes. In lanes 1 and 2. these volumes corresponded to 20 and IO ng, respectively, of recombinant TBP. (D) The D-TFIID and TBP fractions do not contain RNA polymerase Ill inhibitors. A HeLa nuclear extract was depleted of TBP with MAb SL30 and used for transcription of the VAI gene. Lanes 2-7 contain 6 ul of depleted extracl and the indicated volumes of TBP, 0.36MTFIIIB, and D-TFIID. In lane 1, 3 pl of HeLa extract (not depleted) were used for transcription. Each reaction was adjusted to a final volume of 10 ul with buffer D.

and the MAbs SL30 and SL33, which recognize different TBP epitopes (see Figure 16). As a control, we used the MAb 12CA5. As shown in Figure 7, the anti-TBP polyclonal antibody as well as the SL30 and SL33 MAbs, but not the 12CA5 control antibody, precipitated TBP, as expected (compare lanes 2-4 with lane 1). In addition, all the antiTBP antibodies, but not the 12CA5 control antibody, precipitated a protein which migrated with an apparent molecular size of 82 kd (marked by an arrow in Figure 7). Since this protein was not observed in denaturing immunoprecipitations (data not shown) and is precipitated by two antiTBP MAbs with different specificities, it is precipitated by virtue of its association with TBP rather than by direct cross-reaction with the antibodies. This association is stable to400 pg of ethidium bromide (data not shown), indicating that it is not mediated through contaminating DNA in the 0.38M-TFIIIB fraction (Lai and Herr, 1992). Two other polypeptides of 150 kd and 54 kd, respectively (labeled by dots in Figure 7) were reproducibly precipitated by the three anti-TBP antibodies. We cannot exclude, however, that these two proteins are also present in the 12CA5 control immunoprecipitation, because the corresponding portions of the gel are obscured by other proteins migrating in their vicinity (lane 1). Together, these results indicate that the TBP-containing complex in the 0.38M-TFIIIB fraction contains an 82 kd protein and perhaps proteins of 150 and 54 kd. Discussion The TATA binding protein TBP has recently been shown to be involved not only in transcription from TATA-containing RNA polymerase II and Ill promoters, but also in transcription from TATA-less promoters recognized by all three RNA polymerases (Pugh and Tjian, 1991; Comai et al.,

Cell 1036

1992; Cormack and Struhl, 1992; Schultz et al., 1992; White et al., 1992). This raises an important question: how is TBP recruited to TATA-less RNA polymerase ill promoters? As a first step toward answering this question, we have identified and compared the forms of TBP that direct transcription from TATA-containing and TATA-less RNA polymerase ill promoters. TFWB Contains Two Separable Components Required for VAI Transcription We have shown that TFIIIB contains two separable components required for VAI transcription; one elutes at 0.38 M KCI from a Mono Q column and the second elutes at 0.48 M KCI. The component eiuting at 0.38 M KCI may correspond to the B-TFIID complex characterized by Timmers and Sharp (1991). Indeed, we detect only one peak of TBP in the Mono Q column, suggesting that there is only one majorTBPcontaining complex in the B fraction, and these TBP-containing fractions are active for basal transcription of the Ad2 major late promoter (see Figures 4D and 8A), like the B-TFIID fraction described by Timmers and Sharp (1991). And most convincingly, upon further chromatography of the Mono Q 0.38 M KCI fraction on a Superose 12 column, the component active for VAI transcription elutes with an apparent molecular size of approximately 300 kd (data not shown), the size of the B-TFIID complex as determined by similar methods (Timmers and Sharp, 1991). The large size of the 0.38M-TFIIIB complex suggests that it contains TAFs; since 0.38M-TFIIIB cannot be replaced by TBP alone for VAI transcription, the TAFs are probably essential for its function in RNA poiymerase Iii transcription, in the same way in which the TAFs present in the SLl complex are essential for its function in RNA polymerase I transcription (Comai et al., 1992). Nondenaturing immunoprecipitations identify a protein migrating with an apparent molecular size of 82 kd as a TAF and two proteins with apparent molecular size of 150 and 54 kd as TAF candidates. Further purification will be required to establish the exact poiypeptide composition of the functionally active complex. Yeast TFIIIB is known to consist of at least two poiypeptides of 90 and 70 kd (Bartholomew et al., 1991; Kassavetis et al., 1991) while mammalian TFIIIB has been reported to consist of a single 60 kd poiypeptide (Waidschmidt et al., 1988). in this last case, the assay used for TFIIIB purification was compiementation of a C fraction for VAI transcription. We find that the 0.48M-TFIIIB fraction is capable on its own of complementing a C fraction that has not been depleted of TBP (Figure 48). It is therefore possible that the TFIIIB purified by Waldschmidt et al. (1988) corresponds to our 0.48M-TFIIIB fraction. Transcription of TATA-Containing and TATA-Less RNA Polymerase ill Genes Uses Different Forms of TBP We have shown that transcription of different RNA polymerase iii genes uses different forms of TBP; specifically, transcription of the VAI, 5S, and 7SL genes requires the 0.38M-TFIIIB complex, while transcription of the U6 gene

can function with TBP alone and also with 0.38M-TFIIIB and D-TFIID. The inability of theTBP and D-TFIIDfractions to restore VAI or 5s transcription to a depleted extract was not due to loss of activity in these fractions, because they were able to restore activity from two other promoters, the Ad2 major late promoter and the U6 promoter (Figure 6B), and because the D-TFIID fraction was able to sustain transactivation by the POU domain activator Ott-2 (M. T., unpublished results). Nor did it result from the presence of specific inhibitors, since these fractions had no deleterious effect when mixed with the active 0.38M-TFIIIB fraction (Figure 6D). These results contrast with those of White et al. (1992) who found that transcription of TATA-less RNA polymerase iii genes could be restored by addition of TBP to extracts inactivated by heat treatment or by the addition of TATA box-containing oiigonucleotides. This is probably because in these experiments, the endogenous TBPcontaining complexes were not removed from the extracts, and the 0.38M-TFIIIB TAFs may have exchanged between the inactivated TBP and the exogenously added TBP. Thus, while the U6 and the Ad2 major late promoters, which both contain TATA boxes, can use TBP alone for basal transcription, TATA-less promoters seem to require specific TBP-containing complexes: the RNA polymerase I ribosomal promoter requires SLl (Comai et al., 1992) the TATA-less RNA poiymerase Ii mRNA promoters require TAFs in the D-TFIID complex as well as a tethering factor (Pugh and Tjian, 1990; 1991; Smale et al., 1990), and the TATA-less RNA polymerase iii promoters such as the VAI, 5S, and 7SL promoters require the 0.38M-TFIIIB complex. In recent experiments, we found that TATA-less RNA polymerase II snRNA genes such as the Ul gene also require TBP for transcription (C. Sadowski, S. M. L., and N. H., unpublished results). It now becomes very interesting to determine which form of TBP is used in this case, because the absence of a TATA box is a prerequisite for RNA polymerase II transcription of snRNA genes (Mattaj et al., 1988; Lobo and Hernandez, 1989), and these genes are transactivated by a different mechanism than TATAcontaining RNA polymerase II mRNA promoters (Ciliberto et al., 1987; Dahiberg and Schenborn, 1988; Tanaka et al., 1988, 1992). Thus, RNA polymerase II snRNA genes may use either a specialized Tap-containing complex or, like TATA-less RNA polymerase II mRNA promoters, a tethering factor(s) (Pugh and Tjian, 1991). The finding that 0.38M-TFIIIB is required for transcription of TATA-less RNA poiymerase III promoters suggests that the 0.38M-TFIIIB TAFs play an essential role in recruiting TBP to TATA-less promoters, either by binding to DNA themselves, or through protein-protein interactions with other factors bound to the promoter. Such protein-protein interactions may in turn stabilize a weak TBP-DNA interaction. Thus, unlike for TATA-containing promoters, in which the binding of D-TFIID is the first step in the assembly of the initiation complex (Buratowski et al., 1988,1989; Cavallini et al., 1988; Van Dyke et al., 1988, 1989) the binding of TBPcontaining complexes on TATA-less promoters may not be the first event. An interesting parallel

;O;;P-Containing

Complex

Is a Component

of TFIIIB

can be made with the transcription factor TFIIIC. TFIIIC binds directly to the B box of the VAI and tRNA genes and thereby initiates transcription complex assembly, but it requires prior binding of TFIIIA to the internal control region of the 5S genes to join, presumably through proteinprotein interactions with TFIIIA, the 5s transcription complex (see Geiduschek and Kassavetis, 1992, for a review). The ability of the same factor to enter different initiation complexes either by direct DNA binding or through protein-protein interactions may turn out to be a very common theme in transcription. Together with previous evidence, the data presented in this paper indicate that transcription complexes from one RNA polymerase class are not restricted to one form of TBP. RNA polymerase Ill promoters that contain a TATA box can use TBP (Lobo et al., 1991; Margottin et al., 1991; Simmen et al., 1991), whereas TATA-less RNA polymerase Ill promoters use 0.38M-TFIIIB. In addition, TBP, 0.38M-TFIIIB, and D-TFIID can all be used for basal transcription from both RNA polymerase II (Hoffmann et al., 1990b; Peterson et al., 1990; Pugh and Tjian, 1990; Timmers and Sharp, 1991; Figures 4D and 6A, this paper) and RNA polymerase Ill TATA-containing promoters. Thus, TBP or a TBP-containing complex alone does not necessarily determine RNA polymerase specificity, confirming that, as suggested previously by the structure of the U6 promoter, RNA polymerase specificity is not determined by a single transcription factor but rather by the particular combination and architecture of factors in a given transcription complex. Experimental

Procedures

Fractlonatlon HeLa cell extracts were prepared and fractionated on a PI 1 (Whatman) phosphocellulose column as described previously (Dignam et al., 1983; Lobo et al., 1991). The phosphocellulose B fraction (180 mg of protein) was dialyzed against buffer Q (20 m M HEPES [pH 7.91 at room temperature, 0.5 m M phenylmethylsulfonyl fluoride, 3 m M dithiothreitol, 10 m M MgCb, 0.5 m M EDTA, 5% glycerol) containing 100 m M KCI (C&J and loaded on a Mono Q HR lO/lO column (Pharmacia) equilibrated with the same buffer. The column was washed with 50 ml of Qm and eluted with a 200 ml linear gradient of 100 to 600 m M KCI in buffer Q. Five milliliter fractions were collected, dialyzed against Qlm containing 20% glycerol, and tested for reconstitution of VAI transcrip tion, the presence of TBP by immunoblotting, and reconstitution of RNA polymerase II transcription from the Ad2 major late promoter. For the first assay (Figure 48) VAI transcription was reconstituted by combining3plof thedifferentMonoQfractionswith3trlofphosphocellulose C (0.35-0.6 M KCI) fraction, under the transcription conditions described below. The TBP immunoblot (Figure 4C) was performed with MAb SL30 as described below, with 30 pl of each Mono Q fraction. RNA polymerase II transcription from the major late promoter (Figure 4D) was reconstituted by complementing a TFIIA fraction purified by successive chromatography on Pl 1, DE52, Pll, and DE52 columns as described in Sumimoto et al. (1990) and a Pll 0.3 to 0.5 M step elution fraction that provided TFIIB, TFIIE, TFIIF, and RNA polymerase II (Sumimoto et al., 1990) with 2.4 pi of each Mono Q fraction. D-TFIID was purified from a nuclear extract over a Pll phosphocellulose and a DE52 column (Whatman) (Figure 3) as described by Sumimoto et al. (1990) and dialyzed against buffer D (Dignam et al., 1983). Recombinant TBP was purchased from Promega. Constructs The VAI template, pBSM 13’VAL contains an Xbal-Hpall Ad2 fragment (extending from 10579 to 11002 in the Ad2 sequence) inserted into

pBSMlJ+ cleaved with Xbal and Sall. The 7SL template, pT3m7 H7SL30.1, was a kind gift from Dr. Elisabetta Ullu. The U6 promoter construct pUG/Hae/RA.P and the antisense RNA probe U6/RA.2/143 were described previously (Lob0 and Hernandez, 1989). The 5s clone, pHCSST, was a generous gift from Dr. Randall Little. This clone contains a Stul-Tthl 11 I fragment (-1237 to +I65 relative to the first transcribed nucleotide) from the human 5s repeat (Little and Braaten, 1989) cloned into the pUCll8 polylinker. The construct containing the Ad2 major late promoter pII9 MLP(C2A) was generated by excising the insert from pML(C2AT) (Sawadogo and Roeder, 1985) with EcoRl and Hindlll and inserting it into pUCll9 cleaved with EcoRl and Hindlll. Purlflcation of MAbs from Ascites The generation of the SL MAbs will be described elsewhere. The SL3, SL30, SL33, and SL35 MAbs were determined to be of the IgG, isotype with the ImmunoSelect kit from GIBCO BRL. according to the manufacturer’s instructions. The MAbs were purified from ascites by chromatography on protein A-Sepharose in high salt. Columns (1.5 ml) were equilibrated in binding buffer (1.5 M glycine, 3 M NaCI, adjusted to pH 8.9 with NaOH) and loaded with 3 ml ascites diluted with an equal volume of binding buffer and adjusted to 3 M NaCI. The column was washed with 17 column volumes of binding buffer and eluted with 100 m M sodium citrate (pH 4). Fractions (0.5 ml) were collected and immediately neutralized with Tris-HCI (pH 9). The concentrations of the different antibodies were equalized by visualization on Coomassiestained gels and with the Bradford assay. The purified antibodies were used for the blocking experiments shown in Figure 2 and for immunoblotting. lmmunodepletions Ascites (1 ml) were incubated with protein G-Sepharose beads (400 ~1 packed bead volume) for 1 hr with rocking at 4OC. The beads were allowed to settle under gravity, and the supernatant was removed. The beads were then washed in batches, twice with 10 packed bead volumes of RIPA buffer (Harlow and Lane, 1988) and five times with IO packed bead volumes of buffer D (Dignam et al., 1983). The beads were stored at 4OC in buffer D containing 0.01% Thimerosal (Sigma). Prior to use, they were washed twice with 10 vol of buffer D and resuspended in 2 packed bead volumes of buffer D. For depletion of HeLa nuclear extracts, 1 vol of extract was mixed with 1 vol of MAb-coated bead slurry (see above) and gently rotated at 4OC for 1 hr. The beads were then allowed to settle, and the supernatant was pipeted off carefully and used in transcription reactions. Thus, TBPdepleted and mock-depleted nuclear extracts were diluted 1:2 as compared with nondepleted extracts, and the volumes used in transcription reactions were therefore doubled, as indicated in the figure legends. To deplete the C-and B-TFIID fractions, 1 vol of fraction was mixed with 0.125-0.25 vol of packed MAb-coated beads. The mixture was incubated at 4W with gentle mixing for 30-45 min; the beads were then allowed to settle, and the supernatant was removed and used for transcriptions. Transcrlption Reactions For the U6 promoter, transcriptions were performed as described previously (Lob0 and Hernandez, 1989) except that 6 ~I(30 ug of protein) of immunodepleted or immunoinhibited (Figure 2) extract and 0.2 pg of supercoiled DNA template were used in a 10 pl transcription reaction. Transcripts derived from pU6/Hae/RA.2 were detected by RNAase T, protection with the probe U6/RA.2/143 as described previously (Lobo and Hernandez, 1989). For the VAI and 7SL promoters, the transcrip tion reactions contained 6 ~I(30 pg of protein) of immunodepleted or immunoinhibited (Figure 2) extract, 0.2 pg of supercoiled DNA template, 0.5 m M ATP, GTP, and UTP. 0.025 m M CTP, 5 PCi of [a-“P] CTP (800 Cilmole), 5 m M MgCb, 60 m M KCI, and 10% glycerol. For the 55 gene, the conditions were identical except that 0.075 pg of template was used. For the Ad2 major late promoter, the reactions contained 12.5 pl(62.5 pg of protein) of immunodepleted or immunoinhibited (Figure 2) extract, 0.5 pg of supercoiled DNA template, 0.5 m M each of ATP and CTP, 10 pCi of [a-“P] UTP (600 Cilmole). 0.6 m M 3’ Q-Methyl GTP, 10 m M MgCI,, 60 m M KCI, 10% glycerol, and 500 ng of RNAase T,. In Figure 4D, the transcription reactions contained 1.2 pl of the TFIIA fraction, 2.4 pl of a PI 1 0.3-0.5 M step elution fraction that provided TFIIB, TFIIE, TFIIF. and RNA polymerase II (Sumimoto

Cell 1038

et al., 1990) and either 2.4 ul of fractions from the Mono Q column (Figure 3) or 2.4 ul of the D-TFIID fraction. The reactions also contained 0.1 ug of supercoiled DNA template [pll9 MLP(C2A)], 0.5 m M ATP, and UTP, 25 uM CTP, 10 pCi of [a-=P] CTP (800 Cilmole), 0.1 m M 3’ O-Methyl GTP, 10 m M MgCb, 60mM KCI, 10% glycerol, and 500 ng of RNAase T1. lmmunoblotting SDS gel electrophoresis and semidry transfer of proteins to nitrocellulose were carried out as described by Harlow and Lane (1988). The filters were blocked with 5% Carnation nonfat dry milk in phosphate buffered saline (PBS) for 3-12 hr at 4OC as described (Harlow and Lane, 1988) and then incubated with SL30 (1:2000 to 1:5000 dilution of purified MAb) in PBS containing 3% bovine serum albumin (PBSBSA) (Sigma) for 1 hr. The filters were washed twice for 5 min with 10 ml of PBS containing 0.05% Tween-20 (Tween-PBS), and incubated with biotinylated goat anti-mouse antibodies (1:200 dilution of affinitypurified antibody, Cappel) in 10 ml of PBS-BSA. The filters were washed with Tween-PBS and incubated with a 1:200 dilution of strep tavidin-biotinylated horseradish-peroxidase complex (Amersham) in PBS-BSA. The immunoreactive bands were visualized with 10 ml of developer (9 ml of 50 m M Tris-HCI [pH 7.51 and 1 ml of 0.3% cobalt(Il)chloride containing 6 mg of diaminobenzidine) to which 33 ul of hydrogen peroxide were added just before use, and the reaction was stopped by rinsing the blot with PBS. In Figure 6C, however, an Enhanced ChemiLuminescence kit (Amersham) was used to visualize the bands as described by the manufacturer. Mapping of TBP Sequences Required for Recognition by the Anti-TBP MAbs A construct containing the human TBP coding sequence was generated by PCR amplification of cDNA made by random priming of total HeLa cell RNA. The oligonucleotides used (IIDN and IIDC, see sequences below) were based on the TBP cDNA sequence published by Peterson et al. (1990). IIDN contains an Xbal site followed by TBP sequences (upper strand) from positions 242 to 261 in the numbering of Peterson et al. (1990). IIDC contains a BamHl site followed by TBP sequences (lower strand) from positions 1261 to 1238. The fragment resulting from PCR amplification was cloned into pUC119. The XbalBamHl fragment containing the TBP coding sequence was then excised and recloned into pCG (Tanaka and Herr, 1990) cleaved with Xbal and BamHl to generate the construct pCGIID. pCGllD was used in PCR reactions to generate a series of templates for in vitro transcription/translation reactions. The upstream oligonucleotide T7-5’ (Tanaka and Herr, 1990; see sequence below) contained the T7 promoter (position 1 to 19) followed by sequences corresponding to the 5’ untranslated HSV thymidine kinase leader region just upstream of the AUG codon in the pCG vector (Tanaka and Herr, 1990). The other upstream oligonucleotides (2980, 244C, 198C, see sequences below) used in these PCR reactions contained the SP6 promoter (position 3 to 20) for transcription followed by 6-globin untranslated sequences and initiation codon (position 21 to 34) (Aurora and Herr, 1992) for translation, a serine codon (position 35 to 37) and TBP sequences (position 36 to 52). The TBP sequences (upper strand) were, in the numbering of Peterson et al. (1990): 298C, positions 401 to 416; 244C, positions 527 to 541; 198C, positions 719 to 733. The downstream oligonucleotide was IIDC. The PCR products were used as templates for RNA synthesis with T7 or SP6 RNA polymerase. The resulting RNAs were then translated in a rabbit reticulocyte lysate (Promega) in a 50 ul reaction containing 4 pl of L-[?8]methionine at 1233 Cilmmole (New England Nuclear) to generate labeled full-length and truncated versions of human TBP containing 298, 244, and 198 C-terminal amino acids. A mixture of full-length, 298C, and 244C polypeptides, or 196C alone were used in immunoprecipitation reactions. Each immunoprecipitation reaction contained 2 ul of ascites fluid and 5 ul of a translation reaction in 1 ml of RIPA buffer (Harlow and Lane, 1988) and was rotated for 1 hr at 4OC. Twenty microliters of a 1:l suspension of protein G-Sepharose beads (Pharmacia) in RIPA buffer was added, and the reactions were rotated for a further 30 min. The beads were pelleted by low-speed centrifugation, and the supernatants were discarded. The pellets were washed five times with 1 ml of RIPA buffer, resuspended in Laemmli sample buffer (see Harlow and Lane, 1988) boiled, and loaded on a 17% SDS gel.

IIDC: GAGGATCCTTACGTAGTCI-TCCTGAATCCCT-T IIDN: TGTCTAGAATGGATCAGAACAACAGCCT l7-5’: TTAATACGACTCACTATAGGGCGTGAAACTCCCGCA 298C: CTAllTAGGTGACACTATAGAAACAGACACCATGAGCGAGCAACAAAGGCAG 244C: CTAll-TAGGTGACACTATAGACAGACACCATGAGCGCAGTGGCAGCTGCA 198C: CTATTTAGGTGACACTATAG AAAAAACAGACACCATGAGCCCCATGACTCCCATG lmmunopreclpitations Two to three milliliters of the 0.38M-TFIIIB fraction containing 100-l 50 ng of TBP (as determined by Western blot analysis) was precleared by incubation with 10 ~1 of packed 12CA5 antibody beads for 1 hr with gentle rocking at 4OC. The beads were pelleted by centrifugation and the supernatant was incubated with 2 ul of 12CA5, SL30, or SL33 ascites fluid or with 3 ul of affinity-purified anti-TBP polyclonal antibody (obtained from N. Tanese and R. Tjian) at 4OC for 1 hr. Preswollen protein G- (for the monoclonal antibodies) or protein A- (for the poly clonal antibodies) Sepharose beads (Boehringer) were then added (30 ul packed volume) and the incubation continued for 30 min at 4OC with gentle rocking. The beads were pelleted by low-speed centrifugation and washed 4 times with Dignam buffer D containing 5 m M MgC& and 0.1% NP-40. Laemmli buffer (25 ul) was added, and the samples were boiled for 3 min and loaded on a 7.5% SDS-polyacrylamide gel. Acknowledgments We thank R. Little for different subclones of the human 55 rRNA gene; C. Sadowski for HeLa cell extracts; C. Bautista and M. Falkowski for their expert and indispensable help in raising the MAbs; N. Tanese and R. Tjian for affinity-purified anti-TBP polyclonal antibodies and helpful discussion; S. Bell, S. Brill, and M. Ruppert for help and discussion throughout the course of this work; and S. Bell, S. Brill, and W. Herr for helpful comments on the manuscript. We also thank R. Whitaker and J. Wiggins for help with tissue culture and J. Duffy and P. Renna for artwork and photography. This work was funded by National Institutes of Health grant ROI GM3881 0. M. T. was funded by National Institutes of Health grant CA13106. N. H. is a Rita Allen Foundation Scholar. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “‘advetiisement” in accordance with 18 USC Section 1734 solely to indicate this fact. Received July 6, 1992; revised September

22, 1992

References Aurora, R., and Herr, W. (1992). Segments of the POU domain influence one another’s DNA binding specificity. Mol. Cell. Biol. 72, 455467. Bartholomew, B., Kassavetis, G. A., and Geiduschek, E. P. (1991). Twocomponentsof Saccharomycescerevisiae transcription factor IIIB (TFIIIB) are stereospecifically located upstream of a tRNA gene and interact with the second-largest subunit of TFIIIC. Mol. Cell. Biol. 11, 5181-5189. Braun, B. R., Riggs, D. L., Kassavetis, G. A., and Geiduschek, E.P. (1989). Multiple states of protein-DNA interaction in the assembly of transcription complexes on Saccharomyces cerevisiae 5S ribosomal RNA genes. Proc. Natl. Acad. Sci. USA 86, 2530-2534. Buratowski, S., Hahn, S., Sharp, P. A., and Guarente, L. (1988). Function of a yeast TATA element-binding protein in a mammalian transcription system. Nature 334, 37-42. Buratowski, S., Hahn, S., Guarente, L., and Sharp, P. A. (1989). Five intermediate complexes in transcription initiation by RNA polymerase II. Cell 56, 549-561. Cavallini, B., Huet, J., Plassat, J., Sentenac, A., Egly, J., and Chambon, P. (1988). A yeast activity can substitute for the HeLa cell TATA box factor. Nature 334, 77-80. Ciliberto, G., Palla, F.. Tebb. G.. Mattaj, I. W., and Philipson, L. (1987). Properties of a Ul RNA enhancer-like sequence. Nucl. Acids Res. 75, 2403-2416.

fO;;P-Containing

Complex

Is a Component

of TFIIIB

Comai, L., Tanese, N., and Tjian, R. (1992). The TATA-binding protein and associated factors are integral components of the RNA polymerase I transcription factor, SLl Cell 88, 985-976. Conaway, J. W.. Reines, D., and Conaway, R. C. (1990). Transcription initiated by RNA polymerase II and transcription factors from liver: cooperative interaction of transcription factor T and E in initial complex formation. J. Biol. Chem. 285, 7552-7558.

TATA factor (TFIID). Nature 348, 387-390. Horikoshi, M.. Yamamoto, T., Ohkuma, Y., Weil, P. A., and Roeder, R. G. (1990). Analysis of structure-function relationships of yeast TATA box binding factor TFIID. Cell 87, 1171-1178. Kao, C. C., Lieberman, P. M., Schmidt, M. C., Zhou, Q., Pei, R., and Berk, A. J. (1990). Cloning of a transcriptionally active human TATA binding factor. Science 248, 1646-1850.

Conaway, J. W., Hanley. J. P.,Garret, K. P.,andConaway, R.C. (1991). Transcription initiated by RNA polymerase II and transcription factors in liver: structure and function of E and T. J. Biol. Chem. 288, 78047811.

Kassavetis, G. A., Riggs, D. L., Negri. R., Nguyen, L. H., and Geiduschek, E. P. (1989). Transcription factor IIIB generates extended DNA interactions in RNA polymerase Ill transcription complexes on tRNA genes. Mol. Cell. Biol. 9, 2551-2588.

Cormack, 8. P., and Struhl, K. (1992). The TATA-binding protein is required for transcription by all three nuclear RNA polymerases in yeast cells. Cell 89, 685-696.

Kassavetis, G. A., Braun, B. R., Nguyen, L. H., and Geiduschek, E.P. (1990). S. cerevisiae TFIIIB is the transcription initiation factor proper of RNA polymerase Ill, while TFIIIA and TFIIIC are assembly factors. Cell 60.235-248.

Dahlberg. J. E., and Lund, E. (1988). The genes and transcription of the major small nuclear RNAs. In Structure and Function of Major and Minor Small Nuclear Ribonucleoprotein Particles, M. L. Birnstiel, ed. (Berlin and Heidelberg: Springer Verlag), pp. 38-70. Dahlberg, J. E., and Schenborn, E. T. (1988). The human tJ1 snRNA promoter and enhancer do not direct synthesis of messenger RNA. Nucl. Acids Res. 18, 5827-5840.

Kassavetis, G. A., Bartholomew, B., Blanco, J. A., Johnson, T. E., and Geiduschek, E. P. (1991). Two essential components of the Saccharomyces cerevisiae transcription factor TFIIIB: Transcription and DNAbinding properties. Proc. Natl. Acad. Sci. USA 88, 7308-7312. Lai, J.-S., and Herr, W. (1992). Ethidium bromide provides a simple tool for identifying genuine DNA-independent protein associations. Proc. Natl. Acad. Sci. USA 89,8958-6962.

Dean, N., and Berk, A. J. (1987). Separation of TFIIIC into two functionalcomponents bysequencespecificDNAaffinitychromatography. Nucl. Acids Res. 15, 9895-9907.

Little, R. D., and Braaten, D. C. (1989). Genomicorganization of human 55 rDNA and sequence of one tandem repeat. Genomics 4,376-383.

Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983). Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucl. Acids Res. 17, 1475-1489.

Lobo, S. M., and Hernandez, N. (1989). A 7 bp mutation converts a human RNA polymerase II snRNA promoter into an RNA polymerase Ill promoter. Cell 58, 55-87.

Dynlacht, B. D., Hoey, T., and Tjian, R. (1991). Isolation of coactivators associated with the TATA-binding protein that mediate transcriptional activation. Cell 88, 563-578.

Lobo, S. M., Lister, J., Sullivan, M. L., and Hernandez, N. (1991). The cloned RNA polymerase II transcription factor IID selects RNA polymerase Ill to transcribe the human U8 gene in vitro. Genes Dev. 5, 1477-1489.

Engelke, D. R., Ng, S.-Y., Shastry, B. S., and Roeder, R. G. (1980). Specific interaction of a purified transcription factor with an internal control region of 55 RNA genes. Cell 19, 717-728. Fikes, J. D., Becker, D. M., Winston, F., and Guarente, L. (1990). Striking conservation of TFIID in Schizosaccharomyces pombe and Saccharomyces cerevisiae. Nature 348, 291-294. Gabrielsen, 0. S., Marzouki, N., Ruet, A., Sentenac, A., and Fromageot, P. (1989). Two polypeptide chains in yeast transcription factor T interact with DNA. J. Biol. Chem. 284. 7505-7511. Gasch, A., Hoffmann, A., Horikoshi, ht., Roeder, R. G., and Chua, N.-H. (1990).Arabidopsisfha/ianacontainstwogenesfor TFIID. Nature 348, 390-394. Geiduschek, E. P, and Kassavetis, G. A. (1992). RNA polymerase Ill transcription complexes. In Transcriptional Regulation, Cold Spring Harbor Monograph Series (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory), in press. Ginsberg, A. M., King, B. O., and Roeder, R. 0. (1984). Xenopus 5S gene transcription factor, TFIIIA: characterization of a cDNA clone and measurement of RNA levels throughout development. Cell 39, 479489. Greenblatt, J. (1991). Rolesof TFIID in transcriptional polymerase II. Cell 88, 1087-l 070.

initiation by RNA

Margottin, F., Dujardin, G., Gerard, M., Egly, J.-M., Huet, J., and Sentenac, A. (1991). Participation of the TATA factor in transcription of the yeast U8 gene by RNA polymerase C. Science 251, 424-426. Matsui, T., Segall, J., Weil, P. A., and Roeder, R. G. (1980). Multiple factors required for accurate initiation of transcription by purified RNA polymerase II. J. Biol. Chem. 255, 11992-11998. Mattaj, I. W., Dathan, N. A., Parry, H. D., Carbon, P.. and Krol, A. (1988). Changing the RNA polymerase specificity of U snRNA gene promoters. Cell 55, 435-442. Nakajima, N., Horikoshi, M., and Roeder, R. G. (1988). Factors involved in specific transcription by mammalian RNA polymerase II: purification, genetic specificity, and TATA box-promoter interactions of TFIID. Mol. Cell. Biol. 8, 4028-4040. Niman, H. L., Houghten, R. A., Walker, L. E., Reisfeld, R. I. A., Hogle, J. M., and Lerner. R. A. (1983). Generation reactive antibodies by short peptides is an event of high implications for the structural basis of immune recognition. Acad. Sci. USA 80,4949-4953.

A., Wilson, of proteinfrequency: Proc. Natl.

Peterson, M. G., Tanese, N., Pugh, B. F.. and Tjian, R. (1990). Functional domains and upstream activation properties of cloned human TATA binding protein. Science 248, 16251830.

Harlow, E., and Lane, D. (1988). Antibodies: A Laboratory Manual (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory).

Pugh, B. F., and Tjian, R. (1990). Mechanism of transcriptional tion by Spl: evidence for coactivators. Cell 81. 1187-l 197.

Hernandez. N. (1992). Transcription of vertebrate snRNA genes and related genes. In Transcriptional Regulation, Cold Spring Harbor Monograph Series (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory), in press.

Pugh, B. F., and Tjian, R. (1991). Transcription moter requires a multisubunit TFIID complex. 1945.

Hoey, T., Dynlacht, B. D., Peterson, M. G., Pugh, B. F., and Tjian, R. (1990). Isolation and characterization of the Drosophila gene encoding the TATA box binding protein, TFIID. Cell 87, 1179-1188. Hoffmann, A., Horikoshi, ht., Wang, C. K., Schroeder, S., Weil, P. A., and Roeder, R. G. (199Oa). Cloning of the Schizosaccharomyces pombe TFIID gene reveals a strong conservation of functional domains present in Saccharomyces cwevisiae TFIID. Genes Dev. 4, 11411148. Hoffmann, A., Sinn, E., Yamamoto, T., Wang, J., Roy, A., Horikoshi, M., and Roeder, R. G. (1990b). Highly conserved core domain and unique N terminus with presumptive regulatory motifs in a human

activa-

from aTATA-less proGenes Dev. 5, 1935-

Samuels, M., Fire, A., and Sharp, P. A. (1982). Separation and characterization of factors mediating accurate transcription by RNA polymerase II. J. Biol. Chem. 257, 14419-14427. Sawadogo. M., and Roeder, R. G. (1985). Factors involved in specific transcription by human RNA polymerase II: analysis by a rapid and quantitative in vitro assay. Proc. Natl. Acad. Sci. USA 82,4394-4398. Sawadogo, M., and Sentenac, A. (1990). RNA polymerase B (II) and general transcription factors. Annu. Rev. Biochem. 59, 71 l-754. Schultz, M. C., Reeder, R. H., and Hahn, S. (1992). Variants of the TATA-binding protein can distinguish subsets of RNA polymerase I, II, and Ill promoters. Cell 89, 897-702. Segall, J., Matsui, T., and Roeder, R. G. (1960). Multiple factors are

Cell 1940

required for the accurate transcription of purified genes by RNA polymerase Ill. J. Biol. Chem. 255, 11986-l 1991. Shastry. B. S., Ng, S. Y., and Roeder, R. G. (1982). Multiple factors involved in the transcriptionof class Ill genes inXenopus/aevis. J. Biol. Chem. 257, 12979-12986. Simmen, K. A., Bernues, J., Parry, f-f. D., Stunnenberg, H. G., Berkenstam, A., Cavallini, B., Egly, J.-M., and Mattaj, I. W. (1991). TFIID is required for in vitro transcription of the human U6 gene by RNA polymerase Ill. EMBO J. 70, 1853-1662. Smale, S. T., Schmidt, M. C.. Berk. A. J., and Baltimore, D. (1990). Transcriptional activation by Spl as directed through TATA or initiator: specific requirementfor mammalian transcription factor IID. Proc. Natl. Acad. Sci. USA 87,4509-4513. Sumimoto, H.,Ohkuma, Y., Yamamoto,T., Horikoshi, ht., and Roeder, R. (1990). Factors involved in specific transcription by mammalian RNA polymerase II: identification of general transcription factor TFIIG. Proc. Natl. Acad. Sci. USA 87, 9158-9162. Tanaka, M., and Herr, W. (1990). Differential transcriptional activation by Ott-1 and Ott-2: interdependent activation domains induce Ott-2 phosphorylation. Cell 60, 375-386. Tanaka, M., Grossniklaus, U., Herr, W., and Hernandez, N. (1988). Activation of the U2 snRNA promoter by the octamer motif defines a new class of RNA polymerase II enhancer elements. Genes Dev. 2, 1764-l 776. Tanaka, M., Lai, J.-S., and Herr, W. (1992). Promoter-selective activation domains in Ott-I and Ott-2 direct differential activation of an snRNA and mRNA promoter. Cell 68, 755-767. Tanese, N., Pugh, B. F., and Tjian, R. (1991). Coactivatorsforaprolinerich activator purified from the multisubunit human TFIID complex. Genes Dev. 5, 2212-2224. Timmers, H. Th. M., and Sharp, P. A. (1991). The mammalian TFIID protein is present in two functionally distinct complexes. Genes Dev. 5, 1946-l 956. Van Dyke, M. W., Roeder, R. G., and Sawadogo, M. (1968). Physical analysis of transcription preinitiation complex assembly on a class II promoter. Science 247, 1335-1338. Van Dyke, M. W., Sawadogo, M., and Roeder, R. G. (1989). Stability of transcription complexes on class II genes. Mol. Cell. Biol. 9, 342344. Waldschmidt, R., Jahn, D., and Seifart, K. H. (1988). Purification of transcription factor IIIB from HeLa cells. J. Biol. Chem. 263, 1335013356. Weil, P. A., Segall, J., Harris, B., Ng, S-Y., and Roeder, R. G. (1979). Faithful transcription of eukaryotic genes by RNA polymerase Ill in systems reconstituted with purified DNA templates. J. Biol. Chem. 254, 6163-6173. White, R. J.. Jackson, S. P., and Rigby. P. W. J. (1992). A role for the TATA-box-binding protein component of the transcription factor IID complex as a general RNA polymerase Ill transcription factor. Proc. Natl. Acad. Sci. USA 89, 1949-1953. Yoshinaga, S. K., Boulanger, P. A., and Berk, A. J. (1987). Resolution of human transcription factor TFIIIC into two functional components. Proc. Natl. Acad. Sci. USA 84, 3584-3589. Yoshinaga, S. K., L’Etoile. N. D., and Berk, A. J. (1989). Purification and characterization of transcription factor lllC2. J. Biol. Chem. 264, 10726-l 0731.