Journal of Virological Methods, 27 (1990) 49-60 Elsevier
49
VIRMET 00968
An automatic modified polymerase chain reaction procedure for hepatitis B virus DNA detection D. Larzu11p2,D. Chevrieti,
V. Thiers3 and J.-L. Guesdon2
‘Dkpartementde Biologie Mo&culaire, InstitutHenri Beaufour, Les Ulis, France, =Laboratoiredes Sondes Froides and %aitk de Recombinaison et d’Expression G&&ique, InstitutPasteur, Paris, France (Accepted 11 September 1989)
In order to perform an efficient and reproducible diagnostic test for hepatitis B virus (HBV) infection using the polymerase chain reaction (PCR), sixteen primer couples specific for the HBV genome were selected. Primers 15-31 nucleotides in length containing between 31-73% GC permitted amplification of fragments corresponding to the whole HBV genome. The specificity and efficiency of PCR amplification were studied in detail using DNA extracted from either a viral particle preparation or from the liver of a patient with chronic active hepatitis. Three primer couples in the X, C and PreS regions, i.e. MD24MD26, MD27MD31 and MD19MD18, respectively, gave satisfactory results and performed efficiently under highly stringent hybridization conditions. A modified PCR procedure was then developed using only two thermal steps with a temperature shift of 16°C. This simple method was as efficient as conventional PCR and permitted detection of a single HBV DNA molecule with the X region specific primer couple. The automatization of this PCR-based procedure permitted 40 amplification cycles in 105 min. HBV; PCR; Diagnosis; Automatization
Introduction Molecular hybridization has been considered as one of the most direct and reliable diagnostic tests for hepatitis B virus (HBV) infection (Beminger et al., 1982; Correspondence to: D. Larzul, Department of Molecular Biology, Institut Henry Beaufour, 1 Avenue des Tropiques, 91952 Les Ulis Cedex, France. 0166-0934/90/$03.50 @ 1990 Elsevier Science Publishers B.V. (Biomedical Division)
50
B&hot et al., 1982). The presence of HBV DNA sequences in serum and the HBeAg/anti-HBeAg status are considered to be markers of viral replication (Scotto et al., 1982; Lok et al., 1984). During a typical hepatitis B virus infection, HBeAg appears early in serum and is generally associated with HBV DNA positivity. Progressively, HBeAg and HBV DNA disappear and serum antibody against HBeAg emerge. However, some patients with chronic hepatitis are either positive for HBeAg and negative for HBV DNA by dot-blot hybridization, or positive for antibody against HBeAg and for HBV DNA by dot-blot hybridization. Using 32Plabelled DNA probes, up to 10’ viral particles/ml of serum can be detected (Scotto et al., 1982; Weller et al., 1982), but it is known that a serum containing lo* particles/ml is infectious in the chimpanzee (Prince et al., 1983). The lack of sensitivity of conventional tests poses serious problems for the diagnosis of infectivity and for the surveillance of HBV carriers. We used therefore the polymerase chain reaction (PCR) (Saiki et al., 1985; Mullis et al., 1986) in a previous report (Larzul et al., 1988) in order to address this problem. PCR made it possible to detect a single viral DNA molecule with either a 32P (Larzul et al., 1988) or acetylaminofluorene (AAF) (Larzul et al., 1989) labelled probe after 32 and 40 amplification cycles, respectively. More recently, our results were confirmed when PCR was used to detect HBV DNA in serum of patients with chronic hepatitis (Kaneko et al., 1989). In this report, 16 primer couples permitting amplification of a set of fragments corresponding to the whole HBV genome were studied. Primer hybridization conditions were studied in order to select the most efficient primer couples with the aim of performing hybridization and extension with Taq polymerase during the same thermal step. In addition, some basic parameters were modified to perform a highly specific and rapid test based on PCR. We then developed an automatic PCR apparatus more adapted to HBV DNA sequence detection in clinical practice.
Materials and Methods Preparation of DNA
Viral particles were purified from the serum of a chronic HBsAg carrier by using a discontinuous sucrose gradient (Budkowska et al., 1986). In a 12 ml polypropylene centrifuge tube, 5 ml of serum were loaded onto a 6 ml discontinuous sucrose gradient containing an equal volume of 10, 20 and 30% sucrose in 10 mM Tris-HCl, pH 7.8, containing 50 mM NaCl. After a 4 h centrifugation at 220000 x g, the pellet was resuspended and incubated for 1 h at 70°C with proteinase K (Boehringer, Mannheim, F.R.G.) at 2.5 mg/ml in 25 mM sodium acetate, pH 6.5, containing 2.5 mM EDTA and 0.5% SDS. After one phenol and one diethylether extraction, the sample was incubated for 30 min at 68°C to eliminate the diethylether. The viral particle concentration could be determined by dot-blot (Scotto et al., 1982) using a known preparation of recombinant Lambda HBV bacteriophage particles (Kuhns et al., 1984).
51
DNA extraction from liver was performed as follows: the liver tissue was crushed in liquid nitrogen and the cellular DNA was purified by phenol chloroform extraction and ethanol precipitation. Primer synthesis
Primer sequences are indicated in Fig. 1. Oligonucleotide primers were synthesized on an Applied Biosystems 381A synthesizer using phosphoramidite chemistry* Amplification technique with Taq Polymerase
A serum DNA sample containing lo6 viral particles, or 350 ng of hepatic DNA, was added to 40 ~1 of a buffer containing 60 mM Tris, pH 7.5, 17 mM ammonium sulphate, 5 mM MgCl,, 6.7 FM EDTA, 10 mM B-mercaptoethanol, 170 mg/ml bovine serum albumin, 200 PM of each dNTP and 400 nM of each primer. One unit of Taq polymerase (Perkin-Elmer Cetus, U.S.A.) per sample was used for 40 cycles in the presence of 100 ~1 of mineral oil (Sigma, U.S.A.) added to avoid evaporation. We used an automatic amplification apparatus (DNA thermal cycler PerIP 03
GCTGAAAGCCAAACA
MD 03
CTCAAGCTTCATCATCCATATA
MD06
CTTGGATCCTATGGGAGTGG
MD11
GCGAAGCTTAAGAAGATGAGGCATAG
MD 12
GCGCTGCAGGGACTGGGGACCCTG
MD 13
GCGAAGCTTTTAGGGTTTAAATGTATACCC
MD 14
GCGCTGCAGCTATGCCTCATCTTC
MD 16
GCGAAGCTTGTCCTAGGAATCCTGATG
MD 18
GCGAAGCTTCCCTGAGCCTGAGGGCTCCACC
MD 19
GCGCTGCAGGGGTCACCATATTCTTGG
MD24
TGCCAACTGGATCCTTCGCGGGACGTCCTT
MD 25
GCGAAGCTTAAGGAAAGAAGTCAGAAGG
MD 26
GCGAAGCTTGTTCACGGTGGTCTCCATG
Mp 27
GCGGGATCCACTGTTCAAGCCTCCAAGCT
MD30
GCGCTGCAGGAGTGTGGATTCGCACTC
MD31
GCGAAGCTTAGGAGTGCGAATCCACACTC
Fig. 1. HBV primer sequences. Sixteen oligonucleotide sequences were selected in conserved regions of the HBV genome deduced from the alignment of five different sequences from subtypes adw, adr and ayw. Sequences MD12, MD14, MD06, MD24, MD27, MD30 and MD19 are complementary to the (-) strand. Sequences MD16, MDll, IP03, MD03, MD13, MD26, MD25, MD31 and MD18 are complementary to the (+) strand. IFQ3 is fully HBV specific and does not carry a restriction site. MD24 contains a BumHI site which is HBV specific as is the rest of its sequence. All the ,other sequences contain an additional restriction site at the 5’ end: Hind111 for MD03, MDll, MD13, MD16, MD18, MD25, MD26 and MD31; BarnHI for MD06 and MD27; and PstI for MD12 MD14, MD19 and MD30. These same fourteen sequences have an additional GCG sequence in 5’, except MD03 and MD06 which contain CI’C and CIT respectively.
52
kin-Elmer Cetus) to perform the amplification. This apparatus was used for conventional PCR i.e. with three thermal steps (denaturation, annealing, and extension). For the two thermal step PCR procedure, we used an apparatus developed by Institut Pasteur (see results). Gel electrophoresis
and Southern blot analysis
20 ml of the PCR product were electrophoresed in 2% agarose gel (Sigma) and stained with ethidium bromide to visualize DNA. The gel was then incubated twice for 15 min in 0.5 M NaOH, 1.5 M NaCl, and twice for 30 min in 0.5 M Tris-HCl, pH 7.5, 3 M NaCl. Nucleic acids were transferred for 16 h to a nylon membrane (Hybond-N, Amersham, Little Chalfont, U.K.), then the filter was rapidly washed in 2 x SSC (1 x SSC = 0.15 M NaCl, 0.015 M sodium citrate) and treated for UV irradiation. Hybridization
with a radioactive probe
A recombinant I-IBV plasmid, pCPl0 (Dubois et al., 1980), containing two HBV genomes, was treated by random priming (Multiprime DNA Labelling System, Amersham) by using a 32P-dTTP (specific activity: 1.6 x lo9 cpm/pg). The filter was prehybridized for 3 h at 68°C in 6 x SSC, 5 x Denhardt’s solution (5 x solution = 0.1% Ficoll, 0.1% bovine serum albumin, and 0.1% polyvinylpyrrolidone), 0.5% SDS, 100 mg/ml denatured salmon sperm DNA, and hybridization was performed for 16 h at 68°C in the same buffer without SDS and with the 32Plabelled pCPl0 probe at 0.5 X lo6 cpm/ml. The filter was washed three times in 2 x SSC, 0.1% SDS for 10 min at room temperature, and twice for 30 min at 58°C in 0.1 x SSC, 0.1% SDS. Autoradiography was performed at -80°C for 1 h with Kodak XAR-5 film and an intensifying screen.
Results
Oligonucleotide
sequence
determination
In order to develop a rapid and highly specific PCR-based procedure, 16 different HBV specific primers (Fig. 1) were selected in the conserved regions of the viral genome as shown by the alignment of five different sequences from subtypes adw, adr and ayw. MD03 and MD06 are two primers of 22 and 20 nucleotides respectively with only 13 HBV specific nucleotides. These primers were previously selected for another study (Larzul et al., 1988) in which the Klenow fragment was used. The fourteen other primers were selected for use with Taq polymerase. The length of their HBV specific sequences ranged from 15 (IP03) to 31 (MD 18) nucleotides. An additional restriction site was added at the 5’ extremity (&I, BamHI, and HindIII)
53
except for IP03 which has no restriction site and MD 24 which contains an HBV specific BamHl site. A short three nucleotide sequence was added 5’ of the restriction site to protect it from possible degradation. In order to avoid formation of secondary structures, no compkmentary sequences longer than 4 nucleotides were present in the primer sequences. Particular attention was paid to the sequence in 3’, related to conserved regions in the HBV genome. GC content of the HBV specific sequences of the various primers ranged from 31% (MD03) to 73% (MD 12, MD 18). HBV diagnostic test Sixteen different primer associations were used to perform amplification of HBV specific DNA fragments of 128 to 1226 nuckotides in length (Fig. 2). Under these conditions, the entire HEW genome was amplified. Specifkity and efficiency of the three thermal amplification steps were studied for these sixteen primer couples by MD 111
MD 12
MD26
MD 24
Fig. 2. Positions of primers on the HBV genome and characterization of the amplified DNA fragments. Arrows indicate positions of primer sequences on the HBV genome. A clockwise arrow designates a primer sequence complementary to the (-) strand, while a counterclockwise arrow indicates a sequence complementary to the (+) strand. Thick lines indicate the amplifiable DNA fragments A, B, C, D, E, F, G, H, I, J, K, L, M, N, 0 and P. C is flanked by primers MD14/IPO3. F is flanked by primers MDO6MDO3.
54
‘AGCGJKNELOPBNIM
1057 -
. *ADCBJKNELGPBNIH
1057
392 291 162
Fig. 3. PCR product obtained with DNA extracted from a viral particle preparation. Amplification was performed for 40 cycles with a monoblock automatic apparatus (DNA thermal cycler, Perkin-Elmer Cetus) and the PCR product was electrophoresed on an agarose gel subsequently stained with ethidium bromide. A three thermal step procedure was programmed and three hybridization step temperatures were used. For fragments A, D, C, G, J, K and N, an ampli~cation cycie was 1 min at 95”C, 1 min at 50°C (1) or 65°C (Z), and 1 min at 72°C. An amplification cycle was then performed in 5 min 30 s. For fragments E, L, 0, P, B, H, I and M, an amplification cycle was 1 min at 95”C, 1 min 30 s at 50°C (1) or 6% (2), and 2 min 30 s at 72°C. An amplification cycle was then performed in 7 min 30 s. White arrows indicate positions of the expected bands.
using an annealing temperature (Ta) of 50, 60 or 65°C. This procedure was applied either to a viral particle preparation from an I-E& Ag+ chronic carrier carrier serum (Fig. 3) or to total liver DNA obtained from a chronic active hepatitis B patient (data not shown). In order to obtain amplification results independent of primer length, different PCR conditions were used. A one minute extension time was used for the sixteen primer couples. When the specific amplified fragment was longer than 500 base pairs, a second amplification ex-
55
periment was performed with an extension time of 2 min 30 s. Two classes of PCR products were obtained when a viral particle preparation was used. In the first class, DNA fragments A, D, G, J, K and N were specifically amplified with a one min extension time regardless of the annealing temperature which varied from 50 to 65°C. For these fragments, an optimal efficiency was obtained (Table 1) and the amount of amplified DNA estimated on ethidium bromide stained agarose gels (data not shown) ranged from 1.5 to 3 pg for a 50 ~1 sample. Fragment C was specifically amplified but the PCR efficiency decreased dramatically when the Ta increased from 50 to 65°C. For the second class of amplified fragments, i.e. fragments E, L, 0, P, B, H, I and M, a one min extension time resulted in an undetectable specific product (data not shown). After a longer extension time (2 min 30 s), PCR efficiency was significantly increased, but some contaminating faint bands appeared on the agarose gel regardless of Ta. These bands were HBV specific as shown with Southern blot analysis using a total HBV DNA probe (data not shown). When applied to total liver DNA, the electrophoretie patterns of the PCR product were significantly different with an annealing temperature of 50 or 65°C. Indeed, for all primer couples, additional amplified DNA fragments were obtained with Ta = .5O”C,excepted for MDl4~13 (fragment D). These additional bands did not hybridize with au HBV specific DNA probe (data not shown). Products H and I (Fig. 3) show a double-band amplification pattern which could be related to the unusual structure of HBV DNA. Indeed, in serum, DNA is partially single stranded and the complete strand is nicked to a position overlap by products H and I. The same experiment performed with Ta = 65°C resulted in a highly specific amplification of fragments A, D, G, K, N, E and L. Indeed, for these fragments, all the additional bands observed with Ta = 50°C (except for D) were not amplified under high annealing temperature conditions (Ta = 65°C). The efficiency of the PCR was semi-quantitatively evaluated (Table 1) from the ethidium bromide stained agarose gel for Ta = 50, 60 or 65°C. Increasing the Ta from 50 to 65°C had a significant effect on the PCR product pattern obtained in serum for fragments B, C, I and L. Concerning fragments B and C, a decrease of the PCR efficiency was obtained with a more pronounced effect for C. In contrast, PCR efficiency seemed to increase for fragments I and L, and this effect was confirmed for fragment L when PCR was performed with total liver DNA. For fragments A, D, E, G, J, K, M and 0, PCR was very efficient regardless of Ta, but when total liver DNA was used this high efficiency was clearly observed only for fragments G, K and N. Finally, primer couples MD24/MD26 (G fragment), MD27ND31 (K fragment) and MD19MD18 (N fragment) gave consistent amplification results and were highly efficient under stringent primer hybridization conditions, i.e. when Ta = 65°C.
As some primer couples were very efficient at a Ta of 65°C i.e. only seven degrees below the primer extension temperature, we tried to perform PCR in order
TABLE 1 Semiquantitative evaluation of PCR efficiency related to annealing temperature (Ta). A three thermal step amplification procedure was performed for 40 cycles with a monoblock automatic apparatus (DNA thermal cycier, Perkin-Elmer Cetus) and the PCR product was electrophoresed on an agarose gel subsequently stained with ethidium bromide. PCR effi~entIy fell into four categories (+ + + , + + , + and -) according to the results on the ethidium bromide stained agarose gels. 40 cycle amplification was performed with DNA extracted from a viral particle preparation or from liver (in parentheses). Fragment
Base pairs (HBV specific)
Annealing temperature 50°C
60°C
65°C
A B C D E F G H I J K L M
323 (306) 730 (712) 326 (318) 442 (425) 1225 (1208) 128 (112) 243 (234) 594 (585) 905 (896) 140 (122) 451 (433) 1226 (1208) 813 (795) 267 (249) 572 (554) 822 (805)
+++(+) +++(+) ++i”(++> +++(+) +++(-) -(-) +++(+++) ++(+) +(+) +++(-) +++(++) ++(-) +++(+) +++(++) +++(+) +++(+)
+++(++) +(-) +++(++) +++(+++) nd -(-) +++(+++) +(-) nd +++(+) +-I”+(++) nd f+(-) +++(+i+) +++(++) ++(+)
+++(+) ++(+) +(-) +++(+++) +++(+++) -(-) +++(+++) ++(+) ++(+) +++(-) +++(+++) +++(i”+)
N 0 P
+++t-) +++(+++) i”++(+) +++(+)
to amplify fragments G, K and N by using only two thermal steps. For this purpose, sample temperature during one amplification cycle ranged between a denaturation and a single annealin~extension temperature. In order to develop a rapid procedure, temperature shift times were significantly reduced by using an original automatic apparatus which we developed, composed of a mechanical arm and three independent heating blocks. This apparatus permitted us to develop a modified PCR using two thermal steps, and under these conditions, sample temperature ranged between 81 and 65”C, i.e. a fluctuation of 16°C. With the apparatus, one amplification cycle lasted between 2 min 30 s and 3 min 10 s. Thus 20 cycles take 55 min and 40 cycles can be performed in 105 min (with a 5 min denaturation time for the first amplification cycle). This two thermal step PCR was used to perform specific amplification of an HBV DNA sequence flanked by primers MD24 and MD26. After 40 cycles, the specific DNA fragment G was visualized on an ethidium bromide agarose gel (the initial number of HIS’ DNA molecules prepared from a viral particle preparation were 300, 30 and 3: Fig. 4). For 0.3 and 0.03 molecules, fragment G was not observed on an agarose gel or on the corresponding autoradiogram (data not shown) obtained with a total HBV DNA probe (pCP10). Total DNA extracted from the liver of a chronic active hepatitis B patient was submitted to the same two thermal step procedure but the denaturation temperature was 95°C instead of 81°C for the first two cycles only. Applied to HBV DNA, extracted from a particle preparation or
57
TI
Tz
1
2
3
4
5
243 =
Fig. 4. PCR amplification of fragment G with the two thermal step procedure. MD24 and MD26 primers were used to amplify a 243 bp DNA fragment for 40 cycles using a one minute annealing/extension time. The experiment was performed with our automatic multiblock apparatus and the PCR product was electrophoresed on an agarose gel subsequently stained with ethidium bromide. The initial number of HBV DNA molecule extracted from a viral particle preparation was 300 (l), 30 (2), 3 (3), 0.3 (4) and 0.03 (5). Tl was the PCR product obtained from 1 pg of pCPl0. T2 was 0x 17CHincII (Phannacia) .
from liver, specificity and efficiency were identical when the modified PCR procedure or the conventional PCR with Ta = 65°C were performed.
Discussion We show in this study that selection of primers is important for development of an HBV infection diagnostic test based on PCR. Some observations on the influence of primer sequence on PCR can be made. Firstly, the two primer couples which were the least efficient at 65”C, i.e. MD14/IPO3 (C) and MD03/MDO6 (F), had a GC content in the HBV specific sequence of 50% for MD 14 and IP03, 30% for MD03 and 55% for MD06. In addition, primers IP03, MD03, MD06 and MD014 had shorter total sequences (15, 22, 20 and 24 nucleotides, respectively) and HBV specific sequences (15, 13, 11 and 15 nucleotides, respectively). All these characteristics are probably responsible for the lower melting temperatures of IP03 MD03 and MD06 in the sixteen proposed primer sequences. Secondly, the most efficient primer couples used for amplification of DNA from serum or liver with Ta = 65°C were MD14iMD13 (D), MD14MD26 (E), MD24MD26 (G), MD27/MD31 (K), MD19MD18 (N) and MD27ND18 (L). For five of these six primer couples, GC content in HBV specific sequences range from
58
50 to 75%. The primer couple MD14/MD13 is the only one to have a lower GC content, i.e. 50% for MD14 and 30% for MD13. However, the three terminal 3’ nucleotides of MD13 are cytosines which could explain the efficiency of this primer couple at a high annealing temperature. All these observations prompted us to consider that parameters such as GC content, nucleotide length and 3’ sequence are significantly related to PCR efficiency, even if they cannot account for all of our results. Extension time seemed to be a limiting factor when large DNA fragments were amplified. Indeed, when PCR was performed on DNA extracted from a viral particle preparation (Fig. 3), only DNA fragments shorter than 500 base pairs (i.e. fragments A, D, C, G, J, K and N) were efficiently amplified with an extension time of 1 min and Ta = 50°C. DNA fragments of 500 to 1200 base pairs were clearly visualized on the agarose gel with an extension time of 2 min 30 s. A surprising result is the improvement in PCR efficiency for fragments E, I and L when Ta was increased from 50 to 65°C. Secondary structure formation of the DNA sequence to be amplified could explain this observation. Indeed, under our ionic strength conditions, secondary structure within these fragments should be stable at 50°C and instable at 65°C. Intramolecular secondary structure results from complete or partial hybridization between two inverted complementary sequences. As the probability for one molecule to contain these two sequences increases with the total length, long DNA molecules are particularly prone to secondary structure formation. According to our results (Table l), the three DNA fragments in question are precisely the three longest ones, i.e. 1226 bp for L, 1225 bp for E and 905 bp for I. This hypothesis of secondary structure formation is consistent with the observation of Mtiller and Fitch (1982) concerning the HBV genome structure. Indeed, 19 hairpin loops of more than 6 nucleotides in size including 7 hairpin loops of more than 7 nucleotides in size have been located within the HBV genome. These structures have perfectly base-paired stems and loop sizes of 3 to 20 nucleotides. Their involvement in HBV gene regulation has been proposed (Delius et al., 1983). Fragments E, I and L contain at least one hairpin loop. For fragments E, L, 0, P, B, H and I, additional HBV specific bands were visualized on the agarose gel (Fig. 3) when PCR was performed on a viral particle preparation. Two potential interpretations can explain this PCR heterogeneity. Firstly, amplified fragments shorter than the HBV genome (3182 bp) could result from non-specific hybridization of primers to the HBV genome. However, in our experimental conditions the probability of this non-specific hybridization is very low, given the simplicity of the viral genome. The second interpretation can account for HBV DNA fragments even longer than 3182 base pairs (as observed for MD14/MD26). Additional bands could result from partial hybridization of the 3’ extremity of a neosynthesized specific sequence with its complementary sequence. As primers are physically integrated 5’ of these two sequences, the action of Taq polymerase would result in synthesis of an exponentially amplifiable typical length sequence. This hypothesis is consistent with the fact that the additional bands observed on the agarose gel hybridized with a total HBV DNA probe and with oligonucleotide probe specific for the expected PCR product (data not shown).
59
When the amplification was performed with total liver DNA, the PCR pattern showed a large heterogeneity especially when Ta = 50%. In contrast to the results obtained with the viral particles, additional bands observed on the agarose gel did not hybridize with a total HBV DNA probe. This observation and the elimination of additional bands at high annealing temperatures indicate clearly the non-specific nature of the amplification. Our automated PCR method must be compared with the two thermal step procedure described by Kim and Smithies (1988). In their technique, samples are submitted to a denaturation step of 90°C for 15 s, i.e. under rapid Taq polymerase degradation conditions. In addition, duration of the hybridization/extension step ranges from 5 min for amplified fragments smaller than 500 bp to 15 min for longer ones. Then, an amplification cycle is performed in a minimum of 6 min 45 s. Consequently 40 cycles take 4 h 30 min. This long experimental time is also due to the automatic mono-block apparatus conception (Roll0 et al., 1988) which imposes long temperature shift times related to the thermal inertia of the system. The use of PCR for HBV DNA detection has resulted in the development of a highly sensitive diagnostic test which can detect even a single HBV DNA molecule present in a serum sample using a non-radioactive DNA probe. Rapid development of diagnostic tests based on PCR is now required on simplification and automatization of the technique from DNA (or RNA) extraction to the hybridization step. In this context, our automatized two thermal step procedure is a promising advance since a thermal amplitude of 16°C is clearly sufficient to perform the amplification. Further improvements could be based on the Peltier effect or could use microwaves.
Acknowledgements We acknowledge D.H. Mack and J.J. Sninsky for their generous help with primer sequence selection and for helpful discussions. We are grateful to J.-P. Gerlier, I. Stojic and B. Cailleux for their precious technical assistance in PCR automatization. We also thank C. B&hot who kindly provided us with biological material. References Berninger, M., Hammer, M., Hoyer, B. and Germ, J.L. (1982) An assay for the detection of the DNA genome of hepatitis B virus in serum. J. Med. Virol. 9, 57-68. Brechot, C., Pourcel, C., Hadchouel, M., Dejean, A., Louise, A., Scotto, J. and Tiollais, P. (1982) State of hepatitis B virus DNA in liver diseases. Hepatology 2, 26S-34s. Budkowska, A., Dubreuil, P., Capel, F. and Pillot, J. (1986) Hepatitis B virus pre-S gene encoded antigenic specificity and anti pre-S antibody: relationship between anti-pre-S response and recovery. Hepatology 6, 360-368. Delius, H., Gough, N.M., Cameron, C.H. and Murray, K. (1983) Structure of the hepatitis B virus genome. J, Virol. 47, 337-343. Dubois, M.F., Pourcel, C., Rousset, S., Chany, C. and Tiollais, P. (1980) Excretion of hepatitis B surface antigen particles from mouse cells transformed with cloned viral DNA. Proc. Natl. Acad. Sci. (USA) 77, 4549-4553.
60 Kaneko, S., Miller, R.H., Feinstone, S.M., Unoura, M., Kobayashi, K., Hattori, N. and Purcell, R.H. (1989) Detection of serum hepatitis virus DNA in patients with chronic hepatitis using the polymerase chain reaction assay. Proc. Natl. Acad. Sci. (USA) 86, 312-316. Kim, H.S. and Smithies, 0. (1988) Recombinant fragment assay for gene targeting based on the polymerase chain reaction. Nucleic Acids Res. 16, 8887-8903. Kuhns, M., Thiers, V., Courouce, A., Scotto, J., Tiollais, P. and B&hot, C. (1984) Quantitative detection of HBV DNA in human serum. In: G.N. Vyas, J.L. Dienstag and J.K. Hoofnagle (Eds), Viral Hepatitis and Liver Disease, 8B17, 665. Grune and Statton, New York, London. Larzul, D., Guigue, F., Sninsky, J.J., Mack, D.H., B&hot, C. and Guesdon, J.L. (1988) Detection of hepatitis B virus sequences in serum by using in vitro enzymatic amplification. J. Virol. Methods 20, 227-237. Larzul, D., Chevrier, D. and Guesdon, J.L. (1989) A non-radioactive diagnostic test for the detection of HBV DNA sequences in serum at the single molecule level. Mol. Cell. Probes 3, 45-57. Lok, A.S.F., Hadziyannis, S. J., Weller, I.V.D., Karvountzis, M.G., Montjardino, J., Karayiannis, P., Montana, L. and Thomas, H.C. (1984) Contribution of low level HBV replication to continuing inflammatory activity with anti-HBe positive chronic hepatitis B virus infection. Gut 25, 1283-1287. Mtlller, U.R. and Fitch, W.M. (1982) Evolutionary selection for perfect hairpin structures in viral DNAs. Nature (London) 298, 582-584. Mullis, K., Faloona, F., Scharf, S., Saiki, R., Horn, G. and Erlich, H. (1986) Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harbor Symp. Quant. Biol. 51, 263-273. Prince, A.M., Stephan, W. and Brotman, B. (1983) B-propiolactone/irradiation: a review of its effectiveness for inactivation of viruses in blood derivatives. Rev. Infect. Dis. 5, 92-107. Rollo, F., Amici, A. and Salvi, R. (1988) A simple and low cost DNA amplifier. Nucleic Acids Res. 16, 3105-3106. Saiki, R.K., Scharf, S., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A. and Arnheim, N. (1985) Enzymatic amplification of B-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230, 1350-1354. Scotto, J., Hadchouel, M., Hery, C., Yvart, _I., Tiollais, P. and B&hot, C. (1982) Detection of hepatitis B virus DNA in serum by a simple spot hybridization technique: comparison with results for other viral markers. Hepatology 3, 279-284. Weller, I., Fowler, M., Monjardino, J. and Thomas, H. (1982) The detection of HBV-DNA in serum by molecular hybridization: a more sensitive method for the detection of complete HBV particles. J. Med. Virol. 9, 273-280.
49
VIRMET 00968
An automatic modified polymerase chain reaction procedure for hepatitis B virus DNA detection D. Larzu11p2,D. Chevrieti,
V. Thiers3 and J.-L. Guesdon2
‘Dkpartementde Biologie Mo&culaire, InstitutHenri Beaufour, Les Ulis, France, =Laboratoiredes Sondes Froides and %aitk de Recombinaison et d’Expression G&&ique, InstitutPasteur, Paris, France (Accepted 11 September 1989)
In order to perform an efficient and reproducible diagnostic test for hepatitis B virus (HBV) infection using the polymerase chain reaction (PCR), sixteen primer couples specific for the HBV genome were selected. Primers 15-31 nucleotides in length containing between 31-73% GC permitted amplification of fragments corresponding to the whole HBV genome. The specificity and efficiency of PCR amplification were studied in detail using DNA extracted from either a viral particle preparation or from the liver of a patient with chronic active hepatitis. Three primer couples in the X, C and PreS regions, i.e. MD24MD26, MD27MD31 and MD19MD18, respectively, gave satisfactory results and performed efficiently under highly stringent hybridization conditions. A modified PCR procedure was then developed using only two thermal steps with a temperature shift of 16°C. This simple method was as efficient as conventional PCR and permitted detection of a single HBV DNA molecule with the X region specific primer couple. The automatization of this PCR-based procedure permitted 40 amplification cycles in 105 min. HBV; PCR; Diagnosis; Automatization
Introduction Molecular hybridization has been considered as one of the most direct and reliable diagnostic tests for hepatitis B virus (HBV) infection (Beminger et al., 1982; Correspondence to: D. Larzul, Department of Molecular Biology, Institut Henry Beaufour, 1 Avenue des Tropiques, 91952 Les Ulis Cedex, France. 0166-0934/90/$03.50 @ 1990 Elsevier Science Publishers B.V. (Biomedical Division)
50
B&hot et al., 1982). The presence of HBV DNA sequences in serum and the HBeAg/anti-HBeAg status are considered to be markers of viral replication (Scotto et al., 1982; Lok et al., 1984). During a typical hepatitis B virus infection, HBeAg appears early in serum and is generally associated with HBV DNA positivity. Progressively, HBeAg and HBV DNA disappear and serum antibody against HBeAg emerge. However, some patients with chronic hepatitis are either positive for HBeAg and negative for HBV DNA by dot-blot hybridization, or positive for antibody against HBeAg and for HBV DNA by dot-blot hybridization. Using 32Plabelled DNA probes, up to 10’ viral particles/ml of serum can be detected (Scotto et al., 1982; Weller et al., 1982), but it is known that a serum containing lo* particles/ml is infectious in the chimpanzee (Prince et al., 1983). The lack of sensitivity of conventional tests poses serious problems for the diagnosis of infectivity and for the surveillance of HBV carriers. We used therefore the polymerase chain reaction (PCR) (Saiki et al., 1985; Mullis et al., 1986) in a previous report (Larzul et al., 1988) in order to address this problem. PCR made it possible to detect a single viral DNA molecule with either a 32P (Larzul et al., 1988) or acetylaminofluorene (AAF) (Larzul et al., 1989) labelled probe after 32 and 40 amplification cycles, respectively. More recently, our results were confirmed when PCR was used to detect HBV DNA in serum of patients with chronic hepatitis (Kaneko et al., 1989). In this report, 16 primer couples permitting amplification of a set of fragments corresponding to the whole HBV genome were studied. Primer hybridization conditions were studied in order to select the most efficient primer couples with the aim of performing hybridization and extension with Taq polymerase during the same thermal step. In addition, some basic parameters were modified to perform a highly specific and rapid test based on PCR. We then developed an automatic PCR apparatus more adapted to HBV DNA sequence detection in clinical practice.
Materials and Methods Preparation of DNA
Viral particles were purified from the serum of a chronic HBsAg carrier by using a discontinuous sucrose gradient (Budkowska et al., 1986). In a 12 ml polypropylene centrifuge tube, 5 ml of serum were loaded onto a 6 ml discontinuous sucrose gradient containing an equal volume of 10, 20 and 30% sucrose in 10 mM Tris-HCl, pH 7.8, containing 50 mM NaCl. After a 4 h centrifugation at 220000 x g, the pellet was resuspended and incubated for 1 h at 70°C with proteinase K (Boehringer, Mannheim, F.R.G.) at 2.5 mg/ml in 25 mM sodium acetate, pH 6.5, containing 2.5 mM EDTA and 0.5% SDS. After one phenol and one diethylether extraction, the sample was incubated for 30 min at 68°C to eliminate the diethylether. The viral particle concentration could be determined by dot-blot (Scotto et al., 1982) using a known preparation of recombinant Lambda HBV bacteriophage particles (Kuhns et al., 1984).
51
DNA extraction from liver was performed as follows: the liver tissue was crushed in liquid nitrogen and the cellular DNA was purified by phenol chloroform extraction and ethanol precipitation. Primer synthesis
Primer sequences are indicated in Fig. 1. Oligonucleotide primers were synthesized on an Applied Biosystems 381A synthesizer using phosphoramidite chemistry* Amplification technique with Taq Polymerase
A serum DNA sample containing lo6 viral particles, or 350 ng of hepatic DNA, was added to 40 ~1 of a buffer containing 60 mM Tris, pH 7.5, 17 mM ammonium sulphate, 5 mM MgCl,, 6.7 FM EDTA, 10 mM B-mercaptoethanol, 170 mg/ml bovine serum albumin, 200 PM of each dNTP and 400 nM of each primer. One unit of Taq polymerase (Perkin-Elmer Cetus, U.S.A.) per sample was used for 40 cycles in the presence of 100 ~1 of mineral oil (Sigma, U.S.A.) added to avoid evaporation. We used an automatic amplification apparatus (DNA thermal cycler PerIP 03
GCTGAAAGCCAAACA
MD 03
CTCAAGCTTCATCATCCATATA
MD06
CTTGGATCCTATGGGAGTGG
MD11
GCGAAGCTTAAGAAGATGAGGCATAG
MD 12
GCGCTGCAGGGACTGGGGACCCTG
MD 13
GCGAAGCTTTTAGGGTTTAAATGTATACCC
MD 14
GCGCTGCAGCTATGCCTCATCTTC
MD 16
GCGAAGCTTGTCCTAGGAATCCTGATG
MD 18
GCGAAGCTTCCCTGAGCCTGAGGGCTCCACC
MD 19
GCGCTGCAGGGGTCACCATATTCTTGG
MD24
TGCCAACTGGATCCTTCGCGGGACGTCCTT
MD 25
GCGAAGCTTAAGGAAAGAAGTCAGAAGG
MD 26
GCGAAGCTTGTTCACGGTGGTCTCCATG
Mp 27
GCGGGATCCACTGTTCAAGCCTCCAAGCT
MD30
GCGCTGCAGGAGTGTGGATTCGCACTC
MD31
GCGAAGCTTAGGAGTGCGAATCCACACTC
Fig. 1. HBV primer sequences. Sixteen oligonucleotide sequences were selected in conserved regions of the HBV genome deduced from the alignment of five different sequences from subtypes adw, adr and ayw. Sequences MD12, MD14, MD06, MD24, MD27, MD30 and MD19 are complementary to the (-) strand. Sequences MD16, MDll, IP03, MD03, MD13, MD26, MD25, MD31 and MD18 are complementary to the (+) strand. IFQ3 is fully HBV specific and does not carry a restriction site. MD24 contains a BumHI site which is HBV specific as is the rest of its sequence. All the ,other sequences contain an additional restriction site at the 5’ end: Hind111 for MD03, MDll, MD13, MD16, MD18, MD25, MD26 and MD31; BarnHI for MD06 and MD27; and PstI for MD12 MD14, MD19 and MD30. These same fourteen sequences have an additional GCG sequence in 5’, except MD03 and MD06 which contain CI’C and CIT respectively.
52
kin-Elmer Cetus) to perform the amplification. This apparatus was used for conventional PCR i.e. with three thermal steps (denaturation, annealing, and extension). For the two thermal step PCR procedure, we used an apparatus developed by Institut Pasteur (see results). Gel electrophoresis
and Southern blot analysis
20 ml of the PCR product were electrophoresed in 2% agarose gel (Sigma) and stained with ethidium bromide to visualize DNA. The gel was then incubated twice for 15 min in 0.5 M NaOH, 1.5 M NaCl, and twice for 30 min in 0.5 M Tris-HCl, pH 7.5, 3 M NaCl. Nucleic acids were transferred for 16 h to a nylon membrane (Hybond-N, Amersham, Little Chalfont, U.K.), then the filter was rapidly washed in 2 x SSC (1 x SSC = 0.15 M NaCl, 0.015 M sodium citrate) and treated for UV irradiation. Hybridization
with a radioactive probe
A recombinant I-IBV plasmid, pCPl0 (Dubois et al., 1980), containing two HBV genomes, was treated by random priming (Multiprime DNA Labelling System, Amersham) by using a 32P-dTTP (specific activity: 1.6 x lo9 cpm/pg). The filter was prehybridized for 3 h at 68°C in 6 x SSC, 5 x Denhardt’s solution (5 x solution = 0.1% Ficoll, 0.1% bovine serum albumin, and 0.1% polyvinylpyrrolidone), 0.5% SDS, 100 mg/ml denatured salmon sperm DNA, and hybridization was performed for 16 h at 68°C in the same buffer without SDS and with the 32Plabelled pCPl0 probe at 0.5 X lo6 cpm/ml. The filter was washed three times in 2 x SSC, 0.1% SDS for 10 min at room temperature, and twice for 30 min at 58°C in 0.1 x SSC, 0.1% SDS. Autoradiography was performed at -80°C for 1 h with Kodak XAR-5 film and an intensifying screen.
Results
Oligonucleotide
sequence
determination
In order to develop a rapid and highly specific PCR-based procedure, 16 different HBV specific primers (Fig. 1) were selected in the conserved regions of the viral genome as shown by the alignment of five different sequences from subtypes adw, adr and ayw. MD03 and MD06 are two primers of 22 and 20 nucleotides respectively with only 13 HBV specific nucleotides. These primers were previously selected for another study (Larzul et al., 1988) in which the Klenow fragment was used. The fourteen other primers were selected for use with Taq polymerase. The length of their HBV specific sequences ranged from 15 (IP03) to 31 (MD 18) nucleotides. An additional restriction site was added at the 5’ extremity (&I, BamHI, and HindIII)
53
except for IP03 which has no restriction site and MD 24 which contains an HBV specific BamHl site. A short three nucleotide sequence was added 5’ of the restriction site to protect it from possible degradation. In order to avoid formation of secondary structures, no compkmentary sequences longer than 4 nucleotides were present in the primer sequences. Particular attention was paid to the sequence in 3’, related to conserved regions in the HBV genome. GC content of the HBV specific sequences of the various primers ranged from 31% (MD03) to 73% (MD 12, MD 18). HBV diagnostic test Sixteen different primer associations were used to perform amplification of HBV specific DNA fragments of 128 to 1226 nuckotides in length (Fig. 2). Under these conditions, the entire HEW genome was amplified. Specifkity and efficiency of the three thermal amplification steps were studied for these sixteen primer couples by MD 111
MD 12
MD26
MD 24
Fig. 2. Positions of primers on the HBV genome and characterization of the amplified DNA fragments. Arrows indicate positions of primer sequences on the HBV genome. A clockwise arrow designates a primer sequence complementary to the (-) strand, while a counterclockwise arrow indicates a sequence complementary to the (+) strand. Thick lines indicate the amplifiable DNA fragments A, B, C, D, E, F, G, H, I, J, K, L, M, N, 0 and P. C is flanked by primers MD14/IPO3. F is flanked by primers MDO6MDO3.
54
‘AGCGJKNELOPBNIM
1057 -
. *ADCBJKNELGPBNIH
1057
392 291 162
Fig. 3. PCR product obtained with DNA extracted from a viral particle preparation. Amplification was performed for 40 cycles with a monoblock automatic apparatus (DNA thermal cycler, Perkin-Elmer Cetus) and the PCR product was electrophoresed on an agarose gel subsequently stained with ethidium bromide. A three thermal step procedure was programmed and three hybridization step temperatures were used. For fragments A, D, C, G, J, K and N, an ampli~cation cycie was 1 min at 95”C, 1 min at 50°C (1) or 65°C (Z), and 1 min at 72°C. An amplification cycle was then performed in 5 min 30 s. For fragments E, L, 0, P, B, H, I and M, an amplification cycle was 1 min at 95”C, 1 min 30 s at 50°C (1) or 6% (2), and 2 min 30 s at 72°C. An amplification cycle was then performed in 7 min 30 s. White arrows indicate positions of the expected bands.
using an annealing temperature (Ta) of 50, 60 or 65°C. This procedure was applied either to a viral particle preparation from an I-E& Ag+ chronic carrier carrier serum (Fig. 3) or to total liver DNA obtained from a chronic active hepatitis B patient (data not shown). In order to obtain amplification results independent of primer length, different PCR conditions were used. A one minute extension time was used for the sixteen primer couples. When the specific amplified fragment was longer than 500 base pairs, a second amplification ex-
55
periment was performed with an extension time of 2 min 30 s. Two classes of PCR products were obtained when a viral particle preparation was used. In the first class, DNA fragments A, D, G, J, K and N were specifically amplified with a one min extension time regardless of the annealing temperature which varied from 50 to 65°C. For these fragments, an optimal efficiency was obtained (Table 1) and the amount of amplified DNA estimated on ethidium bromide stained agarose gels (data not shown) ranged from 1.5 to 3 pg for a 50 ~1 sample. Fragment C was specifically amplified but the PCR efficiency decreased dramatically when the Ta increased from 50 to 65°C. For the second class of amplified fragments, i.e. fragments E, L, 0, P, B, H, I and M, a one min extension time resulted in an undetectable specific product (data not shown). After a longer extension time (2 min 30 s), PCR efficiency was significantly increased, but some contaminating faint bands appeared on the agarose gel regardless of Ta. These bands were HBV specific as shown with Southern blot analysis using a total HBV DNA probe (data not shown). When applied to total liver DNA, the electrophoretie patterns of the PCR product were significantly different with an annealing temperature of 50 or 65°C. Indeed, for all primer couples, additional amplified DNA fragments were obtained with Ta = .5O”C,excepted for MDl4~13 (fragment D). These additional bands did not hybridize with au HBV specific DNA probe (data not shown). Products H and I (Fig. 3) show a double-band amplification pattern which could be related to the unusual structure of HBV DNA. Indeed, in serum, DNA is partially single stranded and the complete strand is nicked to a position overlap by products H and I. The same experiment performed with Ta = 65°C resulted in a highly specific amplification of fragments A, D, G, K, N, E and L. Indeed, for these fragments, all the additional bands observed with Ta = 50°C (except for D) were not amplified under high annealing temperature conditions (Ta = 65°C). The efficiency of the PCR was semi-quantitatively evaluated (Table 1) from the ethidium bromide stained agarose gel for Ta = 50, 60 or 65°C. Increasing the Ta from 50 to 65°C had a significant effect on the PCR product pattern obtained in serum for fragments B, C, I and L. Concerning fragments B and C, a decrease of the PCR efficiency was obtained with a more pronounced effect for C. In contrast, PCR efficiency seemed to increase for fragments I and L, and this effect was confirmed for fragment L when PCR was performed with total liver DNA. For fragments A, D, E, G, J, K, M and 0, PCR was very efficient regardless of Ta, but when total liver DNA was used this high efficiency was clearly observed only for fragments G, K and N. Finally, primer couples MD24/MD26 (G fragment), MD27ND31 (K fragment) and MD19MD18 (N fragment) gave consistent amplification results and were highly efficient under stringent primer hybridization conditions, i.e. when Ta = 65°C.
As some primer couples were very efficient at a Ta of 65°C i.e. only seven degrees below the primer extension temperature, we tried to perform PCR in order
TABLE 1 Semiquantitative evaluation of PCR efficiency related to annealing temperature (Ta). A three thermal step amplification procedure was performed for 40 cycles with a monoblock automatic apparatus (DNA thermal cycier, Perkin-Elmer Cetus) and the PCR product was electrophoresed on an agarose gel subsequently stained with ethidium bromide. PCR effi~entIy fell into four categories (+ + + , + + , + and -) according to the results on the ethidium bromide stained agarose gels. 40 cycle amplification was performed with DNA extracted from a viral particle preparation or from liver (in parentheses). Fragment
Base pairs (HBV specific)
Annealing temperature 50°C
60°C
65°C
A B C D E F G H I J K L M
323 (306) 730 (712) 326 (318) 442 (425) 1225 (1208) 128 (112) 243 (234) 594 (585) 905 (896) 140 (122) 451 (433) 1226 (1208) 813 (795) 267 (249) 572 (554) 822 (805)
+++(+) +++(+) ++i”(++> +++(+) +++(-) -(-) +++(+++) ++(+) +(+) +++(-) +++(++) ++(-) +++(+) +++(++) +++(+) +++(+)
+++(++) +(-) +++(++) +++(+++) nd -(-) +++(+++) +(-) nd +++(+) +-I”+(++) nd f+(-) +++(+i+) +++(++) ++(+)
+++(+) ++(+) +(-) +++(+++) +++(+++) -(-) +++(+++) ++(+) ++(+) +++(-) +++(+++) +++(i”+)
N 0 P
+++t-) +++(+++) i”++(+) +++(+)
to amplify fragments G, K and N by using only two thermal steps. For this purpose, sample temperature during one amplification cycle ranged between a denaturation and a single annealin~extension temperature. In order to develop a rapid procedure, temperature shift times were significantly reduced by using an original automatic apparatus which we developed, composed of a mechanical arm and three independent heating blocks. This apparatus permitted us to develop a modified PCR using two thermal steps, and under these conditions, sample temperature ranged between 81 and 65”C, i.e. a fluctuation of 16°C. With the apparatus, one amplification cycle lasted between 2 min 30 s and 3 min 10 s. Thus 20 cycles take 55 min and 40 cycles can be performed in 105 min (with a 5 min denaturation time for the first amplification cycle). This two thermal step PCR was used to perform specific amplification of an HBV DNA sequence flanked by primers MD24 and MD26. After 40 cycles, the specific DNA fragment G was visualized on an ethidium bromide agarose gel (the initial number of HIS’ DNA molecules prepared from a viral particle preparation were 300, 30 and 3: Fig. 4). For 0.3 and 0.03 molecules, fragment G was not observed on an agarose gel or on the corresponding autoradiogram (data not shown) obtained with a total HBV DNA probe (pCP10). Total DNA extracted from the liver of a chronic active hepatitis B patient was submitted to the same two thermal step procedure but the denaturation temperature was 95°C instead of 81°C for the first two cycles only. Applied to HBV DNA, extracted from a particle preparation or
57
TI
Tz
1
2
3
4
5
243 =
Fig. 4. PCR amplification of fragment G with the two thermal step procedure. MD24 and MD26 primers were used to amplify a 243 bp DNA fragment for 40 cycles using a one minute annealing/extension time. The experiment was performed with our automatic multiblock apparatus and the PCR product was electrophoresed on an agarose gel subsequently stained with ethidium bromide. The initial number of HBV DNA molecule extracted from a viral particle preparation was 300 (l), 30 (2), 3 (3), 0.3 (4) and 0.03 (5). Tl was the PCR product obtained from 1 pg of pCPl0. T2 was 0x 17CHincII (Phannacia) .
from liver, specificity and efficiency were identical when the modified PCR procedure or the conventional PCR with Ta = 65°C were performed.
Discussion We show in this study that selection of primers is important for development of an HBV infection diagnostic test based on PCR. Some observations on the influence of primer sequence on PCR can be made. Firstly, the two primer couples which were the least efficient at 65”C, i.e. MD14/IPO3 (C) and MD03/MDO6 (F), had a GC content in the HBV specific sequence of 50% for MD 14 and IP03, 30% for MD03 and 55% for MD06. In addition, primers IP03, MD03, MD06 and MD014 had shorter total sequences (15, 22, 20 and 24 nucleotides, respectively) and HBV specific sequences (15, 13, 11 and 15 nucleotides, respectively). All these characteristics are probably responsible for the lower melting temperatures of IP03 MD03 and MD06 in the sixteen proposed primer sequences. Secondly, the most efficient primer couples used for amplification of DNA from serum or liver with Ta = 65°C were MD14iMD13 (D), MD14MD26 (E), MD24MD26 (G), MD27/MD31 (K), MD19MD18 (N) and MD27ND18 (L). For five of these six primer couples, GC content in HBV specific sequences range from
58
50 to 75%. The primer couple MD14/MD13 is the only one to have a lower GC content, i.e. 50% for MD14 and 30% for MD13. However, the three terminal 3’ nucleotides of MD13 are cytosines which could explain the efficiency of this primer couple at a high annealing temperature. All these observations prompted us to consider that parameters such as GC content, nucleotide length and 3’ sequence are significantly related to PCR efficiency, even if they cannot account for all of our results. Extension time seemed to be a limiting factor when large DNA fragments were amplified. Indeed, when PCR was performed on DNA extracted from a viral particle preparation (Fig. 3), only DNA fragments shorter than 500 base pairs (i.e. fragments A, D, C, G, J, K and N) were efficiently amplified with an extension time of 1 min and Ta = 50°C. DNA fragments of 500 to 1200 base pairs were clearly visualized on the agarose gel with an extension time of 2 min 30 s. A surprising result is the improvement in PCR efficiency for fragments E, I and L when Ta was increased from 50 to 65°C. Secondary structure formation of the DNA sequence to be amplified could explain this observation. Indeed, under our ionic strength conditions, secondary structure within these fragments should be stable at 50°C and instable at 65°C. Intramolecular secondary structure results from complete or partial hybridization between two inverted complementary sequences. As the probability for one molecule to contain these two sequences increases with the total length, long DNA molecules are particularly prone to secondary structure formation. According to our results (Table l), the three DNA fragments in question are precisely the three longest ones, i.e. 1226 bp for L, 1225 bp for E and 905 bp for I. This hypothesis of secondary structure formation is consistent with the observation of Mtiller and Fitch (1982) concerning the HBV genome structure. Indeed, 19 hairpin loops of more than 6 nucleotides in size including 7 hairpin loops of more than 7 nucleotides in size have been located within the HBV genome. These structures have perfectly base-paired stems and loop sizes of 3 to 20 nucleotides. Their involvement in HBV gene regulation has been proposed (Delius et al., 1983). Fragments E, I and L contain at least one hairpin loop. For fragments E, L, 0, P, B, H and I, additional HBV specific bands were visualized on the agarose gel (Fig. 3) when PCR was performed on a viral particle preparation. Two potential interpretations can explain this PCR heterogeneity. Firstly, amplified fragments shorter than the HBV genome (3182 bp) could result from non-specific hybridization of primers to the HBV genome. However, in our experimental conditions the probability of this non-specific hybridization is very low, given the simplicity of the viral genome. The second interpretation can account for HBV DNA fragments even longer than 3182 base pairs (as observed for MD14/MD26). Additional bands could result from partial hybridization of the 3’ extremity of a neosynthesized specific sequence with its complementary sequence. As primers are physically integrated 5’ of these two sequences, the action of Taq polymerase would result in synthesis of an exponentially amplifiable typical length sequence. This hypothesis is consistent with the fact that the additional bands observed on the agarose gel hybridized with a total HBV DNA probe and with oligonucleotide probe specific for the expected PCR product (data not shown).
59
When the amplification was performed with total liver DNA, the PCR pattern showed a large heterogeneity especially when Ta = 50%. In contrast to the results obtained with the viral particles, additional bands observed on the agarose gel did not hybridize with a total HBV DNA probe. This observation and the elimination of additional bands at high annealing temperatures indicate clearly the non-specific nature of the amplification. Our automated PCR method must be compared with the two thermal step procedure described by Kim and Smithies (1988). In their technique, samples are submitted to a denaturation step of 90°C for 15 s, i.e. under rapid Taq polymerase degradation conditions. In addition, duration of the hybridization/extension step ranges from 5 min for amplified fragments smaller than 500 bp to 15 min for longer ones. Then, an amplification cycle is performed in a minimum of 6 min 45 s. Consequently 40 cycles take 4 h 30 min. This long experimental time is also due to the automatic mono-block apparatus conception (Roll0 et al., 1988) which imposes long temperature shift times related to the thermal inertia of the system. The use of PCR for HBV DNA detection has resulted in the development of a highly sensitive diagnostic test which can detect even a single HBV DNA molecule present in a serum sample using a non-radioactive DNA probe. Rapid development of diagnostic tests based on PCR is now required on simplification and automatization of the technique from DNA (or RNA) extraction to the hybridization step. In this context, our automatized two thermal step procedure is a promising advance since a thermal amplitude of 16°C is clearly sufficient to perform the amplification. Further improvements could be based on the Peltier effect or could use microwaves.
Acknowledgements We acknowledge D.H. Mack and J.J. Sninsky for their generous help with primer sequence selection and for helpful discussions. We are grateful to J.-P. Gerlier, I. Stojic and B. Cailleux for their precious technical assistance in PCR automatization. We also thank C. B&hot who kindly provided us with biological material. References Berninger, M., Hammer, M., Hoyer, B. and Germ, J.L. (1982) An assay for the detection of the DNA genome of hepatitis B virus in serum. J. Med. Virol. 9, 57-68. Brechot, C., Pourcel, C., Hadchouel, M., Dejean, A., Louise, A., Scotto, J. and Tiollais, P. (1982) State of hepatitis B virus DNA in liver diseases. Hepatology 2, 26S-34s. Budkowska, A., Dubreuil, P., Capel, F. and Pillot, J. (1986) Hepatitis B virus pre-S gene encoded antigenic specificity and anti pre-S antibody: relationship between anti-pre-S response and recovery. Hepatology 6, 360-368. Delius, H., Gough, N.M., Cameron, C.H. and Murray, K. (1983) Structure of the hepatitis B virus genome. J, Virol. 47, 337-343. Dubois, M.F., Pourcel, C., Rousset, S., Chany, C. and Tiollais, P. (1980) Excretion of hepatitis B surface antigen particles from mouse cells transformed with cloned viral DNA. Proc. Natl. Acad. Sci. (USA) 77, 4549-4553.
60 Kaneko, S., Miller, R.H., Feinstone, S.M., Unoura, M., Kobayashi, K., Hattori, N. and Purcell, R.H. (1989) Detection of serum hepatitis virus DNA in patients with chronic hepatitis using the polymerase chain reaction assay. Proc. Natl. Acad. Sci. (USA) 86, 312-316. Kim, H.S. and Smithies, 0. (1988) Recombinant fragment assay for gene targeting based on the polymerase chain reaction. Nucleic Acids Res. 16, 8887-8903. Kuhns, M., Thiers, V., Courouce, A., Scotto, J., Tiollais, P. and B&hot, C. (1984) Quantitative detection of HBV DNA in human serum. In: G.N. Vyas, J.L. Dienstag and J.K. Hoofnagle (Eds), Viral Hepatitis and Liver Disease, 8B17, 665. Grune and Statton, New York, London. Larzul, D., Guigue, F., Sninsky, J.J., Mack, D.H., B&hot, C. and Guesdon, J.L. (1988) Detection of hepatitis B virus sequences in serum by using in vitro enzymatic amplification. J. Virol. Methods 20, 227-237. Larzul, D., Chevrier, D. and Guesdon, J.L. (1989) A non-radioactive diagnostic test for the detection of HBV DNA sequences in serum at the single molecule level. Mol. Cell. Probes 3, 45-57. Lok, A.S.F., Hadziyannis, S. J., Weller, I.V.D., Karvountzis, M.G., Montjardino, J., Karayiannis, P., Montana, L. and Thomas, H.C. (1984) Contribution of low level HBV replication to continuing inflammatory activity with anti-HBe positive chronic hepatitis B virus infection. Gut 25, 1283-1287. Mtlller, U.R. and Fitch, W.M. (1982) Evolutionary selection for perfect hairpin structures in viral DNAs. Nature (London) 298, 582-584. Mullis, K., Faloona, F., Scharf, S., Saiki, R., Horn, G. and Erlich, H. (1986) Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harbor Symp. Quant. Biol. 51, 263-273. Prince, A.M., Stephan, W. and Brotman, B. (1983) B-propiolactone/irradiation: a review of its effectiveness for inactivation of viruses in blood derivatives. Rev. Infect. Dis. 5, 92-107. Rollo, F., Amici, A. and Salvi, R. (1988) A simple and low cost DNA amplifier. Nucleic Acids Res. 16, 3105-3106. Saiki, R.K., Scharf, S., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A. and Arnheim, N. (1985) Enzymatic amplification of B-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230, 1350-1354. Scotto, J., Hadchouel, M., Hery, C., Yvart, _I., Tiollais, P. and B&hot, C. (1982) Detection of hepatitis B virus DNA in serum by a simple spot hybridization technique: comparison with results for other viral markers. Hepatology 3, 279-284. Weller, I., Fowler, M., Monjardino, J. and Thomas, H. (1982) The detection of HBV-DNA in serum by molecular hybridization: a more sensitive method for the detection of complete HBV particles. J. Med. Virol. 9, 273-280.
