http://informahealthcare.com/phb ISSN 1388-0209 print/ISSN 1744-5116 online Editor-in-Chief: John M. Pezzuto Pharm Biol, Early Online: 1–6 ! 2015 Informa Healthcare USA, Inc. DOI: 10.3109/13880209.2015.1025290
ORIGINAL ARTICLE
Antimicrobial resistance and virulence-related genes of Streptococcus obtained from dairy cows with mastitis in Inner Mongolia, China Yuexia Ding1,2, Junli Zhao3, Xiuling He1,2, Man Li1,2, Hong Guan1,2, Ziying Zhang4, and Peifeng Li1,2
Pharmaceutical Biology Downloaded from informahealthcare.com by Kainan University on 04/14/15 For personal use only.
1
Department of Veterinary Pharmacology & Toxicology, College of Veterinary Medicine, Inner Mongolia Agricultural University, Hohhot, Inner Mongolia Autonomous Region, PR China, 2Laboratory of Clinical Diagnosis and Treatment Techniques for Animal Disease, Ministry of Agriculture, Hohhot, Inner Mongolia Autonomous Region, China, 3Inner Mongolia Academy of Agricultural & Animal Husbandry Sciences, Hohhot, Inner Mongolia Autonomous Region, PR China, and 4College of Basic, Inner Mongolia Medical University, Hohhot, Inner Mongolia Autonomous Region, PR China Abstract
Keywords
Context: Mastitis is the most expensive disease in the dairy cattle industry and results in decreased reproductive performance. Streptococcus, especially Streptococcus agalactiae, possesses a variety of virulence factors that contribute to pathogenicity. Objective: Streptococcus isolated from mastitis was tested to assess the prevalence of antimicrobial resistance and distribution of antibiotic resistance- and virulence-related genes. Materials and methods: Eighty-one Streptococcus isolates were phenotypically characterized for antimicrobial resistance against 15 antibiotics by determining minimum inhibitory concentrations (MIC) using a micro-dilution method. Resistance- and virulence-related genes were detected by PCR. Results: High percentage of resistance to b-lactams, along with tetracycline and erythromycin, was found. Resistance to three or more of seven antimicrobial agents was observed at 88.9%, with penicillin–tetracycline–erythromycin–clindamycin as the major profile in Streptococcus isolates. Resistant genes were detected by PCR, the result showed that 86.4, 86.4, 81.5, and 38.3% of isolates were mainly carrying the pbp2b, tetL, tetM, and ermB genes, respectively. Nine virulence genes were investigated. Genes cyl, glnA, cfb, hylB, and scaA were found to be in 50% of isolates, while 3.7, 21, and 4.9% of isolates were positive for bca, lmb, and scpB, genes, respectively. None of the isolates carried the bac gene. Discussion and conclusion: This study suggests the need for prudent use of antimicrobial agents in veterinary clinical medicine to avoid the increase and dissemination of antimicrobial resistance arising from the use of antimicrobial drugs in animals.
Antimicrobial resistance, mastitis, Streptococcus, virulence
Introduction Mastitis is the most expensive disease in the dairy cattle industry and results in decreased reproductive performance. Streptococcus agalactiae is associated with cow and well adapted to the mammary gland, whereas Streptococcus dysgalactiae and Streptococcus uberis are environmental pathogens (Gue´rin-Fauble´e et al., 2002). Various species of Streptococcus are known to be associated with infections of cattle, pigs, horses, sheep, birds, aquatic mammals, and fishes. Streptococcus uberis and S. dysgalactiae are considered exclusively animal pathogens (Facklam, 2002); however, S. agalactiae is one of the main pathogens causing mastitis, invasive disease (Jain et al., 2012) and is also a human pathogen that mainly cause neonatal infections (Poyart et al., 2003).
Correspondence: Peifeng Li, Department of Veterinary Pharmacology & Toxicology, College of Veterinary Medicine, Inner Mongolia Agricultural University, 306 Zhaowuda Road, 010018 Hohhot, Inner Mongolia Autonomous Region, PR China. Tel/Fax: +86 471 4314662. E-mail: [email protected]
History Received 9 December 2014 Revised 2 February 2015 Accepted 28 February 2015 Published online 9 April 2015
Streptococcus, especially S. agalactiae, possesses a variety of virulence factors that contribute to pathogenicity. Several surface proteins and polysaccharide capsules were identified within this species. The scpB gene encodes for surface enzyme ScpB (C5a peptidase), the bca gene encodes for a-protein, the lmb gene encodes for laminine-binding protein, and bac, cyl, glnA, cfb, hylB, and scaA encode for b-antigen, b-hemolysin, glutamine synthetase, the Christie–Atkins– Munch–Peterson (CAMP) factor, hyaluronidase, and aggregation factor, respectively (Dmitriev et al., 2002). Antimicrobial resistance in pathogenic bacteria has become a real problem and may be partially due to the use of antimicrobials as growth promoters or prophylactic agents in animal agriculture. Antimicrobial treatment should take into account previous information such as the minimum inhibitory concentrations (MIC) of the available agents for individual pathogens (Sheldon et al., 2004). In Streptococcus, antimicrobial resistance genes are responsible for resistance to erythromycin, tetracycline, and penicillin which mainly included ermB, mefA, tetL, tetM, tetK, tetO, and pbp2b.
2
Y. Ding et al.
Pharm Biol, Early Online: 1–6
Susceptibility of Streptococcus to antimicrobial agents has been poorly described in Inner Mongolia of China. The aim of this study was to assess the prevalence of antimicrobial resistance and distribution of antibiotic resistance- and virulence-related genes in local Streptococcus isolates from dairy cows with mastitis. Understanding the patterns of phenotypic antibiotic resistance will provide important information into effective antimicrobial management of mastitis. Materials and methods
Pharmaceutical Biology Downloaded from informahealthcare.com by Kainan University on 04/14/15 For personal use only.
Case definition and sample collection A total of 360 milk samples were collected from commercial dairy farms distributed throughout the main dairy production regions of the Inner Mongolia autonomous region of China from 2010 to 2013. The most obvious symptoms of clinical mastitis are abnormalities in the udder such as swelling, heat, hardness, redness, or pain; and the milk such as a watery appearance, flakes, clots, or pus. Other symptoms, depending on the severity of the illness and how systemic it has become, can also include the following: a reduction in milk yield, an increase in body temperature, the lack of appetite, etc. Milk samples were recovered from cows without antibiotic treatment until samples were collected. Before sampling, the udder was washed with an antiseptic solution, wiped dry with a clean face towel, and then disinfected with a cotton ball dampened with 75% ethanol; the first streams of milk were discarded and 10 mL of milk was collected in sterile plastic tubes and numbered. Samples were transported on the ice to the laboratory within 5 h. Bacterial isolation and identification The samples were enriched in 5 mL of the Mueller–Hinton broth with 5% defibrinated sheep blood and incubated at 37 C for 1824 h. The enriched samples were cultured on Mueller–Hinton agar plates supplemented with 5% defibrinated sheep blood for 24 h aerobically in 5% CO2 at 37 C. Typical Streptococcus colonies were distinguished
microscopically by colony morphology, then by the characteristic appearance on hemolysis and Gram’s stain and the absence of catalase activity. Isolates were kept at 80 C in the Mueller–Hinton broth containing 30% glycerol. DNA extraction Streptococcus isolates were subcultured on Mueller–Hinton agar plates supplemented with 5% defibrinated sheep blood and were grown overnight at 37 C. Genomic DNA was purified using a commercially available kit (TIANamp, Beijing, China) according to the manufacturer’s instructions, with a minor modification by the addition of 15 mL of lysozyme (20 mg/mL; Sigma, St. Louis, MO) to each sample during cell lysis. The purified genomic DNA was stored at 20 C until polymerase chain reaction (PCR) analysis. Species identification by sodA gene sequence analysis Each extracted genomic DNA was subjected to PCR to amplify a 480 bp region of the manganese-dependent superoxide dismutase (sodA) gene (Hoshino et al., 2005). The primers used for PCR amplification and sequencing are shown in Table 1. PCR was performed in a DNA thermal cycler (Eppendorf, Hamburg, Germany) using a PCR kit (Takara, Tokyo, Japan) following the manufacturer’s instructions with some modifications. Each PCR reaction contained 1 mL of extracted template DNA, 1.25 U of Taq DNA polymerase, 5 mL of 10 PCR amplification buffer (Mg2+ plus buffer), 1 mL of each primer (10 mM), 4 mL of dNTP (each 2.5 mM), and double-distilled water was added to a final volume of 50 mL. Following an initial denaturation step of 94 C for 5 min, samples were subjected to 35 cycles of: denaturation for 30 s at 94 C, annealing for 30 s at 50 C, and extension at 72 C for 90 s. A final extension step was performed at 72 C for 10 min. The positive and negative controls for these experiments were the ATCC 49619 strain of Streptococcus pneumoniae and a PCR solution reaction lacking template DNA, respectively. The PCR products were analyzed by electrophoresis using a 1% agarose gel in
Table 1. Details of PCR primers used to amplify Streptococcus antimicrobial resistance genes and virulence factors. Primer sequence (50 –30 ) Target gene
Forward
Reverse
Tm ( C)
Amplicon size (bp)
soda ermB mefA tetM tetO tetL tetK pbp2b
CCITAYICITAYGAYGCIYTIGARCC ATTGGAACAGGTAAAGGGC AGTATCATTAATCACTAGTGC GAACTCGAACAAGAGGAAAGC AACTTAGGCATTCTGGCTCAC TGAACGTCTCATTACCTG TCCTGGAACCATGAGTGT GATCCTCTAAATGATTCTCAGGTGG
ARRTARTAIGCRTGYTCCCAIACRTC GAACATCTGTGGTATGGCG TTCTTCTGGTACTAAAAGTGG ATGGAAGCCCAGAAAGGAT TCCCACTGTTCCATATCGTCA ACGAAAGCCCACCTAAAA AGATAATCCGCCCATAAC CCATTAGCTTAGCAATAGGTGTTGG
50 50 53 55 52 50 50 55
480 442 346 740 519 993 189 1500
bac bca scpB lmb cyl glnA cfb scaA hylB
TGTAAAGGACGATAGTGTGAAGAC TAACAGTTATGATACTTCACAGAC CCAAGACTTCAGCCACAAGG ACCGTCTGAAATGATGTGG ACGGCTTGTCCATAGTAGTGTTTG ACGTATGAACAGAGTTGGCTATAA ATGGGATTTGGGATAACTAAGCTAG ACGGTATCAACCTTGAAACTGG ACAAATGGAACGACGTGACTAT
CATTTGTGATTCCCTTTTGC ACGACTTTCTTCCGTCCACTTAGG CAATTCCAGCCAATAGCAGC GATTGACGTTGTCTTCTGC AACGACACTGCCATCAGCAC TCCTCTGATAATTGCATTCCAC AGCGTGTATTCCAGATTTCCTTAT TCAGTGTTGATTTCCCAGATGTA CACCAATTGGCAGAGCCT
50 51 57 51 52 52 52 52 52
530 535 591 572 345 471 193 256 346
Reference Hoshino et al. (2005) Marimo´n et al. (2005) Marimo´n et al. (2005) Lopardo et al. (2003) Lopardo et al. (2003) Lopardo et al. (2003) Lopardo et al. (2003) Charpentier & Tuomanen (2000) Dmitriev et al. (2002) Dmitriev et al. (2002) Dmitriev et al. (2002) Dmitriev et al. (2002) Dmitriev et al. (2002) Dmitriev et al. (2002) Dmitriev et al. (2002) Dmitriev et al. (2002) Dmitriev et al. (2002)
Resistance and virulence of Streptococcus in mastitis
DOI: 10.3109/13880209.2015.1025290
1 TAE buffer. The stained gels were viewed using a standard UV transilluminator. Sequencing reactions were performed using the BigDye Direct Cycle Sequencing Kit (Life Technologies, Grand Island, NY) and an Ion PGM Sequencer (Life Technologies, Grand Island, NY). The sodA gene sequence of each Streptococcus species was obtained from GenBank; the BLAST algorithm was used to compare sequence homology between references and isolate sequences. A 97% identity threshold was used as a cut-off value for homology (Altschul et al., 1990).
Pharmaceutical Biology Downloaded from informahealthcare.com by Kainan University on 04/14/15 For personal use only.
Antimicrobial susceptibility test Prior to susceptibility tests, all detected Streptococcus isolates were revived by subculture on Mueller–Hinton agar plates supplemented with 5% defibrinated sheep blood and incubated at 37 C for 1824 h aerobically in 5% CO2. MICs were determined using the microdilution method as recommended by the Clinical and Laboratory Standards Institute (CLSI, 2013). This method used MH broth and consisted of manually prepared 96-well microtiter plates containing the following 15 antibiotics from the China Institute of Veterinary Drug Control (IVDC, China): penicillin, amoxicillin, ampicillin, cefradine, cefalotin, meropenem, erythromycin, dirithromycin, ofloxacin, levofloxacin, gatifloxacin, chloramphenicol, clindamycin, vancomycin, and tetracycline. Each antibiotic tested was diluted using a two-fold dilution pattern and wells containing different concentrations (0.125, 0.25, 0.5, 1.0, 2.0, 4.0, 8.0, 16.0, 32.0, 64.0, and 128 mg/mL) were prepared. The inoculum was prepared by suspending several colonies of Streptococcus in MH broth and adjusting the OD625 value to 0.1 (about 1 108 CFU/mL). The final bacterial concentration was diluted to 1 106 CFU/mL of 50 mL per well. The plates were covered and incubated at 37 C for 1820 h. At the same time, Streptococcus pneumoniae ATCC 49619 was used as the control strain. All susceptibility results were complied with the quality control ranges. MIC value was defined as the lowest concentration of antimicrobial agent with no visible growth, and the MIC50 value (that inhibited at least 50% of the isolates) and MIC90
3
values (that inhibited at least 90% of the isolates) were calculated. Detection of antimicrobial resistance genes Isolates that displayed phenotypic resistance to antibiotics were further tested for the presence of antimicrobial resistance genes. PCR was used to amplify mefA and ermB genes encoding resistance to erythromycin (Marimo´n et al., 2005), tetM, tetO, tetL, and tetK conferring resistance to tetracycline (Lopardo et al., 2003), pbp2b gene contributing to penicillin resistance (Charpentier & Tuomanen, 2000). Primers, amplicon size, and annealing temperatures are listed in Table 1; PCR was performed using the same conditions as used to identify Streptococcus species. Detection of virulence-related genes PCR method was also used to detect virulence-related genes in the isolated samples. Primer sets used to amplify bca, bac, scpB, lmb, cyl, glnA, cfb, hylB, and scaA genes are listed in Table 1. PCR was performed using the same conditions as used to identify Streptococcus species. The annealing temperatures are listed in Table 1.
Results Species identification Eighty-one Streptococcus isolates were isolated from 22.5% of the clinical bovine mastitis cases tested and identified as S. agalactiae (n ¼ 57; 70.4%), S. dyagalactiae (n ¼ 9; 11.1%), and S. uberis (n ¼ 15; 18.5%) by morphological characterization and biochemical testing. Antimicrobial resistance patterns in Streptococcus isolates and detection of antimicrobial resistance genes Streptococcus isolates were also tested for their susceptibility to 15 antimicrobial agents and the results are shown in Tables 2 and 3. All isolates were resistant to at least one of the antibiotics tested. Most isolates were resistant to
Table 2. Minimum inhibitory concentrations (MIC: mg/mL) of Streptococcus from bovine mastitis (n ¼ 81 isolates) for 15 antimicrobials agents. Distribution of isolates (%) Antimicrobial Penicillin Amoxicillin Ampicillin Cefradine Cefalotin Meropenem Erythromycin Dirithromycin Ofloxacin Levofloxacin Gatifloxacin Chloramphenicol Clindamycin Vancomycin Tetracycline
0.125 ± ± 0 ± ± ± 1.2 ± ± 4.9 ± ± ± 13.6 ± 4.9 23.5 9.9 30.9 1.2 33.3 35.8 0 14.8 4.9 4.9
0.25 1.2 1.2± ± 13.6± ± 2.5 3.7 12.3± ± 6.2± ± 8.6 6.2 7.4 27.2 0 ± ± 13.6± ± 7.4 2.5
0.5
1
2
4
2.5 11.1 56.8 6.2 6.2 17.3 17.3 9.9 25.9 9.9 16 1.2 6.2 33.3 1.2
12.3 14.8 9.9 6.2 6.2 34.6 14.8 9.9 24.7 18.5 8.6 4.9 6.2 27.2 2.5
8.6 37 1.2 4.9 14.8 1.2 4.9 3.7 13.6 22.2 6.2 22.2 7.4 16 1.2
12 14 2.5 1.2 14 3.7 3.7 12 4.9 7.4 2.5 17 4.9 6.2 2.5
± ± ± ± ± ± ± ± ± ± ± ± ± ±
± ± ± ±
The breakpoints used are indicated by vertical lines (CLSI, 2013).
± ± ± ± ± ± ± ± ± ± ± ±
±± ± ± ± ± ± ± ± ± ± ± ± ±
± ± ± ± ± ± ± ± ± ± ± ± ±± ±
8
16
32
64
128
6.2 2.5 0 1.2 21 1.2 7.4 13.6 14.8 3.7 2.5 ± ± ± 21 ± 8.6 0 7.4
30.9 3.7 0 8.6 14.8 0 2.5 7.4 3.7 0 1.2 4.9 11.1 0 12.3
6.2 7.4 3.7 29.6 3.7 1.2 6.2 3.7 2.5 0 0 16 17.3 0 29.6
11.1 4.9 4.9 13.6 6.2 1.2 6.2 0 2.5 0 0 7.4 6.2 2.5 24.7
8.6 2.5 2.5 12.3 4.9 3.7 21 0 0 0 0 4.9 3.7 2.5 11.1
4
Y. Ding et al.
Pharm Biol, Early Online: 1–6
Table 3. Summary of minimum inhibitory concentrations (MIC: mg/mL) and antimicrobial resistance profile for Streptococcus from bovine mastitis (n ¼ 81 isolates). % Isolates MIC (mg/mL)
Pharmaceutical Biology Downloaded from informahealthcare.com by Kainan University on 04/14/15 For personal use only.
Antimicrobial Penicillin Amoxicillin Ampicillin Cefradine Cefalotin Meropenem Erythromycin Dirithromycin Ofloxacin Levofloxacin Gatifloxacin Chloramphenicol Clindamycin Vancomycin Tetracycline
Total
Resistance
Minimum
50%
90%
Maximum
I
R
I+R
S. agalactiae
S. dysgalactiae
S. uberis
0.25 0.125 0.125 0.125 0.125 0.125 0.125 0.125 0.125 0.125 0.125 0.5 0.125 0.125 0.125
16 2 0.5 32 8 0.5 2 1 1 0.5 0.25 8 4 1 32
64 32 32 128 64 4 128 16 8 2 2 64 32 4 128
128 128 128 128 128 128 128 32 64 8 16 128 128 128 128
– – – – – – 17.3 9.9 4.9 7.4 6.2 21 6.2 – 2.5
95 91.4 81.5 86.4 85.2 46.9 66.7 40.7 23.5 3.7 6.2 33.2 65.4 32.2 85.1
– – – – – 84 50.6 28.4 11.1 12.4 54.2 71.6 – 87.6
67.9 66.7 56.8 60.5 60.5 30.9 54.3 32.1 22.3 3.7 4.9 32.1 63 27.2 61.7
11.1 8.6 8.6 8.6 7.4 6.2 8.6 2.5 0 0 1.2 0 0 1.2 9.9
16 16 16 17.3 17.3 9.9 3.7 6.2 1.2 0 0 1.2 2.4 3.7 13.6
I, intermediate resistance; R, resistance; –, not applicable. MIC50 value is the MIC value that inhibited at least 50% of the isolates; MIC90 value is the MIC value that inhibited at least 90% of the isolates. Table 4. Resistance profiles for Streptococcus from bovine mastitis (n ¼ 81 isolates). Isolates Resistance to classes of antimicrobials One Two Three Four Five Six Seven
Number
%
2 7 20 27 13 9 3
2.5 8.5 24.7 33.3 16 11.1 3.7
b-lactams: penicillin (95%), amoxicillin (91.4%), ampicillin (81.5%), cefradine (86.4%), and cefalotin (85.2%). At least 50% of the isolates showed resistance to erythromycin (MIC50 value ¼ 2 mg/mL and MIC90 value 128 mg/ mL), clindamycin (MIC50 value ¼ 4 mg/mL and MIC90 value ¼ 32 mg/mL), and tetracycline (MIC50 value ¼ 32 mg/mL and MIC90 value 128 mg/mL). None of the antimicrobial agents were completely effective against Streptococcus. Levofloxacin and gatifloxacin showed the most effective inhibitory activity against the isolates; 3.7% and 6.2% of the isolates were resistant to these antimicrobials, respectively. Of the 81 isolates, 79 (97.5%) were resistant to at least two of the antimicrobial agents tested and greater than or equal to three antimicrobial agents were observed in 72 (88.9%) Streptococcus isolates (Table 4). Penicillin–tetracycline– erythromycin–clindamycin was the major multidrug resistance profile, which was observed in 14 (17.3%) of the multidrug-resistant isolates, and three isolates (3.7%) were resistant to seven antimicrobials (Table 4). Of the 71 isolates that demonstrated resistance to tetracycline, tetL, tetM, tetK, and tetO were identified in 70 (98.6%), 66 (93.0%), 30 (42.3%), and 5 (7.0%) of the isolates, respectively. In the 68 erythromycin-resistant isolates, ermB and mefA genes were identified, which were 31 (45.6%) and
1 (1.5%) of the isolates, respectively. For isolates demonstrating resistance to b-lactams, pbp2b genes was identified in 70 (86.4%) of the 81 resistant isolates. Detection of virulence factor genes The 81 isolates were tested by PCR for the presence of nine genes potentially involved in virulence. The gene bac was not present in Streptococcus strains, 40 isolates were found to harbor the cyl gene (49.4%) including S. agalactiae (n ¼ 39) 48.1% and S. dysgalactiae (n ¼ 1) 1.2%. Genes glnA, cfb, hylB, and scaA were discovered only in S. agalactiae at incidences of 46.9, 50.6, 49.4, and 45.7%, respectively. In contrast, genes bca, lmb, and scpB were identified only 3 (3.7%), 17 (21%), and 4 (4.9%), respectively, of the S. agalactiae isolates.
Discussion The present study showed that all isolates tested by the in MIC method (CLSI, 2013) against 15 antibiotics demonstrated the existence of a variable and broad antimicrobial resistance profile among local Streptococcus. Overall, the total isolates had a high frequency of phenotypic resistance to b-lactams, along with tetracycline and erythromycin. Streptococcus agalactiae was the main pathogenic bacteria and resistance of strain also was high. Decreased susceptibility to penicillin has been reported previously (Gue´rin-Fauble´e et al., 2002; Rossitto et al., 2002). In contrast to the rate of penicillin resistance (approximately 10%) reported (Nam et al., 2009), the high rate of Streptococci in the present study was resistant to penicillin in the area. b-Lactams are known as the first-line antimicrobial agents when treating streptococcal udder infections (Denamiel et al., 2005). Penicillin is the drug of choice for the treatment of both human and bovine S. agalactiae infections (Keefe, 1997). The mixture of penicillin–streptomycin was used to treat bovine disease in the dairy farm, which increased the development of penicillin resistance. This does not mean that penicillin-resistant
Pharmaceutical Biology Downloaded from informahealthcare.com by Kainan University on 04/14/15 For personal use only.
DOI: 10.3109/13880209.2015.1025290
Streptococcus would fail therapy with penicillin as the interpretive criteria are based on human data and may not accurately reflect the efficacy of penicillin for treating streptococcal mastitis (Watts & Yancey, 1994). Tetracycline and erythromycin had been always used for the treatment of several infections in cattle for many years. Resistance to tetracycline is the most common antibiotic resistance found in nature and is usually mediated either by active efflux of tetracycline from the cell or by ribosomal protection from the action of tetracycline. All tetracycline-resistant isolates carried at least one tet gene. In the present study, resistance prevalence of tetM (93.0%), tetO (7.0%), tetL (98.6%), and tetK (42.3%) genes in the tetracycline-resistant isolates was similar to those found by Gao et al. (2012). Roberts (1996) reported evidence of tetracycline resistance in Streptococci and Enterococci: efflux by proton antiporters (tetL and tetK) and ribosome protection (tetM, tetO, tetS, and tetT). This indicates that tetracycline resistance as both efflux pump and ribosome protection is encoded by the tetL and tetM genes. Data presented should therefore provide a good estimate of antimicrobial susceptibility of udder pathogens encountered in acute clinical mastitis in the field. In Streptococcus, two major mechanisms of resistance to erythromycin are recognized which is due to methylation of the 23 S rRNA by a methyltransferase encoded by an erm (erythromycin resistance methylase) gene, mef (macrolide efflux) gene is mediated by a proton-dependent active drug efflux system encoded. Genes ermB and mefA were detected 45.6% and 1.5% of the 68 erythromycin-resistant isolates, respectively, suggesting that erythromycin resistance methylase may be the major mechanism of resistance in the present study. Multidrug resistant (MDR) was defined as acquired nonsusceptibility to at least one agent in three or more antimicrobial categories (Magiorakos et al., 2011). Multiple resistances to three or more of seven antimicrobial agents tested were observed. Of the 81 Streptococcus isolates, 88.9% (72/81) were multiple resistant. Meanwhile, 3.7% (3/81) were resistant to seven antimicrobial agents. The previous report from Korea stated that about 65% of the isolates were resistant to two or more antimicrobial agents, and 37.6% were resistant to three or more of seven antimicrobial agents tested (Nam et al., 2009). The results suggest that the abuse of antibiotics is very serious, and resistance to many antibiotics has reached a high level, especially multiple resistance in Inner Mongolia region than Korea (Nam et al., 2009). The virulence genes examined in this study would be to possess possible association in the pathogenesis of mammary infections. Streptococcus agalactiae virulence is complex and multifactorial. Several virulence factors are involved in the adhesion to and invasion of host cells, as well as in the immune system evasion. According to Spellerberg (1999), the lmb gene (laminin binding protein) was present in the common serotypes of S. agalactiae, and it plays an important role in the adherence of S. agalactiae. The scpB gene codes for surface enzyme scpB (a C5a peptidase). C5a peptidase genes were found only in group B Streptococci, which cause impairing of neutrophil recruitment and bind fibronectin to promote bacterial invasion of epithelial cells (Beckmann et al., 2002). The bca gene codes for a-protein, a surface
Resistance and virulence of Streptococcus in mastitis
5
protein that helps the bacteria to enter the host cells. In our study, the lmb, scpB, and bca genes were discovered 21, 4.9, and 3.7% of isolates, respectively. These observations are in agreement with earlier reports, where the molecular analysis has shown that most bovine strains lack gene for the surface proteins scpB and lmb, in contrast to human isolates (Dmitriev et al., 1999; Franken et al., 2001; Shome et al., 2012). The results suggest that the S. agalactiae were either less virulent with the absence of the lmb, scpB, and bca genes or they may have an alternative mechanism for the cellular adhesion and invasion. Recent studies indicate that several systems involved in nutrition and metabolism, especially glutamine metabolism (glnA), are important in the virulence of various bacterial pathogens (Hendriksen et al., 2008). Si et al. (2009) data also showed that glnA were definitely important for the virulence of Streptococcus suis serotype. The cyl gene codes for b-hemolysin, a toxin that plays a role in tissue injury and the systemic spread of the bacteria and contributes to meningitis (Doran et al., 2003). In the present study, 48.1% isolates had the cyl gene. Spellerberg et al. (2000) observed that 23% isolates were positive for the cyl, while Bergseng et al. (2007) found 34.3% positivity. The hylB gene codes group B Streptococcal hyaluronate lyase which cleaves hyaluronic acid, a component of extracellular matrix, to N-acetylglucosamine and glucuronic acid. Hyaluronate lyase produced by various bacteria has traditionally been regarded as a spreading factor that contributes to the host tissueinvasive properties of bacterial pathogens (Duran-Reynals, 1942). According to the studies of Gu¨nther et al. (1996), 72% of the GBS investigated were hylB positive, the result was similar with our data. The CAMP factor (cfb) is a 23.5 kDa ceramide-binding protein of S. agalactiae, the lethal properties of the CAMP factor for cell cultures and for rabbits and mice suggest that it may have a cytotoxic action for mammary tissue (Jain et al., 2012). The cfb gene was discovered at 50.6%; in contrast, Shome et al. (2012) reported that the CAMP factor (cfb) was found to be 85.7%, which suggested that the release of CAMP factor during systemic infections could impair the host immune response (Gase et al., 1999). The role of CAMP factor in pathogenicity is unclear, although it cannot be ruled out as a putative virulence factor (Lasagno et al., 2011). The ability to attach to the host cell surface has been considered as an important virulence strategy in many bovine mammary gland pathogens. The expression of these genes is higher than lmb, scpB, and bca, which might play an important role for the virulence of S. agalactiae pathogens, as was found here. In conclusion, the study showed a high occurrence of multidrug resistant Streptococcus isolated from mastitis within Inner Mongolia. Strains of resistant to penicillin, which are to be within and between herds and thereby in combination with prudent use of antimicrobials milked separately if bacteriological cure is not attained, preventing spread of Streptococcus probably, also counteract an increase in the prevalence of penicillin resistance. Virulence-related factors may play an important role in the development or persistence of mastitis. Our study highlights the need for prudent use of antimicrobial agents in veterinary clinical medicine which can avoid the increase
6
Y. Ding et al.
and dissemination of antimicrobial resistance arising from the use of antimicrobial drugs in animals; it is necessary to monitor mastitis pathogens to assess any changes in their antibiotic resistance patterns.
Declaration of interest The authors report that they have no conflicts of interest. This research was supported by the Key Project of Natural Science Fund (2009zd04) of Inner Mongolia autonomous region of China.
Pharmaceutical Biology Downloaded from informahealthcare.com by Kainan University on 04/14/15 For personal use only.
References Altschul SF, Gish W, Miller W, et al. (1990). Basic local alignment search tool. J Mol Biol 215:403–10. Beckmann C, Waggoner JD, Harris TO, et al. (2002). Identification of novel adhesins from group B Streptococci by use of phage display reveals that c5a peptidase mediates fibronectin binding. Infect Immun 70:2869–76. Bergseng H, Bevanger L, Rygg M, et al. (2007). Real-time PCR targeting the sip gene for detection of group B streptococcus colonization in pregnant women at delivery. J Med Microbiol 56:223–8. Charpentier E, Tuomanen E. (2000). Mechanisms of antibiotic resistance and tolerance in Streptococcus pneumoniae. Microbes Infect 2: 1855–64. Clinical and Laboratory Standards Institute (CLSI). (2013). Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Third Informational Supplement. CLSI document M100-S23. Wayne (PA): Clinical and Laboratory Standards Institute. Denamiel G, Llorente P, Carabella M, et al. (2005). Antimicrobial susceptibility of Streptococcus spp. isolated from bovine mastitis in Argentina. J Vet Med B 52:125–8. Dmitriev A, Hu YY, Shen AD, et al. (1999). Comparative genetic study of group B Streptococcus strains if human and bovine origin. Folia Microbiol (Praha) 44:449–53. Dmitriev A, Shakleina E, Tkacikova L, et al. (2002). Genetic heterogeneity of the pathogenic potentials of human and bovine group B Streptococci. Folia Microbiol 47:291–5. Doran KS, Liu GY, Nizet V. (2003). Group B Streptococcal betahemolysin/cytolysin activates neutrophil signaling pathways in brain endothelium and contributes to development of meningitis. J Clin Invest 112:736–44. Duran-Reynals F. (1942). Tissue permeability and spreading factors in infection. Bacteriol Rev 6:197–252. Facklam R. (2002). What happened to the Streptococci: Overview of taxonomic and nomenclature changes. Clin Microbiol Rev 15:613–30. Franken C, Haase G, Brandt C, et al. (2001). Horizontal gene transfer and host specificity of beta-haemolytic Streptococci: The role of a putative composite transposon containing scpB and lmb. Mol Microbiol 41:925–35. Gao J, Yu FQ, Luo LP, et al. (2012). Antibiotic resistance of Streptococcus agalactiae from cows with mastitis. Vet J 194:423–4. Gase K, Ferretti JJ, Primeaux C, et al. (1999). Identification, cloning, and expression of the CAMP factor gene (cfa) of Group A Streptococci. Infect Immun 67:4725–31. Gue´rin-Fauble´e V, Tardy F, Bouveron C, et al. (2002). Antimicrobial susceptibility of Streptococcus species isolated from clinical mastitis in dairy cows. Int J Antimicrob Agents 19:219–26.
Pharm Biol, Early Online: 1–6
Gu¨nther E, Ozegowski JH, Ko¨hler W. (1996). Occurrence of extracellular hyaluronic acid and hyaluronatlyase in Streptococci of groups A, B, C and G. Zentralbl Bakteriol 285:64–73. Hendriksen WT, Kloosterman TG, Bootsma HJ, et al. (2008). Sitespecific contributions of glutamine-dependent regulator GlnR and GlnR-regulated genes to virulence of Streptococcus pneumoniae. Infect Immun 76:1230–8. Hoshino T, Fujiwara T, Kilian M. (2005). Use of phylogenetic and phenotypic analyses to identify nonhemolytic Streptococci isolated from bacteremic patients. J Clin Microbiol 43:6073–85. Jain B, Tewari A, Bhandari BB, et al. (2012). Antibiotic resistance and virulence genes in Streptococcus agalactiae isolated from cases of bovine subclinical mastitis. Vet Arhiv 82:423–32. Keefe GP. (1997). Streptococcus agalactiae mastitis: A review. Can Vet J 38:429–37. Lasagno MC, Reinoso EB, Dieser SA, et al. (2011). Phenotypic and genotypic characterization of Streptococcus uberis isolated from bovine sub-clinical mastitis in Argentinean dairy farms. Rev Argent Microbiol 43:212–17. Lopardo HA, Vidal P, Jeric P, et al. (2003). Six-month multicenter study on invasive infections due to group B Streptococci in Argentina. J Clin Microbiol 41:4688–94. Magiorakos AP, Srinivasan A, Carey RB, et al. (2011). Multidrugresistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect 18:268–81. Marimo´n JM, Valiente A, Ercibengoa M, et al. (2005). Erythromycin resistance and genetic elements carrying macrolide efflux genes in Streptococcus agalactiae. Antimicrob Agents Chemother 49:5069–74. Nam HM, Lim SK, Kang HM, et al. (2009). Antimicrobial resistance of Streptococci isolated from mastitic bovine milk samples in Korea. J Vet Diagn Invest 21:698–701. Poyart C, Jardy L, Quesne G, et al. (2003). Genetic basis of antibiotic resistance in Streptococcus agalactiae strains isolated in a French hospital. Antimicrob Agents Chemother 47:794–7. Roberts MC. (1996). Tetracycline resistance determinants: Mechanisms of action, regulation of expression, genetic mobility, and distribution. FEMS Microbiol Rev 19:1–24. Rossitto PV, Ruiz L, Kikuchi Y, et al. (2002). Antibiotic susceptibility patterns for environmental Streptococci isolated from bovine mastitis in central California dairies. J Dairy Sci 85:132–8. Sheldon IM, Bushnell M, Montgomery J, et al. (2004). Minimum inhibitory concentrations of some antimicrobial drugs against bacteria causing uterine infections in cattle. Vet Rec 155:383–7. Shome BR, Bhuvana M, Mitra SD, et al. (2012). Molecular characterization of Streptococcus agalactiae and Streptococcus uberis isolates from bovine milk. Trop Anim Health Prod 44:1981–92. Si Y, Yuan F, Chang H, et al. (2009). Contribution of glutamine synthetase to the virulence of Streptococcus suis serotype 2. Vet Microbiol 139:80–8. Spellerberg B, Rozdzinski E, Martin S, et al. (1999). Lmb, a protein with similarities to the LraI adhesin family, mediates attachment of Streptococcus agalactiae to human laminin. Infect Immun 67:871–8. Spellerberg B, Martin S, Brandt C, et al. (2000). The cyl genes of Streptococcus agalactiae are involved in the production of pigment. FEMS Microbiol Lett 188:125–8. Watts JL, Yancey Jr RJ. (1994). Identification of veterinary pathogens by use of commercial identification systems and new trends in antimicrobial susceptibility testing of veterinary pathogens. Clin Microbiol Rev 7:346–56.
ORIGINAL ARTICLE
Antimicrobial resistance and virulence-related genes of Streptococcus obtained from dairy cows with mastitis in Inner Mongolia, China Yuexia Ding1,2, Junli Zhao3, Xiuling He1,2, Man Li1,2, Hong Guan1,2, Ziying Zhang4, and Peifeng Li1,2
Pharmaceutical Biology Downloaded from informahealthcare.com by Kainan University on 04/14/15 For personal use only.
1
Department of Veterinary Pharmacology & Toxicology, College of Veterinary Medicine, Inner Mongolia Agricultural University, Hohhot, Inner Mongolia Autonomous Region, PR China, 2Laboratory of Clinical Diagnosis and Treatment Techniques for Animal Disease, Ministry of Agriculture, Hohhot, Inner Mongolia Autonomous Region, China, 3Inner Mongolia Academy of Agricultural & Animal Husbandry Sciences, Hohhot, Inner Mongolia Autonomous Region, PR China, and 4College of Basic, Inner Mongolia Medical University, Hohhot, Inner Mongolia Autonomous Region, PR China Abstract
Keywords
Context: Mastitis is the most expensive disease in the dairy cattle industry and results in decreased reproductive performance. Streptococcus, especially Streptococcus agalactiae, possesses a variety of virulence factors that contribute to pathogenicity. Objective: Streptococcus isolated from mastitis was tested to assess the prevalence of antimicrobial resistance and distribution of antibiotic resistance- and virulence-related genes. Materials and methods: Eighty-one Streptococcus isolates were phenotypically characterized for antimicrobial resistance against 15 antibiotics by determining minimum inhibitory concentrations (MIC) using a micro-dilution method. Resistance- and virulence-related genes were detected by PCR. Results: High percentage of resistance to b-lactams, along with tetracycline and erythromycin, was found. Resistance to three or more of seven antimicrobial agents was observed at 88.9%, with penicillin–tetracycline–erythromycin–clindamycin as the major profile in Streptococcus isolates. Resistant genes were detected by PCR, the result showed that 86.4, 86.4, 81.5, and 38.3% of isolates were mainly carrying the pbp2b, tetL, tetM, and ermB genes, respectively. Nine virulence genes were investigated. Genes cyl, glnA, cfb, hylB, and scaA were found to be in 50% of isolates, while 3.7, 21, and 4.9% of isolates were positive for bca, lmb, and scpB, genes, respectively. None of the isolates carried the bac gene. Discussion and conclusion: This study suggests the need for prudent use of antimicrobial agents in veterinary clinical medicine to avoid the increase and dissemination of antimicrobial resistance arising from the use of antimicrobial drugs in animals.
Antimicrobial resistance, mastitis, Streptococcus, virulence
Introduction Mastitis is the most expensive disease in the dairy cattle industry and results in decreased reproductive performance. Streptococcus agalactiae is associated with cow and well adapted to the mammary gland, whereas Streptococcus dysgalactiae and Streptococcus uberis are environmental pathogens (Gue´rin-Fauble´e et al., 2002). Various species of Streptococcus are known to be associated with infections of cattle, pigs, horses, sheep, birds, aquatic mammals, and fishes. Streptococcus uberis and S. dysgalactiae are considered exclusively animal pathogens (Facklam, 2002); however, S. agalactiae is one of the main pathogens causing mastitis, invasive disease (Jain et al., 2012) and is also a human pathogen that mainly cause neonatal infections (Poyart et al., 2003).
Correspondence: Peifeng Li, Department of Veterinary Pharmacology & Toxicology, College of Veterinary Medicine, Inner Mongolia Agricultural University, 306 Zhaowuda Road, 010018 Hohhot, Inner Mongolia Autonomous Region, PR China. Tel/Fax: +86 471 4314662. E-mail: [email protected]
History Received 9 December 2014 Revised 2 February 2015 Accepted 28 February 2015 Published online 9 April 2015
Streptococcus, especially S. agalactiae, possesses a variety of virulence factors that contribute to pathogenicity. Several surface proteins and polysaccharide capsules were identified within this species. The scpB gene encodes for surface enzyme ScpB (C5a peptidase), the bca gene encodes for a-protein, the lmb gene encodes for laminine-binding protein, and bac, cyl, glnA, cfb, hylB, and scaA encode for b-antigen, b-hemolysin, glutamine synthetase, the Christie–Atkins– Munch–Peterson (CAMP) factor, hyaluronidase, and aggregation factor, respectively (Dmitriev et al., 2002). Antimicrobial resistance in pathogenic bacteria has become a real problem and may be partially due to the use of antimicrobials as growth promoters or prophylactic agents in animal agriculture. Antimicrobial treatment should take into account previous information such as the minimum inhibitory concentrations (MIC) of the available agents for individual pathogens (Sheldon et al., 2004). In Streptococcus, antimicrobial resistance genes are responsible for resistance to erythromycin, tetracycline, and penicillin which mainly included ermB, mefA, tetL, tetM, tetK, tetO, and pbp2b.
2
Y. Ding et al.
Pharm Biol, Early Online: 1–6
Susceptibility of Streptococcus to antimicrobial agents has been poorly described in Inner Mongolia of China. The aim of this study was to assess the prevalence of antimicrobial resistance and distribution of antibiotic resistance- and virulence-related genes in local Streptococcus isolates from dairy cows with mastitis. Understanding the patterns of phenotypic antibiotic resistance will provide important information into effective antimicrobial management of mastitis. Materials and methods
Pharmaceutical Biology Downloaded from informahealthcare.com by Kainan University on 04/14/15 For personal use only.
Case definition and sample collection A total of 360 milk samples were collected from commercial dairy farms distributed throughout the main dairy production regions of the Inner Mongolia autonomous region of China from 2010 to 2013. The most obvious symptoms of clinical mastitis are abnormalities in the udder such as swelling, heat, hardness, redness, or pain; and the milk such as a watery appearance, flakes, clots, or pus. Other symptoms, depending on the severity of the illness and how systemic it has become, can also include the following: a reduction in milk yield, an increase in body temperature, the lack of appetite, etc. Milk samples were recovered from cows without antibiotic treatment until samples were collected. Before sampling, the udder was washed with an antiseptic solution, wiped dry with a clean face towel, and then disinfected with a cotton ball dampened with 75% ethanol; the first streams of milk were discarded and 10 mL of milk was collected in sterile plastic tubes and numbered. Samples were transported on the ice to the laboratory within 5 h. Bacterial isolation and identification The samples were enriched in 5 mL of the Mueller–Hinton broth with 5% defibrinated sheep blood and incubated at 37 C for 1824 h. The enriched samples were cultured on Mueller–Hinton agar plates supplemented with 5% defibrinated sheep blood for 24 h aerobically in 5% CO2 at 37 C. Typical Streptococcus colonies were distinguished
microscopically by colony morphology, then by the characteristic appearance on hemolysis and Gram’s stain and the absence of catalase activity. Isolates were kept at 80 C in the Mueller–Hinton broth containing 30% glycerol. DNA extraction Streptococcus isolates were subcultured on Mueller–Hinton agar plates supplemented with 5% defibrinated sheep blood and were grown overnight at 37 C. Genomic DNA was purified using a commercially available kit (TIANamp, Beijing, China) according to the manufacturer’s instructions, with a minor modification by the addition of 15 mL of lysozyme (20 mg/mL; Sigma, St. Louis, MO) to each sample during cell lysis. The purified genomic DNA was stored at 20 C until polymerase chain reaction (PCR) analysis. Species identification by sodA gene sequence analysis Each extracted genomic DNA was subjected to PCR to amplify a 480 bp region of the manganese-dependent superoxide dismutase (sodA) gene (Hoshino et al., 2005). The primers used for PCR amplification and sequencing are shown in Table 1. PCR was performed in a DNA thermal cycler (Eppendorf, Hamburg, Germany) using a PCR kit (Takara, Tokyo, Japan) following the manufacturer’s instructions with some modifications. Each PCR reaction contained 1 mL of extracted template DNA, 1.25 U of Taq DNA polymerase, 5 mL of 10 PCR amplification buffer (Mg2+ plus buffer), 1 mL of each primer (10 mM), 4 mL of dNTP (each 2.5 mM), and double-distilled water was added to a final volume of 50 mL. Following an initial denaturation step of 94 C for 5 min, samples were subjected to 35 cycles of: denaturation for 30 s at 94 C, annealing for 30 s at 50 C, and extension at 72 C for 90 s. A final extension step was performed at 72 C for 10 min. The positive and negative controls for these experiments were the ATCC 49619 strain of Streptococcus pneumoniae and a PCR solution reaction lacking template DNA, respectively. The PCR products were analyzed by electrophoresis using a 1% agarose gel in
Table 1. Details of PCR primers used to amplify Streptococcus antimicrobial resistance genes and virulence factors. Primer sequence (50 –30 ) Target gene
Forward
Reverse
Tm ( C)
Amplicon size (bp)
soda ermB mefA tetM tetO tetL tetK pbp2b
CCITAYICITAYGAYGCIYTIGARCC ATTGGAACAGGTAAAGGGC AGTATCATTAATCACTAGTGC GAACTCGAACAAGAGGAAAGC AACTTAGGCATTCTGGCTCAC TGAACGTCTCATTACCTG TCCTGGAACCATGAGTGT GATCCTCTAAATGATTCTCAGGTGG
ARRTARTAIGCRTGYTCCCAIACRTC GAACATCTGTGGTATGGCG TTCTTCTGGTACTAAAAGTGG ATGGAAGCCCAGAAAGGAT TCCCACTGTTCCATATCGTCA ACGAAAGCCCACCTAAAA AGATAATCCGCCCATAAC CCATTAGCTTAGCAATAGGTGTTGG
50 50 53 55 52 50 50 55
480 442 346 740 519 993 189 1500
bac bca scpB lmb cyl glnA cfb scaA hylB
TGTAAAGGACGATAGTGTGAAGAC TAACAGTTATGATACTTCACAGAC CCAAGACTTCAGCCACAAGG ACCGTCTGAAATGATGTGG ACGGCTTGTCCATAGTAGTGTTTG ACGTATGAACAGAGTTGGCTATAA ATGGGATTTGGGATAACTAAGCTAG ACGGTATCAACCTTGAAACTGG ACAAATGGAACGACGTGACTAT
CATTTGTGATTCCCTTTTGC ACGACTTTCTTCCGTCCACTTAGG CAATTCCAGCCAATAGCAGC GATTGACGTTGTCTTCTGC AACGACACTGCCATCAGCAC TCCTCTGATAATTGCATTCCAC AGCGTGTATTCCAGATTTCCTTAT TCAGTGTTGATTTCCCAGATGTA CACCAATTGGCAGAGCCT
50 51 57 51 52 52 52 52 52
530 535 591 572 345 471 193 256 346
Reference Hoshino et al. (2005) Marimo´n et al. (2005) Marimo´n et al. (2005) Lopardo et al. (2003) Lopardo et al. (2003) Lopardo et al. (2003) Lopardo et al. (2003) Charpentier & Tuomanen (2000) Dmitriev et al. (2002) Dmitriev et al. (2002) Dmitriev et al. (2002) Dmitriev et al. (2002) Dmitriev et al. (2002) Dmitriev et al. (2002) Dmitriev et al. (2002) Dmitriev et al. (2002) Dmitriev et al. (2002)
Resistance and virulence of Streptococcus in mastitis
DOI: 10.3109/13880209.2015.1025290
1 TAE buffer. The stained gels were viewed using a standard UV transilluminator. Sequencing reactions were performed using the BigDye Direct Cycle Sequencing Kit (Life Technologies, Grand Island, NY) and an Ion PGM Sequencer (Life Technologies, Grand Island, NY). The sodA gene sequence of each Streptococcus species was obtained from GenBank; the BLAST algorithm was used to compare sequence homology between references and isolate sequences. A 97% identity threshold was used as a cut-off value for homology (Altschul et al., 1990).
Pharmaceutical Biology Downloaded from informahealthcare.com by Kainan University on 04/14/15 For personal use only.
Antimicrobial susceptibility test Prior to susceptibility tests, all detected Streptococcus isolates were revived by subculture on Mueller–Hinton agar plates supplemented with 5% defibrinated sheep blood and incubated at 37 C for 1824 h aerobically in 5% CO2. MICs were determined using the microdilution method as recommended by the Clinical and Laboratory Standards Institute (CLSI, 2013). This method used MH broth and consisted of manually prepared 96-well microtiter plates containing the following 15 antibiotics from the China Institute of Veterinary Drug Control (IVDC, China): penicillin, amoxicillin, ampicillin, cefradine, cefalotin, meropenem, erythromycin, dirithromycin, ofloxacin, levofloxacin, gatifloxacin, chloramphenicol, clindamycin, vancomycin, and tetracycline. Each antibiotic tested was diluted using a two-fold dilution pattern and wells containing different concentrations (0.125, 0.25, 0.5, 1.0, 2.0, 4.0, 8.0, 16.0, 32.0, 64.0, and 128 mg/mL) were prepared. The inoculum was prepared by suspending several colonies of Streptococcus in MH broth and adjusting the OD625 value to 0.1 (about 1 108 CFU/mL). The final bacterial concentration was diluted to 1 106 CFU/mL of 50 mL per well. The plates were covered and incubated at 37 C for 1820 h. At the same time, Streptococcus pneumoniae ATCC 49619 was used as the control strain. All susceptibility results were complied with the quality control ranges. MIC value was defined as the lowest concentration of antimicrobial agent with no visible growth, and the MIC50 value (that inhibited at least 50% of the isolates) and MIC90
3
values (that inhibited at least 90% of the isolates) were calculated. Detection of antimicrobial resistance genes Isolates that displayed phenotypic resistance to antibiotics were further tested for the presence of antimicrobial resistance genes. PCR was used to amplify mefA and ermB genes encoding resistance to erythromycin (Marimo´n et al., 2005), tetM, tetO, tetL, and tetK conferring resistance to tetracycline (Lopardo et al., 2003), pbp2b gene contributing to penicillin resistance (Charpentier & Tuomanen, 2000). Primers, amplicon size, and annealing temperatures are listed in Table 1; PCR was performed using the same conditions as used to identify Streptococcus species. Detection of virulence-related genes PCR method was also used to detect virulence-related genes in the isolated samples. Primer sets used to amplify bca, bac, scpB, lmb, cyl, glnA, cfb, hylB, and scaA genes are listed in Table 1. PCR was performed using the same conditions as used to identify Streptococcus species. The annealing temperatures are listed in Table 1.
Results Species identification Eighty-one Streptococcus isolates were isolated from 22.5% of the clinical bovine mastitis cases tested and identified as S. agalactiae (n ¼ 57; 70.4%), S. dyagalactiae (n ¼ 9; 11.1%), and S. uberis (n ¼ 15; 18.5%) by morphological characterization and biochemical testing. Antimicrobial resistance patterns in Streptococcus isolates and detection of antimicrobial resistance genes Streptococcus isolates were also tested for their susceptibility to 15 antimicrobial agents and the results are shown in Tables 2 and 3. All isolates were resistant to at least one of the antibiotics tested. Most isolates were resistant to
Table 2. Minimum inhibitory concentrations (MIC: mg/mL) of Streptococcus from bovine mastitis (n ¼ 81 isolates) for 15 antimicrobials agents. Distribution of isolates (%) Antimicrobial Penicillin Amoxicillin Ampicillin Cefradine Cefalotin Meropenem Erythromycin Dirithromycin Ofloxacin Levofloxacin Gatifloxacin Chloramphenicol Clindamycin Vancomycin Tetracycline
0.125 ± ± 0 ± ± ± 1.2 ± ± 4.9 ± ± ± 13.6 ± 4.9 23.5 9.9 30.9 1.2 33.3 35.8 0 14.8 4.9 4.9
0.25 1.2 1.2± ± 13.6± ± 2.5 3.7 12.3± ± 6.2± ± 8.6 6.2 7.4 27.2 0 ± ± 13.6± ± 7.4 2.5
0.5
1
2
4
2.5 11.1 56.8 6.2 6.2 17.3 17.3 9.9 25.9 9.9 16 1.2 6.2 33.3 1.2
12.3 14.8 9.9 6.2 6.2 34.6 14.8 9.9 24.7 18.5 8.6 4.9 6.2 27.2 2.5
8.6 37 1.2 4.9 14.8 1.2 4.9 3.7 13.6 22.2 6.2 22.2 7.4 16 1.2
12 14 2.5 1.2 14 3.7 3.7 12 4.9 7.4 2.5 17 4.9 6.2 2.5
± ± ± ± ± ± ± ± ± ± ± ± ± ±
± ± ± ±
The breakpoints used are indicated by vertical lines (CLSI, 2013).
± ± ± ± ± ± ± ± ± ± ± ±
±± ± ± ± ± ± ± ± ± ± ± ± ±
± ± ± ± ± ± ± ± ± ± ± ± ±± ±
8
16
32
64
128
6.2 2.5 0 1.2 21 1.2 7.4 13.6 14.8 3.7 2.5 ± ± ± 21 ± 8.6 0 7.4
30.9 3.7 0 8.6 14.8 0 2.5 7.4 3.7 0 1.2 4.9 11.1 0 12.3
6.2 7.4 3.7 29.6 3.7 1.2 6.2 3.7 2.5 0 0 16 17.3 0 29.6
11.1 4.9 4.9 13.6 6.2 1.2 6.2 0 2.5 0 0 7.4 6.2 2.5 24.7
8.6 2.5 2.5 12.3 4.9 3.7 21 0 0 0 0 4.9 3.7 2.5 11.1
4
Y. Ding et al.
Pharm Biol, Early Online: 1–6
Table 3. Summary of minimum inhibitory concentrations (MIC: mg/mL) and antimicrobial resistance profile for Streptococcus from bovine mastitis (n ¼ 81 isolates). % Isolates MIC (mg/mL)
Pharmaceutical Biology Downloaded from informahealthcare.com by Kainan University on 04/14/15 For personal use only.
Antimicrobial Penicillin Amoxicillin Ampicillin Cefradine Cefalotin Meropenem Erythromycin Dirithromycin Ofloxacin Levofloxacin Gatifloxacin Chloramphenicol Clindamycin Vancomycin Tetracycline
Total
Resistance
Minimum
50%
90%
Maximum
I
R
I+R
S. agalactiae
S. dysgalactiae
S. uberis
0.25 0.125 0.125 0.125 0.125 0.125 0.125 0.125 0.125 0.125 0.125 0.5 0.125 0.125 0.125
16 2 0.5 32 8 0.5 2 1 1 0.5 0.25 8 4 1 32
64 32 32 128 64 4 128 16 8 2 2 64 32 4 128
128 128 128 128 128 128 128 32 64 8 16 128 128 128 128
– – – – – – 17.3 9.9 4.9 7.4 6.2 21 6.2 – 2.5
95 91.4 81.5 86.4 85.2 46.9 66.7 40.7 23.5 3.7 6.2 33.2 65.4 32.2 85.1
– – – – – 84 50.6 28.4 11.1 12.4 54.2 71.6 – 87.6
67.9 66.7 56.8 60.5 60.5 30.9 54.3 32.1 22.3 3.7 4.9 32.1 63 27.2 61.7
11.1 8.6 8.6 8.6 7.4 6.2 8.6 2.5 0 0 1.2 0 0 1.2 9.9
16 16 16 17.3 17.3 9.9 3.7 6.2 1.2 0 0 1.2 2.4 3.7 13.6
I, intermediate resistance; R, resistance; –, not applicable. MIC50 value is the MIC value that inhibited at least 50% of the isolates; MIC90 value is the MIC value that inhibited at least 90% of the isolates. Table 4. Resistance profiles for Streptococcus from bovine mastitis (n ¼ 81 isolates). Isolates Resistance to classes of antimicrobials One Two Three Four Five Six Seven
Number
%
2 7 20 27 13 9 3
2.5 8.5 24.7 33.3 16 11.1 3.7
b-lactams: penicillin (95%), amoxicillin (91.4%), ampicillin (81.5%), cefradine (86.4%), and cefalotin (85.2%). At least 50% of the isolates showed resistance to erythromycin (MIC50 value ¼ 2 mg/mL and MIC90 value 128 mg/ mL), clindamycin (MIC50 value ¼ 4 mg/mL and MIC90 value ¼ 32 mg/mL), and tetracycline (MIC50 value ¼ 32 mg/mL and MIC90 value 128 mg/mL). None of the antimicrobial agents were completely effective against Streptococcus. Levofloxacin and gatifloxacin showed the most effective inhibitory activity against the isolates; 3.7% and 6.2% of the isolates were resistant to these antimicrobials, respectively. Of the 81 isolates, 79 (97.5%) were resistant to at least two of the antimicrobial agents tested and greater than or equal to three antimicrobial agents were observed in 72 (88.9%) Streptococcus isolates (Table 4). Penicillin–tetracycline– erythromycin–clindamycin was the major multidrug resistance profile, which was observed in 14 (17.3%) of the multidrug-resistant isolates, and three isolates (3.7%) were resistant to seven antimicrobials (Table 4). Of the 71 isolates that demonstrated resistance to tetracycline, tetL, tetM, tetK, and tetO were identified in 70 (98.6%), 66 (93.0%), 30 (42.3%), and 5 (7.0%) of the isolates, respectively. In the 68 erythromycin-resistant isolates, ermB and mefA genes were identified, which were 31 (45.6%) and
1 (1.5%) of the isolates, respectively. For isolates demonstrating resistance to b-lactams, pbp2b genes was identified in 70 (86.4%) of the 81 resistant isolates. Detection of virulence factor genes The 81 isolates were tested by PCR for the presence of nine genes potentially involved in virulence. The gene bac was not present in Streptococcus strains, 40 isolates were found to harbor the cyl gene (49.4%) including S. agalactiae (n ¼ 39) 48.1% and S. dysgalactiae (n ¼ 1) 1.2%. Genes glnA, cfb, hylB, and scaA were discovered only in S. agalactiae at incidences of 46.9, 50.6, 49.4, and 45.7%, respectively. In contrast, genes bca, lmb, and scpB were identified only 3 (3.7%), 17 (21%), and 4 (4.9%), respectively, of the S. agalactiae isolates.
Discussion The present study showed that all isolates tested by the in MIC method (CLSI, 2013) against 15 antibiotics demonstrated the existence of a variable and broad antimicrobial resistance profile among local Streptococcus. Overall, the total isolates had a high frequency of phenotypic resistance to b-lactams, along with tetracycline and erythromycin. Streptococcus agalactiae was the main pathogenic bacteria and resistance of strain also was high. Decreased susceptibility to penicillin has been reported previously (Gue´rin-Fauble´e et al., 2002; Rossitto et al., 2002). In contrast to the rate of penicillin resistance (approximately 10%) reported (Nam et al., 2009), the high rate of Streptococci in the present study was resistant to penicillin in the area. b-Lactams are known as the first-line antimicrobial agents when treating streptococcal udder infections (Denamiel et al., 2005). Penicillin is the drug of choice for the treatment of both human and bovine S. agalactiae infections (Keefe, 1997). The mixture of penicillin–streptomycin was used to treat bovine disease in the dairy farm, which increased the development of penicillin resistance. This does not mean that penicillin-resistant
Pharmaceutical Biology Downloaded from informahealthcare.com by Kainan University on 04/14/15 For personal use only.
DOI: 10.3109/13880209.2015.1025290
Streptococcus would fail therapy with penicillin as the interpretive criteria are based on human data and may not accurately reflect the efficacy of penicillin for treating streptococcal mastitis (Watts & Yancey, 1994). Tetracycline and erythromycin had been always used for the treatment of several infections in cattle for many years. Resistance to tetracycline is the most common antibiotic resistance found in nature and is usually mediated either by active efflux of tetracycline from the cell or by ribosomal protection from the action of tetracycline. All tetracycline-resistant isolates carried at least one tet gene. In the present study, resistance prevalence of tetM (93.0%), tetO (7.0%), tetL (98.6%), and tetK (42.3%) genes in the tetracycline-resistant isolates was similar to those found by Gao et al. (2012). Roberts (1996) reported evidence of tetracycline resistance in Streptococci and Enterococci: efflux by proton antiporters (tetL and tetK) and ribosome protection (tetM, tetO, tetS, and tetT). This indicates that tetracycline resistance as both efflux pump and ribosome protection is encoded by the tetL and tetM genes. Data presented should therefore provide a good estimate of antimicrobial susceptibility of udder pathogens encountered in acute clinical mastitis in the field. In Streptococcus, two major mechanisms of resistance to erythromycin are recognized which is due to methylation of the 23 S rRNA by a methyltransferase encoded by an erm (erythromycin resistance methylase) gene, mef (macrolide efflux) gene is mediated by a proton-dependent active drug efflux system encoded. Genes ermB and mefA were detected 45.6% and 1.5% of the 68 erythromycin-resistant isolates, respectively, suggesting that erythromycin resistance methylase may be the major mechanism of resistance in the present study. Multidrug resistant (MDR) was defined as acquired nonsusceptibility to at least one agent in three or more antimicrobial categories (Magiorakos et al., 2011). Multiple resistances to three or more of seven antimicrobial agents tested were observed. Of the 81 Streptococcus isolates, 88.9% (72/81) were multiple resistant. Meanwhile, 3.7% (3/81) were resistant to seven antimicrobial agents. The previous report from Korea stated that about 65% of the isolates were resistant to two or more antimicrobial agents, and 37.6% were resistant to three or more of seven antimicrobial agents tested (Nam et al., 2009). The results suggest that the abuse of antibiotics is very serious, and resistance to many antibiotics has reached a high level, especially multiple resistance in Inner Mongolia region than Korea (Nam et al., 2009). The virulence genes examined in this study would be to possess possible association in the pathogenesis of mammary infections. Streptococcus agalactiae virulence is complex and multifactorial. Several virulence factors are involved in the adhesion to and invasion of host cells, as well as in the immune system evasion. According to Spellerberg (1999), the lmb gene (laminin binding protein) was present in the common serotypes of S. agalactiae, and it plays an important role in the adherence of S. agalactiae. The scpB gene codes for surface enzyme scpB (a C5a peptidase). C5a peptidase genes were found only in group B Streptococci, which cause impairing of neutrophil recruitment and bind fibronectin to promote bacterial invasion of epithelial cells (Beckmann et al., 2002). The bca gene codes for a-protein, a surface
Resistance and virulence of Streptococcus in mastitis
5
protein that helps the bacteria to enter the host cells. In our study, the lmb, scpB, and bca genes were discovered 21, 4.9, and 3.7% of isolates, respectively. These observations are in agreement with earlier reports, where the molecular analysis has shown that most bovine strains lack gene for the surface proteins scpB and lmb, in contrast to human isolates (Dmitriev et al., 1999; Franken et al., 2001; Shome et al., 2012). The results suggest that the S. agalactiae were either less virulent with the absence of the lmb, scpB, and bca genes or they may have an alternative mechanism for the cellular adhesion and invasion. Recent studies indicate that several systems involved in nutrition and metabolism, especially glutamine metabolism (glnA), are important in the virulence of various bacterial pathogens (Hendriksen et al., 2008). Si et al. (2009) data also showed that glnA were definitely important for the virulence of Streptococcus suis serotype. The cyl gene codes for b-hemolysin, a toxin that plays a role in tissue injury and the systemic spread of the bacteria and contributes to meningitis (Doran et al., 2003). In the present study, 48.1% isolates had the cyl gene. Spellerberg et al. (2000) observed that 23% isolates were positive for the cyl, while Bergseng et al. (2007) found 34.3% positivity. The hylB gene codes group B Streptococcal hyaluronate lyase which cleaves hyaluronic acid, a component of extracellular matrix, to N-acetylglucosamine and glucuronic acid. Hyaluronate lyase produced by various bacteria has traditionally been regarded as a spreading factor that contributes to the host tissueinvasive properties of bacterial pathogens (Duran-Reynals, 1942). According to the studies of Gu¨nther et al. (1996), 72% of the GBS investigated were hylB positive, the result was similar with our data. The CAMP factor (cfb) is a 23.5 kDa ceramide-binding protein of S. agalactiae, the lethal properties of the CAMP factor for cell cultures and for rabbits and mice suggest that it may have a cytotoxic action for mammary tissue (Jain et al., 2012). The cfb gene was discovered at 50.6%; in contrast, Shome et al. (2012) reported that the CAMP factor (cfb) was found to be 85.7%, which suggested that the release of CAMP factor during systemic infections could impair the host immune response (Gase et al., 1999). The role of CAMP factor in pathogenicity is unclear, although it cannot be ruled out as a putative virulence factor (Lasagno et al., 2011). The ability to attach to the host cell surface has been considered as an important virulence strategy in many bovine mammary gland pathogens. The expression of these genes is higher than lmb, scpB, and bca, which might play an important role for the virulence of S. agalactiae pathogens, as was found here. In conclusion, the study showed a high occurrence of multidrug resistant Streptococcus isolated from mastitis within Inner Mongolia. Strains of resistant to penicillin, which are to be within and between herds and thereby in combination with prudent use of antimicrobials milked separately if bacteriological cure is not attained, preventing spread of Streptococcus probably, also counteract an increase in the prevalence of penicillin resistance. Virulence-related factors may play an important role in the development or persistence of mastitis. Our study highlights the need for prudent use of antimicrobial agents in veterinary clinical medicine which can avoid the increase
6
Y. Ding et al.
and dissemination of antimicrobial resistance arising from the use of antimicrobial drugs in animals; it is necessary to monitor mastitis pathogens to assess any changes in their antibiotic resistance patterns.
Declaration of interest The authors report that they have no conflicts of interest. This research was supported by the Key Project of Natural Science Fund (2009zd04) of Inner Mongolia autonomous region of China.
Pharmaceutical Biology Downloaded from informahealthcare.com by Kainan University on 04/14/15 For personal use only.
References Altschul SF, Gish W, Miller W, et al. (1990). Basic local alignment search tool. J Mol Biol 215:403–10. Beckmann C, Waggoner JD, Harris TO, et al. (2002). Identification of novel adhesins from group B Streptococci by use of phage display reveals that c5a peptidase mediates fibronectin binding. Infect Immun 70:2869–76. Bergseng H, Bevanger L, Rygg M, et al. (2007). Real-time PCR targeting the sip gene for detection of group B streptococcus colonization in pregnant women at delivery. J Med Microbiol 56:223–8. Charpentier E, Tuomanen E. (2000). Mechanisms of antibiotic resistance and tolerance in Streptococcus pneumoniae. Microbes Infect 2: 1855–64. Clinical and Laboratory Standards Institute (CLSI). (2013). Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Third Informational Supplement. CLSI document M100-S23. Wayne (PA): Clinical and Laboratory Standards Institute. Denamiel G, Llorente P, Carabella M, et al. (2005). Antimicrobial susceptibility of Streptococcus spp. isolated from bovine mastitis in Argentina. J Vet Med B 52:125–8. Dmitriev A, Hu YY, Shen AD, et al. (1999). Comparative genetic study of group B Streptococcus strains if human and bovine origin. Folia Microbiol (Praha) 44:449–53. Dmitriev A, Shakleina E, Tkacikova L, et al. (2002). Genetic heterogeneity of the pathogenic potentials of human and bovine group B Streptococci. Folia Microbiol 47:291–5. Doran KS, Liu GY, Nizet V. (2003). Group B Streptococcal betahemolysin/cytolysin activates neutrophil signaling pathways in brain endothelium and contributes to development of meningitis. J Clin Invest 112:736–44. Duran-Reynals F. (1942). Tissue permeability and spreading factors in infection. Bacteriol Rev 6:197–252. Facklam R. (2002). What happened to the Streptococci: Overview of taxonomic and nomenclature changes. Clin Microbiol Rev 15:613–30. Franken C, Haase G, Brandt C, et al. (2001). Horizontal gene transfer and host specificity of beta-haemolytic Streptococci: The role of a putative composite transposon containing scpB and lmb. Mol Microbiol 41:925–35. Gao J, Yu FQ, Luo LP, et al. (2012). Antibiotic resistance of Streptococcus agalactiae from cows with mastitis. Vet J 194:423–4. Gase K, Ferretti JJ, Primeaux C, et al. (1999). Identification, cloning, and expression of the CAMP factor gene (cfa) of Group A Streptococci. Infect Immun 67:4725–31. Gue´rin-Fauble´e V, Tardy F, Bouveron C, et al. (2002). Antimicrobial susceptibility of Streptococcus species isolated from clinical mastitis in dairy cows. Int J Antimicrob Agents 19:219–26.
Pharm Biol, Early Online: 1–6
Gu¨nther E, Ozegowski JH, Ko¨hler W. (1996). Occurrence of extracellular hyaluronic acid and hyaluronatlyase in Streptococci of groups A, B, C and G. Zentralbl Bakteriol 285:64–73. Hendriksen WT, Kloosterman TG, Bootsma HJ, et al. (2008). Sitespecific contributions of glutamine-dependent regulator GlnR and GlnR-regulated genes to virulence of Streptococcus pneumoniae. Infect Immun 76:1230–8. Hoshino T, Fujiwara T, Kilian M. (2005). Use of phylogenetic and phenotypic analyses to identify nonhemolytic Streptococci isolated from bacteremic patients. J Clin Microbiol 43:6073–85. Jain B, Tewari A, Bhandari BB, et al. (2012). Antibiotic resistance and virulence genes in Streptococcus agalactiae isolated from cases of bovine subclinical mastitis. Vet Arhiv 82:423–32. Keefe GP. (1997). Streptococcus agalactiae mastitis: A review. Can Vet J 38:429–37. Lasagno MC, Reinoso EB, Dieser SA, et al. (2011). Phenotypic and genotypic characterization of Streptococcus uberis isolated from bovine sub-clinical mastitis in Argentinean dairy farms. Rev Argent Microbiol 43:212–17. Lopardo HA, Vidal P, Jeric P, et al. (2003). Six-month multicenter study on invasive infections due to group B Streptococci in Argentina. J Clin Microbiol 41:4688–94. Magiorakos AP, Srinivasan A, Carey RB, et al. (2011). Multidrugresistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect 18:268–81. Marimo´n JM, Valiente A, Ercibengoa M, et al. (2005). Erythromycin resistance and genetic elements carrying macrolide efflux genes in Streptococcus agalactiae. Antimicrob Agents Chemother 49:5069–74. Nam HM, Lim SK, Kang HM, et al. (2009). Antimicrobial resistance of Streptococci isolated from mastitic bovine milk samples in Korea. J Vet Diagn Invest 21:698–701. Poyart C, Jardy L, Quesne G, et al. (2003). Genetic basis of antibiotic resistance in Streptococcus agalactiae strains isolated in a French hospital. Antimicrob Agents Chemother 47:794–7. Roberts MC. (1996). Tetracycline resistance determinants: Mechanisms of action, regulation of expression, genetic mobility, and distribution. FEMS Microbiol Rev 19:1–24. Rossitto PV, Ruiz L, Kikuchi Y, et al. (2002). Antibiotic susceptibility patterns for environmental Streptococci isolated from bovine mastitis in central California dairies. J Dairy Sci 85:132–8. Sheldon IM, Bushnell M, Montgomery J, et al. (2004). Minimum inhibitory concentrations of some antimicrobial drugs against bacteria causing uterine infections in cattle. Vet Rec 155:383–7. Shome BR, Bhuvana M, Mitra SD, et al. (2012). Molecular characterization of Streptococcus agalactiae and Streptococcus uberis isolates from bovine milk. Trop Anim Health Prod 44:1981–92. Si Y, Yuan F, Chang H, et al. (2009). Contribution of glutamine synthetase to the virulence of Streptococcus suis serotype 2. Vet Microbiol 139:80–8. Spellerberg B, Rozdzinski E, Martin S, et al. (1999). Lmb, a protein with similarities to the LraI adhesin family, mediates attachment of Streptococcus agalactiae to human laminin. Infect Immun 67:871–8. Spellerberg B, Martin S, Brandt C, et al. (2000). The cyl genes of Streptococcus agalactiae are involved in the production of pigment. FEMS Microbiol Lett 188:125–8. Watts JL, Yancey Jr RJ. (1994). Identification of veterinary pathogens by use of commercial identification systems and new trends in antimicrobial susceptibility testing of veterinary pathogens. Clin Microbiol Rev 7:346–56.
