Journal of Biotechnology 168 (2013) 362–366
Contents lists available at ScienceDirect
Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec
Aptamer modification improves the adenoviral transduction of malignant glioma cells Hao Chen a , Xiaojing Zheng a , BingYan Di a , Dongyang Wang a , Yaling Zhang a , Haibin Xia a,∗ , Qinwen Mao b a b
Laboratory of Gene Therapy, Department of Biochemistry, College of Life Sciences, Shaanxi Normal University, Xi’an 710062, Shaanxi, PR China Department of Pathology, Northwestern University Feinberg School of Medicine, Chicago, IL 60611, USA
a r t i c l e
i n f o
Article history: Received 31 July 2013 Received in revised form 6 October 2013 Accepted 14 October 2013 Available online 25 October 2013 Keywords: Adenovirus Hexon Biotin acceptor peptide (BAP) Aptamer Targeted tumor therapy
a b s t r a c t Adenovirus has shown increasing promise in the gene-viral therapy for glioblastoma, a treatment strategy that relies on the delivery of viruses or transgenes into tumor cells. However, targeting of adenovirus to human glioblastoma remains a challenge due to the low expression level of coxsackie and adenovirus receptor (CAR) in glioma cells. Aptamers are small and highly structured single-stranded oligonucleotides that bind at high affinity to a target molecule, and are good candidates for targeted imaging and therapy. In this study, to construct an aptamer-modified Ad5, we first genetically modified the HVR5 of Ad hexon by biotin acceptor peptide (BAP), which would be metabolically biotinylated during production in HEK293 cells, and then attached the biotin labeled aptamer to the modified Ad through avidin–biotin binding. The aptamers used in this study includes AS1411 and GBI-10. The former is a DNA aptamer that can bind to nucleolin, a nuclear matrix protein found on the surface of cancer cells. The latter is a DNA aptamer that can recognize the extracellular matrix protein tenascin-C on the surface of human glioblastoma cells. To examine if aptamer-modification of the hexon protein could improve the adenoviral transduction efficiency, a glioblastoma cell line, U251, was transduced with aptamer-modified Ads. The transduction efficiency of AS1411- or GBI-10-modified Ad was approximately 4.1-fold or 5.2-fold higher than that of the control. The data indicated that aptamer modified adenovirus would be a useful tool for cancer gene therapy. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Glioblastoma (GB) is the most common and most aggressive malignant primary brain tumor in humans. The current standard of care for newly diagnosed GB is surgical resection, radiotherapy, and chemotherapy. Despite many advances, the 5-year survival rate of GB patients is less than 5% (Thomas et al., 2013). Consequently, there is a substantial need for the development of novel, effective approaches to GB therapy to increase patients’ survival (Murphy and Rabkin, 2013). Targeting molecular pathways underlying carcinogenesis may provide alternative or additional approaches to glioma treatment. Viruses, particularly adenoviruses have been engineered to function as vectors for delivering therapeutic genes for gene therapy, and as direct cytotoxic agents for oncolytic viral therapy (Pedersini et al., 2010). Adenovirus serotype-5 (Ad5), the most commonly used vector, infects human cells using the coxsackie and adenovirus receptor (CAR) (Bergelson et al., 1997; Nabel, 1999; Tomko et al.,
∗ Corresponding author. Tel.: +86 29 85310272; fax: +86 29 85310272. E-mail address: [email protected] (H. Xia). 0168-1656/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jbiotec.2013.10.024
1997). The entry of an Ad5 into tumor cells is, however, complicated by the reduction or total absence of CAR in glioblastoma (Kim et al., 2003). Targeting the adenovirus to human tumors, therefore, remains a challenge. To improve the targeting efficiency of Ad5 to glioblastoma, transductional retargeting strategies have been utilized. One strategy uses heterologous retargeting ligands that are bispecific by binding both to the viral vector as well as to a cell surface target (Gao et al., 2007; Israel et al., 2001; Kashentseva et al., 2002; Li et al., 2007; Suzuki-Kouyama et al., 2011; Wortmann et al., 2008; Yao et al., 2009). A second strategy uses genetically modified viral vectors in which a cellular retargeting ligand is incorporated (Crompton et al., 1994; Einfeld et al., 1999; Jullienne et al., 2009; Kurachi et al., 2007; Lenaerts et al., 2012; Liu et al., 2009). Aptamers are small and highly structured single-stranded oligonucleotides that bind at high affinity (within the low nanomolar range) to a target molecule. They are essentially a chemical equivalent of antibodies but with low molecular weights, lack of immunogenicity comparing to monoclonal antibodies (mAbs), and readily availability (Cerchia et al., 2002, 2009; Cerchia and De Franciscis, 2007; Ni et al., 2011; Tuerk and Gold, 1990; Wilson and Szostak, 1999). Aptamers are good candidates for targeted
H. Chen et al. / Journal of Biotechnology 168 (2013) 362–366
imaging and therapy. Various aptamers have been developed against a variety of cancer targets via systematic evolution of ligands by exponential enrichment (SELEX) (Cerchia et al., 2009; Stoltenburg et al., 2007), including extracellular ligands and cell surface proteins (Barbas et al., 2010). AS1411 is a 26 nt G-rich DNA aptamer considered to be the first anticancer aptamer. AS1411 targets nucleolin, a nuclear matrix protein found on the surface of cancer cells (Guo et al., 2011; Hovanessian et al., 2010; Ni et al., 2011). GBI-10 is a DNA aptamer that can recognize the extracellular matrix protein tenascin-C on the surface of human glioblastoma cells (Daniels et al., 2003). In this study, to improve the targeting ability of Ad5 by an aptamer, we genetically modified the HVR5 of Ad hexon by biotin acceptor peptide (BAP), which would be metabolically biotinylated during production in HEK293 cells, and then attached the biotin labeled aptamer, AS1411 or GBI-10, to the modified Ad through avidin–biotin binding. The resultant aptamer-modified Ad showed improved transduction efficiency for glioblastoma cell line.
2. Materials and methods 2.1. Cells and cell culture HEK 293, human embryonic kidney cell line and U251, human glioblastoma cell line were both purchased from ATCC (Manassas, VA), and cultured in 10% DMEM (high glucose) containing 10% newborn calf serum at 37 ◦ C in a 5% CO2 atmosphere. HUVEC (human umbilical vein endothelial cells) were isolated from human umbilical veins, and cultured in DMEM with 10% (v/v) FBS, 75 g/ml ECGs (Sigma, St. Louis, MO) and 5U/ml Heparin Sodium (Sigma, St. Louis, MO) at 37 ◦ C in a 5% CO2 atmosphere.
2.2. Plasmid construction The biotin acceptor peptide (BAP) with the length of 77 AA (Campos et al., 2004) was synthesized from Sangon Biotech Co. (Shanghai, China), which was flanked by BamHI and SfuI restriction sites at the 5-terminal and 3-terminal, respectively. The sequence of the BAP was as follow: 5 -GGATCCGGCGGATCTGGAGAGGGCGAGATTCCCGCTCCGCTGGCCGGCACC GTCTCCAAGATCCTCGTGAAGGAGGGTGACACGGTCAAGGCTGGTCAGACCGTGCTCGTTCTCGAGGCCATGAAGATGGAGACCGAGATCAACGCTCCCACCGACGGCAAGGTCGAGAAGGTCCTGGTCAAGGAGCGTGACGCGGTGCAGGGCGGTCAGGGTCTCATCAAGATCGGGGGCGGATCTTTCGAA-3 . Then BamHI and SfuI restricted BAP fragment was inserted into the hexon protein HVR5 region of pRGHMAd5 digested by BamHI-SfuI (Di et al., 2012). pRGHMAd5 carried an luciferase expression cassette in the E1 deletion region under the control of CMV promoter. The obtained plasmid was named pRGHMAd5-BAP, which was confirmed by enzyme digestion and DNA sequencing.
2.3. Virus production Recombinant virus modified with BAP peptide in the hypervariable region (HVR) five of hexon was produced by transfecting PacI-linearized vector pRGHMAd5-BAP into HEK-293 cells grown in 60 mm-diameter dishes. Ten days after transfection, the viral lysates were harvested and further propagated in HEK 293 cells and were purified by cesium chloride gradient methods (Anderson et al., 2000). The resultant adenovirus was named Ad5-Hexon-BAP. The titers of the virus particle were detected by spectrophotometry at an absorbance (A) of 260 nm.
363
2.4. Western blot Ad5-Hexon-BAP vector (1 × 106 VP, 1 × 107 VP, 1 × 108 VP) and Ad5 wild type (Ad5 wt) vector (1 × 107 VP, 1 × 108 VP) as a negative control was heated for 5 min at 95 ◦ C in 1 × sample buffer containing 4% -mercaptoethanol, and then the samples were separated on a 7.5% SDS-PAGE gel, followed by electrotransfer to a PVDF (polyvinylidene difluoride) membrane. After blocking with 5% skimmed milk-PBST, the membrane was incubated with horseradish peroxidase (HRP)-conjugated streptavidin (1:500) overnight at 4 ◦ C. After washing, the membrane was reacted with enhanced chemiluminescence (ECL). 2.5. Conjunction of adenovirus with aptamer For conjugation of Ad5-Hexon-BAP with aptamer, Ad5-HexonBAP was incubated with avidin (Sigma, St. Louis, MO) and 5 -biotin-aptamer, AS1411(Guo et al., 2011; Hovanessian et al., 2010), GBI-10 (Daniels et al., 2003) and random aptamer as a negative control: 5 -CAAAGTAGCGTGCACTTTTG-3 , (Sangon Biotech Co., Shanghai, China) at a molar ratio of 1:1:3 (biotinylated hexon: avidin: 5 -biotin-aptamer) for 20 min at room-temperature. The obtained adenoviruses were named Ad5-Hexon-BAP-AS1411, Ad5Hexon-BAP-GBI-10 and Ad5-Hexon-BAP-NC, respectively. 2.6. Luciferase activity assay U251 cells and a non-cancer cell control HUVEC were plated into 24-well plates until the cell density reached 70%. Then the virus Ad5-Hexon-BAP, Ad5-Hexon-BAP-AS1411, Ad5-Hexon-BAPGBI-10, and Ad5-Hexon-BAP-NC were respectively added into the U251 cells or HUVEC cells at the dosage of 0.5 MOI (multiplicity of infection) for each virus. Four hours later, the cells were cultured in fresh medium. The cells were collected then for luciferase activity assay 48 h post transfection using Luciferase Assay Reagent (Promega, Madison, WI). 3. Results 3.1. Generation of aptamer-modified adenovirus We first produced an Ad5 biotinylated in the hexon HVR5 region, which was then modified by aptamer through avidin–biotin binding. We utilized our previously constructed shuttle vector pRGHMAd5 (Di et al., 2012), which contains a lacZ expression cassette in the hexon HVR5 region and a luciferase expression cassette driven by the CMV promoter in E1 region (Fig. 1), to incorporate biotin acceptor peptide (BAP) into the HVR5 of the Ad5 hexon. The BAP DNA sequence was ligated to the BamH1 and Sful digested pRGHMAd5. The obtained plasmid, named pRGHMAd5-BAP (Fig. 1), was confirmed by the restriction endonuclease analysis and DNA sequencing. Then, adenovirus with BAP modified-hexon was successfully generated by transfecting PacI-linearized pRGHMAd5-BAP into HEK293 cells. The obtained virus was named Ad5-Hexon-BAP. The packaging of the virus was seemingly not affected by this modification and the virus was produced with a titer of 2.8 × 1012 viral particles/ml. To examine the biotinylation of Ad5-HexonBAP, we denatured CsCl-purified virons in SDS and ran them on a polyacrylamide gel. We blotted separated proteins onto PVDF membranes and detected them with HRP-conjugated streptavidin, which revealed a single band of 98.32-kD hexon-BAP fusion protein (Fig. 2). These results indicated that the hexon of Ad5-Hexon-BAP was metabolically biotinylated during production in HEK293 cells, consistent with the previous observation (Campos et al., 2004).
364
H. Chen et al. / Journal of Biotechnology 168 (2013) 362–366
Fig. 1. Diagram of the scheme used to construct the hexon-modified adenovirus vector. pRGHMAd5 virus vector, which contains a lacZ expression cassette in the hexon HVR5 region and a luciferase expression cassette driven by the CMV promoter in E1 region, was digested by BamHI and SfuI and ligated with DNA sequence corresponding to the BAP, resulting in pRGHMAd5-BAP.
To modify the Ad5 with aptamer, Ad5-Hexon-BAP was mixed with avidin and 5 -biotin labeled aptamers. Aptamers used include AS1411, GBI-10 or random aptamer as a negative control (NC). Since avidin has a tetrameric structure with four biotin-binding sites (Reche, 2000), the biotinlylated Ad5-Hexon-BAP was allowed to specifically bind with 5 -biotin labeled aptamer via avidin–biotin interaction. The mixing molar ratio of biotinylated hexon, avidin, and 5 -biotin-aptamer (AS1411, GBI-10 or control) was about 1:1:3 to ensure that as much aptamer as possible be attached to the hexon. The three modified adenoviruses were named as Ad5-Hexon-BAP-AS1411, Ad5-Hexon-BAP-GBI-10, and Ad5Hexon-BAP-NC, respectively. 3.2. Improved transduction efficiency of aptamer-modified Ad5 in U251 cell line To examine if aptamer-modification of the hexon protein can improve the transduction efficiency of the Ad vector, a human glioblastoma cell line U251 and a non-cancer cell line HUVEC were transduced with Ad5-Hexon-BAP-AS1411 or Ad5-Hexon-BAP-GBI10 at an MOI of 0.5. The transduction efficiency of the AS1411- or GBI-10- modified Ad5, which was measured as luciferase activity,
Fig. 3. In vitro transduction efficiency of aptamer-modified Ad5 measured by luciferase activity. U251 cells and a non-cancer cell line HUVEC were infected with Ad5-Hexon-BAP-AS1411, Ad5-Hexon-BAP-GBI-10, and controls at the dosage of 0.5 MOI (multiplicity of infection) for each virus. Forty-eight hours later, the luciferase activity in the cell lysate was measured as relative light units (RLU). * indicating P < 0.05 that shows significantly different between experimental group and control group analyzed by LSD’ One-way ANOVA comparison. The NC indicating random aptamer as a negative control.
was approximately 4.1-fold or 5.2-fold higher than those of the control viruses (P < 0.05) (Fig. 3). However, in the non-cancer cell line HUVEC, there was no significant difference between the transduction efficiency of AS1411- or GBI-10- modified Ad5 and that of the control viruses (Fig. 3). The data indicated that aptamer AS1411 or GBI-10 modification could significantly increase the transduction efficiency of Ad5 in glioblastoma cell line U251 specifically. 4. Discussion
Fig. 2. Western blot for evaluation of the biotinylation of Ad5-Hexon-BAP. The different concentration of Ad5-Hexon-BAP viral particles (VP) was separated on 7.5% SDS-PAGE gel and biotinylated hexon was subsequently detected by streptavidinHRP. Wild-type Ad5 (Ad5 wt) vector was included as a negative control. The arrow indicates the band corresponding to the hexon-BAP.
In this study, to improve the tumor-targeting ability of Ad5 by using an aptamer, we genetically modified the HVR5 of Ad hexon by biotin acceptor peptide (BAP), which would be metabolically biotinylated during production in HEK293 cells, followed by binding the modified Ads with biotin-labeled aptamer AS1411 or GBI-10 through avidin–biotin interaction. The resultant aptamer-modified Ads showed significantly improved transduction efficiency for malignant glioma cells. Adenovirus has been the most commonly used vector for geneviral therapy against glioblastoma because of its high titers, high transduction efficiency, and high safety profiles. However, the entry of an adenovirus into tumor cells is complicated by the reduction
H. Chen et al. / Journal of Biotechnology 168 (2013) 362–366
or total absence of CAR, the high-affinity receptor for Ad fiber protein (Nabel, 1999; Bergelson et al., 1997; Tomko et al., 1997), in glioblastoma cells (Kim et al., 2003). Genetic modification of Ad capsid protein (Kurachi et al., 2007; Di et al., 2012; Wang et al., 2011; Nandi and Lesniak, 2009) has been taken to overcome resistance of tumor cells to infection by Ad5. For example, incorporation of the Arg-Gly-Asp (RGD) motif into the Ad fiber knob in order to bind ␣v3 and ␣v5 integrins expressed on tumor cells demonstrated an increase in gene transfer to ovarian cancer cells of 2 to 3 orders of magnitude (Dmitriev et al., 1998). The addition of the RGD moiety to the CRAd, Ad24, also enhanced the viral cellular toxicity by at least 10% to a maximum of 70% (Lamfers et al., 2002). Our previous work demonstrated that the modification of Ad5 by insertion of NGR, RGD or Tat PTD peptides into hexon HVR5 resulted in 2–5 fold increase in the transduction efficiency in A172 and CHOK1 cells (Di et al., 2012). Despite promising results, the approach of genetic modification of Ad capsid protein to improve tumor targeting has disadvantages, such as, leading to poorly growing viruses (Wu et al., 2005) and being less versatile, i.e., one modification only for one target. An alternative strategy is the use of heterologous retargeting ligands that are bispecific by binding both to the viral vector as well as to a cell surface target (Gao et al., 2007; Suzuki-Kouyama et al., 2011; Wortmann et al., 2008; Yao et al., 2009; Li et al., 2007; Kashentseva et al., 2002; Israel et al., 2001). Successful strategies include anti-capsid antibody fragments or soluble CAR fragments fused to a diverse set of ligands including antibody fragments against a variety of cellular receptors, growth factors like the basic fibroblast growth factor (FGF-2) and epidermal growth factor (EGF), and even small molecule ligands like folate (Barnett et al., 2002; Glasgow et al., 2006). The adaptor molecules rely on non-covalent protein–protein interactions for their conjugation to the Ad capsid, which are generally considered too weak to work in vivo. Naturally occurring antibodies or CAR receptors could compete for Ad binding and displace the molecular adaptors from the capsid, abolishing the vector targeting activity. In this study, to improve the Ad targeting, we utilized a combinatorial approach that involves aptamer and genetically modified Ad. Aptamers, oligonucleic acid or peptide molecules that bind to a specific target molecule, are good candidates for targeted therapy because of their low molecular weights, lack of immunogenicity, and readily availability. Aptamer has been used for mediating Antibody-dependent cellular cytotoxicity (ADCC) (Boltz et al., 2011), inhibiting protein–protein interaction, and mediating siRNA and nanoparticles delivery into the cells (Di Giusto et al., 2006; McNamara et al., 2008; Neff et al., 2011). To the best of our knowledge, aptamer-mediated adenoviral targeting to CARdeficient tumor cells has not been reported. One of the aptamers used in this study, AS1411, is a 26 nt G-rich DNA aptamer and considered to be the first anticancer aptamer. AS1411 targets nucleolin, a nuclear matrix protein which can be found on the surface of cancer cells. AS1411 is currently in Phase II clinical trials for acute myeloid leukemia by Antisoma Research (Ni et al., 2011). GBI-10, another aptamer used in this study, is a DNA aptamer that can recognize the extracellular matrix protein tenascin-C on the surface of human glioblastoma cells (Daniels et al., 2003). To bind an aptamer to the Ad vector in a hexon-specific manner via avidin–biotin interaction, we incorporated BAP peptide into the HVR5 region of the hexon loop. The latter seems appropriate as a site for insertion of foreign peptides because Hexon is not involved in the binding of Ad vector to the primary receptor CAR. In addition, the HVR5 allows insertion of foreign peptides without affecting the function of Ad as a gene transfer vector (Kurachi et al., 2007; Vigne et al., 1999). Our previously constructed shuttle vector pRGHMAd5, which contains a lacZ expression cassette in the hexon HVR5 region (Di et al., 2012), made the job of constructing a BAP-modified
365
Ad painless. As expected, a BAP-modified Ad was produced successfully with a high titer, and metabolically biotinylated during production in HEK293 cell (Campos et al., 2004). In addition to Ad hexon, the fiber knob of Ad is probably another region suitable for this modification (Liu et al., 2009; Wang et al., 2011). Compared with the other approaches to improving Ad tumor targeting, the strategy described in this paper is simple, low-cost, effective, and versatile. Compared with bispecific antibodies, which have also been used to mediate the adenovirus targeting to the tumor cells (Li et al., 2007; Kashentseva et al., 2002; Israel et al., 2001), aptamers will be equally effective, if not more, but much easier to produce. This approach is versatile, for example, a BAPmodified Ad can be further modified by different biotin-labeled aptamers, or even other types of ligands, with tropisims to different targets. In conclusions, we developed an aptamer-modified Ad vector by inserting the BAP into the Ad hexon HVR5 region, and then binding the biotinylated Ad with aptamer through avidin–biotin interaction. The aptamer modified Ad revealed significantly enhanced transduction efficiency for target cells in vitro. This strategy may be of great utility for treatment of neoplasms characterized by deficiency of the primary Ad type 5 receptor.
Acknowledgments This work was supported by the “Foundation for Excellent Doctor Degree Dissertation” (X2011YB09) of Shaanxi Normal University, the Fundamental Research Funds for the Central Universities (GK201301010) and research grants to H.X. and X.Z. from the National Natural Science Foundation of China (Nos. 81272543, 31070137 and 81301957).
References Anderson, R.D., Haskell, R.E., Xia, H., Roessler, B.J., Davidson, B.L., 2000. A simple method for the rapid generation of recombinant adenovirus vectors. Gene Ther. 7, 1034–1038. Barbas, A.S., Mi, J., Clary, B.M., White, R.R., 2010. Aptamer applications for targeted cancer therapy. Future Oncol. 6, 1117–1126. Barnett, B.G., Crews, C.J., Douglas, J.T., 2002. Targeted adenoviral vectors. Biochim. Biophys. Acta 1575, 1–14. Bergelson, J.M., Cunningham, J.A., Droguett, G., Kurt-Jones, E.A., Krithivas, A., Hong, J.S., Horwitz, M.S., Crowell, R.L., Finberg, R.W., 1997. Isolation of a common receptor for Coxsackie B viruses and adenoviruses 2 and 5. Science 275, 1320–1323. Boltz, A., Piater, B., Toleikis, L., Guenther, R., Kolmar, H., Hock, B., 2011. Bi-specific aptamers mediating tumor cell lysis. J. Biol. Chem. 286, 21896–21905. Campos, S.K., Parrott, M.B., Barry, M.A., 2004. Avidin-based targeting and purification of a protein IX-modified, metabolically biotinylated adenoviral vector. Mol. Ther. 9, 942–954. Cerchia, L., De Franciscis, V., 2007. Nucleic acid-based aptamers as promising therapeutics in neoplastic diseases. Methods Mol. Biol. 361, 187–200. Cerchia, L., Esposito, C.L., Jacobs, A.H., Tavitian, B., De Franciscis, V., 2009. Differential SELEX in human glioma cell lines. PLoS One 4, e7971. Cerchia, L., Hamm, J., Libri, D., Tavitian, B., De Franciscis, V., 2002. Nucleic acid aptamers in cancer medicine. FEBS Lett. 528, 12–16. Crompton, J., Toogood, C.I., Wallis, N., Hay, R.T., 1994. Expression of a foreign epitope on the surface of the adenovirus hexon. J. Gen. Virol. 75 (Pt 1), 133–139. Daniels, D.A., Chen, H., Hicke, B.J., Swiderek, K.M., Gold, L., 2003. A tenascin-C aptamer identified by tumor cell SELEX: systematic evolution of ligands by exponential enrichment. Proc. Natl. Acad. Sci. U S A 100, 15416–15421. Di, B., Mao, Q., Zhao, J., Li, X., Wang, D., Xia, H., 2012. A rapid generation of adenovirus vector with a genetic modification in hexon protein. J. Biotechnol. 157, 373–378. Di Giusto, D.A., Knox, S.M., Lai, Y., Tyrelle, G.D., Aung, M.T., King, G.C., 2006. Multitasking by multivalent circular DNA aptamers. Chembiochem 7, 535–544. Dmitriev, I., Krasnykh, V., Miller, C.R., Wang, M., Kashentseva, E., Mikheeva, G., Belousova, N., Curiel, D.T., 1998. An adenovirus vector with genetically modified fibers demonstrates expanded tropism via utilization of a coxsackievirus and adenovirus receptor-independent cell entry mechanism. J. Virol. 72, 9706–9713. Einfeld, D.A., Brough, D.E., Roelvink, P.W., Kovesdi, I., Wickham, T.J., 1999. Construction of a pseudoreceptor that mediates transduction by adenoviruses expressing a ligand in fiber or penton base. J. Virol. 73, 9130–91366. Gao, J.Q., Eto, Y., Yoshioka, Y., Sekiguchi, F., Kurachi, S., Morishige, T., Yao, X., Watanabe, H., Asavatanabodee, R., Sakurai, F., Mizuguchi, H., Okada, Y., Mukai, Y., Tsutsumi, Y., Mayumi, T., Okada, N., Nakagawa, S., 2007. Effective tumor targeted
366
H. Chen et al. / Journal of Biotechnology 168 (2013) 362–366
gene transfer using PEGylated adenovirus vector via systemic administration. J. Control. Release 122, 102–110. Glasgow, J.N., Everts, M., Curiel, D.T., 2006. Transductional targeting of adenovirus vectors for gene therapy. Cancer Gene Ther. 13, 830–844. Guo, J., Gao, X., Su, L., Xia, H., Gu, G., Pang, Z., Jiang, X., Yao, L., Chen, J., Chen, H., 2011. Aptamer-functionalized PEG-PLGA nanoparticles for enhanced anti-glioma drug delivery. Biomaterials 32, 8010–8020. Hovanessian, A.G., Soundaramourty, C., El Khoury, D., Nondier, I., Svab, J., Krust, B., 2010. Surface expressed nucleolin is constantly induced in tumor cells to mediate calcium-dependent ligand internalization. PLoS One 5, e15787. Israel, B.F., Pickles, R.J., Segal, D.M., Gerard, R.D., Kenney, S.C., 2001. Enhancement of adenovirus vector entry into CD70-positive B-cell Lines by using a bispecific CD70-adenovirus fiber antibody. J. Virol. 75, 5215–5221. Jullienne, B., Vigant, F., Muth, E., Chaligne, R., Bouquet, C., Giraudier, S., Perricaudet, M., Benihoud, K., 2009. Efficient delivery of angiostatin K1-5 into tumors following insertion of an NGR peptide into adenovirus capsid. Gene Ther. 16, 1405–1415. Kashentseva, E.A., Seki, T., Curiel, D.T., Dmitriev, I.P., 2002. Adenovirus targeting to c-erbB-2 oncoprotein by single-chain antibody fused to trimeric form of adenovirus receptor ectodomain. Cancer Res. 62, 609–616. Kim, M., Sumerel, L.A., Belousova, N., Lyons, G.R., Carey, D.E., Krasnykh, V., Douglas, J.T., 2003. The coxsackievirus and adenovirus receptor acts as a tumour suppressor in malignant glioma cells. Br. J. Cancer. 88, 1411–1416. Kurachi, S., Koizumi, N., Sakurai, F., Kawabata, K., Sakurai, H., Nakagawa, S., Hayakawa, T., Mizuguchi, H., 2007. Characterization of capsid-modified adenovirus vectors containing heterologous peptides in the fiber knob. Protein IX, or Hexon. Gene Ther. 14, 266–274. Lamfers, M.L., Grill, J., Dirven, C.M., Van Beusechem, V.W., Geoerger, B., Van Den Berg, J., Alemany, R., Fueyo, J., Curiel, D.T., Vassal, G., Pinedo, H.M., Vandertop, W.P., Gerritsen, W.R., 2002. Potential of the conditionally replicative adenovirus Ad5-Delta24RGD in the treatment of malignant gliomas and its enhanced effect with radiotherapy. Cancer Res. 62, 5736–5742. Lenaerts, L., Van Dam, W., Persoons, L., Naesens, L., 2012. Interaction between mouse adenovirus type 1 and cell surface heparan sulfate proteoglycans. PLoS One 7, e31454. Li, H.J., Everts, M., Pereboeva, L., Komarova, S., Idan, A., Curiel, D.T., Herschman, H.R., 2007. Adenovirus tumor targeting and hepatic untargeting by a coxsackie/adenovirus receptor ectodomain anti-carcinoembryonic antigen bispecific adapter. Cancer Res. 67, 5354–5361. Liu, S., Mao, Q., Zhang, W., Zheng, X., Bian, Y., Wang, D., Li, H., Chai, L., Zhao, J., Xia, H., 2009. Genetically modified adenoviral vector with the protein transduction domain of Tat improves gene transfer to CAR-deficient cells. Biosci. Rep. 29, 103–109. Mcnamara, J.O., Kolonias, D., Pastor, F., Mittler, R.S., Chen, L., Giangrande, P.H., Sullenger, B., Gilboa, E., 2008. Multivalent 4-1BB binding aptamers costimulate CD8+ T cells and inhibit tumor growth in mice. J. Clin. Invest. 118, 376–386.
Murphy, A.M., Rabkin, S.D., 2013. Current status of gene therapy for brain tumors. Transl. Res. 161, 339–354. Nabel, G.J., 1999. Development of optimized vectors for gene therapy. Proc. Natl. Acad. Sci. U S A 96, 324–326. Nandi, S., Lesniak, M.S., 2009. Adenoviral virotherapy for malignant brain tumors. Expert Opin. Biol. Ther. 9, 737–747. Neff, C.P., Zhou, J., Remling, L., Kuruvilla, J., Zhang, J., Li, H., Smith, D.D., Swiderski, P., Rossi, J.J., Akkina, R., 2011. An aptamer-siRNA chimera suppresses HIV-1 viral loads and protects from helper CD4(+) T cell decline in humanized mice. Sci. Transl. Med. 3, 66ra6. Ni, X., Castanares, M., Mukherjee, A., Lupold, S.E., 2011. Nucleic acid aptamers: clinical applications and promising new horizons. Curr. Med. Chem. 18, 4206–4214. Pedersini, R., Vattemi, E., Claudio, P.P., 2010. Adenoviral gene therapy in high-grade malignant glioma. Drug News Perspect. 23, 368–379. Reche, P.A., 2000. Lipoylating and biotinylating enzymes contain a homologous catalytic module. Protein Sci. 9, 1922–1929. Stoltenburg, R., Reinemann, C., Strehlitz, B., 2007. SELEX–a (r)evolutionary method to generate high-affinity nucleic acid ligands. Biomol. Eng. 24, 381–403. Suzuki-Kouyama, E., Katayama, K., Sakurai, F., Yamaguchi, T., Kurachi, S., Kawabata, K., Nakagawa, S., Mizuguchi, H., 2011. Hexon-specific PEGylated adenovirus vectors utilizing avidin-biotin interaction. Biomaterials 32, 1724–1730. Thomas, R.P., Recht, L., Nagpal, S., 2013. Advances in the management of glioblastoma: the role of temozolomide and MGMT testing. Clin. Pharmacol. 5, 1–9. Tomko, R.P., Xu, R., Philipson, L., 1997. HCAR and MCAR: the human and mouse cellular receptors for subgroup C adenoviruses and group B coxsackieviruses. Proc. Natl. Acad. Sci. U S A 94, 3352–3356. Tuerk, C., Gold, L., 1990. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249, 505–510. Vigne, E., Mahfouz, I., Dedieu, J.F., Brie, A., Perricaudet, M., Yeh, P., 1999. RGD inclusion in the hexon monomer provides adenovirus type 5-based vectors with a fiber knob-independent pathway for infection. J. Virol. 73, 5156–5161. Wang, D., Liu, S., Mao, Q., Zhao, J., Xia, H., 2011. A novel vector for a rapid generation of fiber-mutant adenovirus based on one step ligation and quick screening of positive clones. J. Biotechnol. 152, 72–76. Wilson, D.S., Szostak, J.W., 1999. In vitro selection of functional nucleic acids. Annu. Rev. Biochem. 68, 611–647. Wortmann, A., Vohringer, S., Engler, T., Corjon, S., Schirmbeck, R., Reimann, J., Kochanek, S., Kreppel, F., 2008. Fully detargeted polyethylene glycol-coated adenovirus vectors are potent genetic vaccines and escape from pre-existing anti-adenovirus antibodies. Mol. Ther. 16, 154–162. Wu, H., Han, T., Belousova, N., Krasnykh, V., Kashentseva, E., Dmitriev, I., Kataram, M., Mahasreshti, P.J., Curiel, D.T., 2005. Identification of sites in adenovirus hexon for foreign peptide incorporation. J. Virol. 79, 3382–3390. Yao, X., Yoshioka, Y., Morishige, T., Eto, Y., Watanabe, H., Okada, Y., Mizuguchi, H., Mukai, Y., Okada, N., Nakagawa, S., 2009. Systemic administration of a PEGylated adenovirus vector with a cancer-specific promoter is effective in a mouse model of metastasis. Gene Ther. 16, 1395–1404.
Contents lists available at ScienceDirect
Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec
Aptamer modification improves the adenoviral transduction of malignant glioma cells Hao Chen a , Xiaojing Zheng a , BingYan Di a , Dongyang Wang a , Yaling Zhang a , Haibin Xia a,∗ , Qinwen Mao b a b
Laboratory of Gene Therapy, Department of Biochemistry, College of Life Sciences, Shaanxi Normal University, Xi’an 710062, Shaanxi, PR China Department of Pathology, Northwestern University Feinberg School of Medicine, Chicago, IL 60611, USA
a r t i c l e
i n f o
Article history: Received 31 July 2013 Received in revised form 6 October 2013 Accepted 14 October 2013 Available online 25 October 2013 Keywords: Adenovirus Hexon Biotin acceptor peptide (BAP) Aptamer Targeted tumor therapy
a b s t r a c t Adenovirus has shown increasing promise in the gene-viral therapy for glioblastoma, a treatment strategy that relies on the delivery of viruses or transgenes into tumor cells. However, targeting of adenovirus to human glioblastoma remains a challenge due to the low expression level of coxsackie and adenovirus receptor (CAR) in glioma cells. Aptamers are small and highly structured single-stranded oligonucleotides that bind at high affinity to a target molecule, and are good candidates for targeted imaging and therapy. In this study, to construct an aptamer-modified Ad5, we first genetically modified the HVR5 of Ad hexon by biotin acceptor peptide (BAP), which would be metabolically biotinylated during production in HEK293 cells, and then attached the biotin labeled aptamer to the modified Ad through avidin–biotin binding. The aptamers used in this study includes AS1411 and GBI-10. The former is a DNA aptamer that can bind to nucleolin, a nuclear matrix protein found on the surface of cancer cells. The latter is a DNA aptamer that can recognize the extracellular matrix protein tenascin-C on the surface of human glioblastoma cells. To examine if aptamer-modification of the hexon protein could improve the adenoviral transduction efficiency, a glioblastoma cell line, U251, was transduced with aptamer-modified Ads. The transduction efficiency of AS1411- or GBI-10-modified Ad was approximately 4.1-fold or 5.2-fold higher than that of the control. The data indicated that aptamer modified adenovirus would be a useful tool for cancer gene therapy. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Glioblastoma (GB) is the most common and most aggressive malignant primary brain tumor in humans. The current standard of care for newly diagnosed GB is surgical resection, radiotherapy, and chemotherapy. Despite many advances, the 5-year survival rate of GB patients is less than 5% (Thomas et al., 2013). Consequently, there is a substantial need for the development of novel, effective approaches to GB therapy to increase patients’ survival (Murphy and Rabkin, 2013). Targeting molecular pathways underlying carcinogenesis may provide alternative or additional approaches to glioma treatment. Viruses, particularly adenoviruses have been engineered to function as vectors for delivering therapeutic genes for gene therapy, and as direct cytotoxic agents for oncolytic viral therapy (Pedersini et al., 2010). Adenovirus serotype-5 (Ad5), the most commonly used vector, infects human cells using the coxsackie and adenovirus receptor (CAR) (Bergelson et al., 1997; Nabel, 1999; Tomko et al.,
∗ Corresponding author. Tel.: +86 29 85310272; fax: +86 29 85310272. E-mail address: [email protected] (H. Xia). 0168-1656/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jbiotec.2013.10.024
1997). The entry of an Ad5 into tumor cells is, however, complicated by the reduction or total absence of CAR in glioblastoma (Kim et al., 2003). Targeting the adenovirus to human tumors, therefore, remains a challenge. To improve the targeting efficiency of Ad5 to glioblastoma, transductional retargeting strategies have been utilized. One strategy uses heterologous retargeting ligands that are bispecific by binding both to the viral vector as well as to a cell surface target (Gao et al., 2007; Israel et al., 2001; Kashentseva et al., 2002; Li et al., 2007; Suzuki-Kouyama et al., 2011; Wortmann et al., 2008; Yao et al., 2009). A second strategy uses genetically modified viral vectors in which a cellular retargeting ligand is incorporated (Crompton et al., 1994; Einfeld et al., 1999; Jullienne et al., 2009; Kurachi et al., 2007; Lenaerts et al., 2012; Liu et al., 2009). Aptamers are small and highly structured single-stranded oligonucleotides that bind at high affinity (within the low nanomolar range) to a target molecule. They are essentially a chemical equivalent of antibodies but with low molecular weights, lack of immunogenicity comparing to monoclonal antibodies (mAbs), and readily availability (Cerchia et al., 2002, 2009; Cerchia and De Franciscis, 2007; Ni et al., 2011; Tuerk and Gold, 1990; Wilson and Szostak, 1999). Aptamers are good candidates for targeted
H. Chen et al. / Journal of Biotechnology 168 (2013) 362–366
imaging and therapy. Various aptamers have been developed against a variety of cancer targets via systematic evolution of ligands by exponential enrichment (SELEX) (Cerchia et al., 2009; Stoltenburg et al., 2007), including extracellular ligands and cell surface proteins (Barbas et al., 2010). AS1411 is a 26 nt G-rich DNA aptamer considered to be the first anticancer aptamer. AS1411 targets nucleolin, a nuclear matrix protein found on the surface of cancer cells (Guo et al., 2011; Hovanessian et al., 2010; Ni et al., 2011). GBI-10 is a DNA aptamer that can recognize the extracellular matrix protein tenascin-C on the surface of human glioblastoma cells (Daniels et al., 2003). In this study, to improve the targeting ability of Ad5 by an aptamer, we genetically modified the HVR5 of Ad hexon by biotin acceptor peptide (BAP), which would be metabolically biotinylated during production in HEK293 cells, and then attached the biotin labeled aptamer, AS1411 or GBI-10, to the modified Ad through avidin–biotin binding. The resultant aptamer-modified Ad showed improved transduction efficiency for glioblastoma cell line.
2. Materials and methods 2.1. Cells and cell culture HEK 293, human embryonic kidney cell line and U251, human glioblastoma cell line were both purchased from ATCC (Manassas, VA), and cultured in 10% DMEM (high glucose) containing 10% newborn calf serum at 37 ◦ C in a 5% CO2 atmosphere. HUVEC (human umbilical vein endothelial cells) were isolated from human umbilical veins, and cultured in DMEM with 10% (v/v) FBS, 75 g/ml ECGs (Sigma, St. Louis, MO) and 5U/ml Heparin Sodium (Sigma, St. Louis, MO) at 37 ◦ C in a 5% CO2 atmosphere.
2.2. Plasmid construction The biotin acceptor peptide (BAP) with the length of 77 AA (Campos et al., 2004) was synthesized from Sangon Biotech Co. (Shanghai, China), which was flanked by BamHI and SfuI restriction sites at the 5-terminal and 3-terminal, respectively. The sequence of the BAP was as follow: 5 -GGATCCGGCGGATCTGGAGAGGGCGAGATTCCCGCTCCGCTGGCCGGCACC GTCTCCAAGATCCTCGTGAAGGAGGGTGACACGGTCAAGGCTGGTCAGACCGTGCTCGTTCTCGAGGCCATGAAGATGGAGACCGAGATCAACGCTCCCACCGACGGCAAGGTCGAGAAGGTCCTGGTCAAGGAGCGTGACGCGGTGCAGGGCGGTCAGGGTCTCATCAAGATCGGGGGCGGATCTTTCGAA-3 . Then BamHI and SfuI restricted BAP fragment was inserted into the hexon protein HVR5 region of pRGHMAd5 digested by BamHI-SfuI (Di et al., 2012). pRGHMAd5 carried an luciferase expression cassette in the E1 deletion region under the control of CMV promoter. The obtained plasmid was named pRGHMAd5-BAP, which was confirmed by enzyme digestion and DNA sequencing.
2.3. Virus production Recombinant virus modified with BAP peptide in the hypervariable region (HVR) five of hexon was produced by transfecting PacI-linearized vector pRGHMAd5-BAP into HEK-293 cells grown in 60 mm-diameter dishes. Ten days after transfection, the viral lysates were harvested and further propagated in HEK 293 cells and were purified by cesium chloride gradient methods (Anderson et al., 2000). The resultant adenovirus was named Ad5-Hexon-BAP. The titers of the virus particle were detected by spectrophotometry at an absorbance (A) of 260 nm.
363
2.4. Western blot Ad5-Hexon-BAP vector (1 × 106 VP, 1 × 107 VP, 1 × 108 VP) and Ad5 wild type (Ad5 wt) vector (1 × 107 VP, 1 × 108 VP) as a negative control was heated for 5 min at 95 ◦ C in 1 × sample buffer containing 4% -mercaptoethanol, and then the samples were separated on a 7.5% SDS-PAGE gel, followed by electrotransfer to a PVDF (polyvinylidene difluoride) membrane. After blocking with 5% skimmed milk-PBST, the membrane was incubated with horseradish peroxidase (HRP)-conjugated streptavidin (1:500) overnight at 4 ◦ C. After washing, the membrane was reacted with enhanced chemiluminescence (ECL). 2.5. Conjunction of adenovirus with aptamer For conjugation of Ad5-Hexon-BAP with aptamer, Ad5-HexonBAP was incubated with avidin (Sigma, St. Louis, MO) and 5 -biotin-aptamer, AS1411(Guo et al., 2011; Hovanessian et al., 2010), GBI-10 (Daniels et al., 2003) and random aptamer as a negative control: 5 -CAAAGTAGCGTGCACTTTTG-3 , (Sangon Biotech Co., Shanghai, China) at a molar ratio of 1:1:3 (biotinylated hexon: avidin: 5 -biotin-aptamer) for 20 min at room-temperature. The obtained adenoviruses were named Ad5-Hexon-BAP-AS1411, Ad5Hexon-BAP-GBI-10 and Ad5-Hexon-BAP-NC, respectively. 2.6. Luciferase activity assay U251 cells and a non-cancer cell control HUVEC were plated into 24-well plates until the cell density reached 70%. Then the virus Ad5-Hexon-BAP, Ad5-Hexon-BAP-AS1411, Ad5-Hexon-BAPGBI-10, and Ad5-Hexon-BAP-NC were respectively added into the U251 cells or HUVEC cells at the dosage of 0.5 MOI (multiplicity of infection) for each virus. Four hours later, the cells were cultured in fresh medium. The cells were collected then for luciferase activity assay 48 h post transfection using Luciferase Assay Reagent (Promega, Madison, WI). 3. Results 3.1. Generation of aptamer-modified adenovirus We first produced an Ad5 biotinylated in the hexon HVR5 region, which was then modified by aptamer through avidin–biotin binding. We utilized our previously constructed shuttle vector pRGHMAd5 (Di et al., 2012), which contains a lacZ expression cassette in the hexon HVR5 region and a luciferase expression cassette driven by the CMV promoter in E1 region (Fig. 1), to incorporate biotin acceptor peptide (BAP) into the HVR5 of the Ad5 hexon. The BAP DNA sequence was ligated to the BamH1 and Sful digested pRGHMAd5. The obtained plasmid, named pRGHMAd5-BAP (Fig. 1), was confirmed by the restriction endonuclease analysis and DNA sequencing. Then, adenovirus with BAP modified-hexon was successfully generated by transfecting PacI-linearized pRGHMAd5-BAP into HEK293 cells. The obtained virus was named Ad5-Hexon-BAP. The packaging of the virus was seemingly not affected by this modification and the virus was produced with a titer of 2.8 × 1012 viral particles/ml. To examine the biotinylation of Ad5-HexonBAP, we denatured CsCl-purified virons in SDS and ran them on a polyacrylamide gel. We blotted separated proteins onto PVDF membranes and detected them with HRP-conjugated streptavidin, which revealed a single band of 98.32-kD hexon-BAP fusion protein (Fig. 2). These results indicated that the hexon of Ad5-Hexon-BAP was metabolically biotinylated during production in HEK293 cells, consistent with the previous observation (Campos et al., 2004).
364
H. Chen et al. / Journal of Biotechnology 168 (2013) 362–366
Fig. 1. Diagram of the scheme used to construct the hexon-modified adenovirus vector. pRGHMAd5 virus vector, which contains a lacZ expression cassette in the hexon HVR5 region and a luciferase expression cassette driven by the CMV promoter in E1 region, was digested by BamHI and SfuI and ligated with DNA sequence corresponding to the BAP, resulting in pRGHMAd5-BAP.
To modify the Ad5 with aptamer, Ad5-Hexon-BAP was mixed with avidin and 5 -biotin labeled aptamers. Aptamers used include AS1411, GBI-10 or random aptamer as a negative control (NC). Since avidin has a tetrameric structure with four biotin-binding sites (Reche, 2000), the biotinlylated Ad5-Hexon-BAP was allowed to specifically bind with 5 -biotin labeled aptamer via avidin–biotin interaction. The mixing molar ratio of biotinylated hexon, avidin, and 5 -biotin-aptamer (AS1411, GBI-10 or control) was about 1:1:3 to ensure that as much aptamer as possible be attached to the hexon. The three modified adenoviruses were named as Ad5-Hexon-BAP-AS1411, Ad5-Hexon-BAP-GBI-10, and Ad5Hexon-BAP-NC, respectively. 3.2. Improved transduction efficiency of aptamer-modified Ad5 in U251 cell line To examine if aptamer-modification of the hexon protein can improve the transduction efficiency of the Ad vector, a human glioblastoma cell line U251 and a non-cancer cell line HUVEC were transduced with Ad5-Hexon-BAP-AS1411 or Ad5-Hexon-BAP-GBI10 at an MOI of 0.5. The transduction efficiency of the AS1411- or GBI-10- modified Ad5, which was measured as luciferase activity,
Fig. 3. In vitro transduction efficiency of aptamer-modified Ad5 measured by luciferase activity. U251 cells and a non-cancer cell line HUVEC were infected with Ad5-Hexon-BAP-AS1411, Ad5-Hexon-BAP-GBI-10, and controls at the dosage of 0.5 MOI (multiplicity of infection) for each virus. Forty-eight hours later, the luciferase activity in the cell lysate was measured as relative light units (RLU). * indicating P < 0.05 that shows significantly different between experimental group and control group analyzed by LSD’ One-way ANOVA comparison. The NC indicating random aptamer as a negative control.
was approximately 4.1-fold or 5.2-fold higher than those of the control viruses (P < 0.05) (Fig. 3). However, in the non-cancer cell line HUVEC, there was no significant difference between the transduction efficiency of AS1411- or GBI-10- modified Ad5 and that of the control viruses (Fig. 3). The data indicated that aptamer AS1411 or GBI-10 modification could significantly increase the transduction efficiency of Ad5 in glioblastoma cell line U251 specifically. 4. Discussion
Fig. 2. Western blot for evaluation of the biotinylation of Ad5-Hexon-BAP. The different concentration of Ad5-Hexon-BAP viral particles (VP) was separated on 7.5% SDS-PAGE gel and biotinylated hexon was subsequently detected by streptavidinHRP. Wild-type Ad5 (Ad5 wt) vector was included as a negative control. The arrow indicates the band corresponding to the hexon-BAP.
In this study, to improve the tumor-targeting ability of Ad5 by using an aptamer, we genetically modified the HVR5 of Ad hexon by biotin acceptor peptide (BAP), which would be metabolically biotinylated during production in HEK293 cells, followed by binding the modified Ads with biotin-labeled aptamer AS1411 or GBI-10 through avidin–biotin interaction. The resultant aptamer-modified Ads showed significantly improved transduction efficiency for malignant glioma cells. Adenovirus has been the most commonly used vector for geneviral therapy against glioblastoma because of its high titers, high transduction efficiency, and high safety profiles. However, the entry of an adenovirus into tumor cells is complicated by the reduction
H. Chen et al. / Journal of Biotechnology 168 (2013) 362–366
or total absence of CAR, the high-affinity receptor for Ad fiber protein (Nabel, 1999; Bergelson et al., 1997; Tomko et al., 1997), in glioblastoma cells (Kim et al., 2003). Genetic modification of Ad capsid protein (Kurachi et al., 2007; Di et al., 2012; Wang et al., 2011; Nandi and Lesniak, 2009) has been taken to overcome resistance of tumor cells to infection by Ad5. For example, incorporation of the Arg-Gly-Asp (RGD) motif into the Ad fiber knob in order to bind ␣v3 and ␣v5 integrins expressed on tumor cells demonstrated an increase in gene transfer to ovarian cancer cells of 2 to 3 orders of magnitude (Dmitriev et al., 1998). The addition of the RGD moiety to the CRAd, Ad24, also enhanced the viral cellular toxicity by at least 10% to a maximum of 70% (Lamfers et al., 2002). Our previous work demonstrated that the modification of Ad5 by insertion of NGR, RGD or Tat PTD peptides into hexon HVR5 resulted in 2–5 fold increase in the transduction efficiency in A172 and CHOK1 cells (Di et al., 2012). Despite promising results, the approach of genetic modification of Ad capsid protein to improve tumor targeting has disadvantages, such as, leading to poorly growing viruses (Wu et al., 2005) and being less versatile, i.e., one modification only for one target. An alternative strategy is the use of heterologous retargeting ligands that are bispecific by binding both to the viral vector as well as to a cell surface target (Gao et al., 2007; Suzuki-Kouyama et al., 2011; Wortmann et al., 2008; Yao et al., 2009; Li et al., 2007; Kashentseva et al., 2002; Israel et al., 2001). Successful strategies include anti-capsid antibody fragments or soluble CAR fragments fused to a diverse set of ligands including antibody fragments against a variety of cellular receptors, growth factors like the basic fibroblast growth factor (FGF-2) and epidermal growth factor (EGF), and even small molecule ligands like folate (Barnett et al., 2002; Glasgow et al., 2006). The adaptor molecules rely on non-covalent protein–protein interactions for their conjugation to the Ad capsid, which are generally considered too weak to work in vivo. Naturally occurring antibodies or CAR receptors could compete for Ad binding and displace the molecular adaptors from the capsid, abolishing the vector targeting activity. In this study, to improve the Ad targeting, we utilized a combinatorial approach that involves aptamer and genetically modified Ad. Aptamers, oligonucleic acid or peptide molecules that bind to a specific target molecule, are good candidates for targeted therapy because of their low molecular weights, lack of immunogenicity, and readily availability. Aptamer has been used for mediating Antibody-dependent cellular cytotoxicity (ADCC) (Boltz et al., 2011), inhibiting protein–protein interaction, and mediating siRNA and nanoparticles delivery into the cells (Di Giusto et al., 2006; McNamara et al., 2008; Neff et al., 2011). To the best of our knowledge, aptamer-mediated adenoviral targeting to CARdeficient tumor cells has not been reported. One of the aptamers used in this study, AS1411, is a 26 nt G-rich DNA aptamer and considered to be the first anticancer aptamer. AS1411 targets nucleolin, a nuclear matrix protein which can be found on the surface of cancer cells. AS1411 is currently in Phase II clinical trials for acute myeloid leukemia by Antisoma Research (Ni et al., 2011). GBI-10, another aptamer used in this study, is a DNA aptamer that can recognize the extracellular matrix protein tenascin-C on the surface of human glioblastoma cells (Daniels et al., 2003). To bind an aptamer to the Ad vector in a hexon-specific manner via avidin–biotin interaction, we incorporated BAP peptide into the HVR5 region of the hexon loop. The latter seems appropriate as a site for insertion of foreign peptides because Hexon is not involved in the binding of Ad vector to the primary receptor CAR. In addition, the HVR5 allows insertion of foreign peptides without affecting the function of Ad as a gene transfer vector (Kurachi et al., 2007; Vigne et al., 1999). Our previously constructed shuttle vector pRGHMAd5, which contains a lacZ expression cassette in the hexon HVR5 region (Di et al., 2012), made the job of constructing a BAP-modified
365
Ad painless. As expected, a BAP-modified Ad was produced successfully with a high titer, and metabolically biotinylated during production in HEK293 cell (Campos et al., 2004). In addition to Ad hexon, the fiber knob of Ad is probably another region suitable for this modification (Liu et al., 2009; Wang et al., 2011). Compared with the other approaches to improving Ad tumor targeting, the strategy described in this paper is simple, low-cost, effective, and versatile. Compared with bispecific antibodies, which have also been used to mediate the adenovirus targeting to the tumor cells (Li et al., 2007; Kashentseva et al., 2002; Israel et al., 2001), aptamers will be equally effective, if not more, but much easier to produce. This approach is versatile, for example, a BAPmodified Ad can be further modified by different biotin-labeled aptamers, or even other types of ligands, with tropisims to different targets. In conclusions, we developed an aptamer-modified Ad vector by inserting the BAP into the Ad hexon HVR5 region, and then binding the biotinylated Ad with aptamer through avidin–biotin interaction. The aptamer modified Ad revealed significantly enhanced transduction efficiency for target cells in vitro. This strategy may be of great utility for treatment of neoplasms characterized by deficiency of the primary Ad type 5 receptor.
Acknowledgments This work was supported by the “Foundation for Excellent Doctor Degree Dissertation” (X2011YB09) of Shaanxi Normal University, the Fundamental Research Funds for the Central Universities (GK201301010) and research grants to H.X. and X.Z. from the National Natural Science Foundation of China (Nos. 81272543, 31070137 and 81301957).
References Anderson, R.D., Haskell, R.E., Xia, H., Roessler, B.J., Davidson, B.L., 2000. A simple method for the rapid generation of recombinant adenovirus vectors. Gene Ther. 7, 1034–1038. Barbas, A.S., Mi, J., Clary, B.M., White, R.R., 2010. Aptamer applications for targeted cancer therapy. Future Oncol. 6, 1117–1126. Barnett, B.G., Crews, C.J., Douglas, J.T., 2002. Targeted adenoviral vectors. Biochim. Biophys. Acta 1575, 1–14. Bergelson, J.M., Cunningham, J.A., Droguett, G., Kurt-Jones, E.A., Krithivas, A., Hong, J.S., Horwitz, M.S., Crowell, R.L., Finberg, R.W., 1997. Isolation of a common receptor for Coxsackie B viruses and adenoviruses 2 and 5. Science 275, 1320–1323. Boltz, A., Piater, B., Toleikis, L., Guenther, R., Kolmar, H., Hock, B., 2011. Bi-specific aptamers mediating tumor cell lysis. J. Biol. Chem. 286, 21896–21905. Campos, S.K., Parrott, M.B., Barry, M.A., 2004. Avidin-based targeting and purification of a protein IX-modified, metabolically biotinylated adenoviral vector. Mol. Ther. 9, 942–954. Cerchia, L., De Franciscis, V., 2007. Nucleic acid-based aptamers as promising therapeutics in neoplastic diseases. Methods Mol. Biol. 361, 187–200. Cerchia, L., Esposito, C.L., Jacobs, A.H., Tavitian, B., De Franciscis, V., 2009. Differential SELEX in human glioma cell lines. PLoS One 4, e7971. Cerchia, L., Hamm, J., Libri, D., Tavitian, B., De Franciscis, V., 2002. Nucleic acid aptamers in cancer medicine. FEBS Lett. 528, 12–16. Crompton, J., Toogood, C.I., Wallis, N., Hay, R.T., 1994. Expression of a foreign epitope on the surface of the adenovirus hexon. J. Gen. Virol. 75 (Pt 1), 133–139. Daniels, D.A., Chen, H., Hicke, B.J., Swiderek, K.M., Gold, L., 2003. A tenascin-C aptamer identified by tumor cell SELEX: systematic evolution of ligands by exponential enrichment. Proc. Natl. Acad. Sci. U S A 100, 15416–15421. Di, B., Mao, Q., Zhao, J., Li, X., Wang, D., Xia, H., 2012. A rapid generation of adenovirus vector with a genetic modification in hexon protein. J. Biotechnol. 157, 373–378. Di Giusto, D.A., Knox, S.M., Lai, Y., Tyrelle, G.D., Aung, M.T., King, G.C., 2006. Multitasking by multivalent circular DNA aptamers. Chembiochem 7, 535–544. Dmitriev, I., Krasnykh, V., Miller, C.R., Wang, M., Kashentseva, E., Mikheeva, G., Belousova, N., Curiel, D.T., 1998. An adenovirus vector with genetically modified fibers demonstrates expanded tropism via utilization of a coxsackievirus and adenovirus receptor-independent cell entry mechanism. J. Virol. 72, 9706–9713. Einfeld, D.A., Brough, D.E., Roelvink, P.W., Kovesdi, I., Wickham, T.J., 1999. Construction of a pseudoreceptor that mediates transduction by adenoviruses expressing a ligand in fiber or penton base. J. Virol. 73, 9130–91366. Gao, J.Q., Eto, Y., Yoshioka, Y., Sekiguchi, F., Kurachi, S., Morishige, T., Yao, X., Watanabe, H., Asavatanabodee, R., Sakurai, F., Mizuguchi, H., Okada, Y., Mukai, Y., Tsutsumi, Y., Mayumi, T., Okada, N., Nakagawa, S., 2007. Effective tumor targeted
366
H. Chen et al. / Journal of Biotechnology 168 (2013) 362–366
gene transfer using PEGylated adenovirus vector via systemic administration. J. Control. Release 122, 102–110. Glasgow, J.N., Everts, M., Curiel, D.T., 2006. Transductional targeting of adenovirus vectors for gene therapy. Cancer Gene Ther. 13, 830–844. Guo, J., Gao, X., Su, L., Xia, H., Gu, G., Pang, Z., Jiang, X., Yao, L., Chen, J., Chen, H., 2011. Aptamer-functionalized PEG-PLGA nanoparticles for enhanced anti-glioma drug delivery. Biomaterials 32, 8010–8020. Hovanessian, A.G., Soundaramourty, C., El Khoury, D., Nondier, I., Svab, J., Krust, B., 2010. Surface expressed nucleolin is constantly induced in tumor cells to mediate calcium-dependent ligand internalization. PLoS One 5, e15787. Israel, B.F., Pickles, R.J., Segal, D.M., Gerard, R.D., Kenney, S.C., 2001. Enhancement of adenovirus vector entry into CD70-positive B-cell Lines by using a bispecific CD70-adenovirus fiber antibody. J. Virol. 75, 5215–5221. Jullienne, B., Vigant, F., Muth, E., Chaligne, R., Bouquet, C., Giraudier, S., Perricaudet, M., Benihoud, K., 2009. Efficient delivery of angiostatin K1-5 into tumors following insertion of an NGR peptide into adenovirus capsid. Gene Ther. 16, 1405–1415. Kashentseva, E.A., Seki, T., Curiel, D.T., Dmitriev, I.P., 2002. Adenovirus targeting to c-erbB-2 oncoprotein by single-chain antibody fused to trimeric form of adenovirus receptor ectodomain. Cancer Res. 62, 609–616. Kim, M., Sumerel, L.A., Belousova, N., Lyons, G.R., Carey, D.E., Krasnykh, V., Douglas, J.T., 2003. The coxsackievirus and adenovirus receptor acts as a tumour suppressor in malignant glioma cells. Br. J. Cancer. 88, 1411–1416. Kurachi, S., Koizumi, N., Sakurai, F., Kawabata, K., Sakurai, H., Nakagawa, S., Hayakawa, T., Mizuguchi, H., 2007. Characterization of capsid-modified adenovirus vectors containing heterologous peptides in the fiber knob. Protein IX, or Hexon. Gene Ther. 14, 266–274. Lamfers, M.L., Grill, J., Dirven, C.M., Van Beusechem, V.W., Geoerger, B., Van Den Berg, J., Alemany, R., Fueyo, J., Curiel, D.T., Vassal, G., Pinedo, H.M., Vandertop, W.P., Gerritsen, W.R., 2002. Potential of the conditionally replicative adenovirus Ad5-Delta24RGD in the treatment of malignant gliomas and its enhanced effect with radiotherapy. Cancer Res. 62, 5736–5742. Lenaerts, L., Van Dam, W., Persoons, L., Naesens, L., 2012. Interaction between mouse adenovirus type 1 and cell surface heparan sulfate proteoglycans. PLoS One 7, e31454. Li, H.J., Everts, M., Pereboeva, L., Komarova, S., Idan, A., Curiel, D.T., Herschman, H.R., 2007. Adenovirus tumor targeting and hepatic untargeting by a coxsackie/adenovirus receptor ectodomain anti-carcinoembryonic antigen bispecific adapter. Cancer Res. 67, 5354–5361. Liu, S., Mao, Q., Zhang, W., Zheng, X., Bian, Y., Wang, D., Li, H., Chai, L., Zhao, J., Xia, H., 2009. Genetically modified adenoviral vector with the protein transduction domain of Tat improves gene transfer to CAR-deficient cells. Biosci. Rep. 29, 103–109. Mcnamara, J.O., Kolonias, D., Pastor, F., Mittler, R.S., Chen, L., Giangrande, P.H., Sullenger, B., Gilboa, E., 2008. Multivalent 4-1BB binding aptamers costimulate CD8+ T cells and inhibit tumor growth in mice. J. Clin. Invest. 118, 376–386.
Murphy, A.M., Rabkin, S.D., 2013. Current status of gene therapy for brain tumors. Transl. Res. 161, 339–354. Nabel, G.J., 1999. Development of optimized vectors for gene therapy. Proc. Natl. Acad. Sci. U S A 96, 324–326. Nandi, S., Lesniak, M.S., 2009. Adenoviral virotherapy for malignant brain tumors. Expert Opin. Biol. Ther. 9, 737–747. Neff, C.P., Zhou, J., Remling, L., Kuruvilla, J., Zhang, J., Li, H., Smith, D.D., Swiderski, P., Rossi, J.J., Akkina, R., 2011. An aptamer-siRNA chimera suppresses HIV-1 viral loads and protects from helper CD4(+) T cell decline in humanized mice. Sci. Transl. Med. 3, 66ra6. Ni, X., Castanares, M., Mukherjee, A., Lupold, S.E., 2011. Nucleic acid aptamers: clinical applications and promising new horizons. Curr. Med. Chem. 18, 4206–4214. Pedersini, R., Vattemi, E., Claudio, P.P., 2010. Adenoviral gene therapy in high-grade malignant glioma. Drug News Perspect. 23, 368–379. Reche, P.A., 2000. Lipoylating and biotinylating enzymes contain a homologous catalytic module. Protein Sci. 9, 1922–1929. Stoltenburg, R., Reinemann, C., Strehlitz, B., 2007. SELEX–a (r)evolutionary method to generate high-affinity nucleic acid ligands. Biomol. Eng. 24, 381–403. Suzuki-Kouyama, E., Katayama, K., Sakurai, F., Yamaguchi, T., Kurachi, S., Kawabata, K., Nakagawa, S., Mizuguchi, H., 2011. Hexon-specific PEGylated adenovirus vectors utilizing avidin-biotin interaction. Biomaterials 32, 1724–1730. Thomas, R.P., Recht, L., Nagpal, S., 2013. Advances in the management of glioblastoma: the role of temozolomide and MGMT testing. Clin. Pharmacol. 5, 1–9. Tomko, R.P., Xu, R., Philipson, L., 1997. HCAR and MCAR: the human and mouse cellular receptors for subgroup C adenoviruses and group B coxsackieviruses. Proc. Natl. Acad. Sci. U S A 94, 3352–3356. Tuerk, C., Gold, L., 1990. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249, 505–510. Vigne, E., Mahfouz, I., Dedieu, J.F., Brie, A., Perricaudet, M., Yeh, P., 1999. RGD inclusion in the hexon monomer provides adenovirus type 5-based vectors with a fiber knob-independent pathway for infection. J. Virol. 73, 5156–5161. Wang, D., Liu, S., Mao, Q., Zhao, J., Xia, H., 2011. A novel vector for a rapid generation of fiber-mutant adenovirus based on one step ligation and quick screening of positive clones. J. Biotechnol. 152, 72–76. Wilson, D.S., Szostak, J.W., 1999. In vitro selection of functional nucleic acids. Annu. Rev. Biochem. 68, 611–647. Wortmann, A., Vohringer, S., Engler, T., Corjon, S., Schirmbeck, R., Reimann, J., Kochanek, S., Kreppel, F., 2008. Fully detargeted polyethylene glycol-coated adenovirus vectors are potent genetic vaccines and escape from pre-existing anti-adenovirus antibodies. Mol. Ther. 16, 154–162. Wu, H., Han, T., Belousova, N., Krasnykh, V., Kashentseva, E., Dmitriev, I., Kataram, M., Mahasreshti, P.J., Curiel, D.T., 2005. Identification of sites in adenovirus hexon for foreign peptide incorporation. J. Virol. 79, 3382–3390. Yao, X., Yoshioka, Y., Morishige, T., Eto, Y., Watanabe, H., Okada, Y., Mizuguchi, H., Mukai, Y., Okada, N., Nakagawa, S., 2009. Systemic administration of a PEGylated adenovirus vector with a cancer-specific promoter is effective in a mouse model of metastasis. Gene Ther. 16, 1395–1404.
