Neurol Sci DOI 10.1007/s10072-014-1817-2
ORIGINAL ARTICLE
Inhibition of GPR137 expression reduces the proliferation and colony formation of malignant glioma cells Gang Zong • Hongliang Wang • Jia Li • Yongsheng Xie • Erbao Bian • Bing Zhao
Received: 14 November 2013 / Accepted: 3 May 2014 Ó Springer-Verlag Italia 2014
Abstract GPR137 are ubiquitously expressed in the central nervous system. However, the role of GPR137 in human malignant glioma is still poorly known. In the present study, we firstly detected the expression of GPR137 in 29 human glioma tissue specimens by immunohistochemistry and in 5 malignant glioma cell lines by quantitative RT-PCR. The expression of GPR137 was much stronger in high-grade gliomas than in low-grade gliomas. Lentivirus-mediated small interfering RNAs (siRNAs) were employed to knock down GPR137 expression in glioma cells. Inhibition of GPR137 expression by RNAi significantly inhibited the proliferation and colony-forming capacity of U251, A172 and U373 cells. Moreover, flow cytometry analysis showed that knockdown of GPR137 led to the cell-cycle arrest at the S phase. Our results indicated that GPR137 is involved in the progression of human glioma, suggesting GPR137 as a potential oncogene of glioma cells. Keywords GPR137 Glioma RNAi Proliferation Colony Cell cycle Introduction Gliomas are the most common type of primary malignancies in the central nervous system (CNS), accounting for
Electronic supplementary material The online version of this article (doi:10.1007/s10072-014-1817-2) contains supplementary material, which is available to authorized users. G. Zong H. Wang J. Li Y. Xie E. Bian B. Zhao (&) Department of Neurosurgery, The Second Affiliated Hospital of Anhui Medical University, and Cerebral Vascular Disease Research Center, Anhui Medical University, 678 Fu Rong Road, Hefei 230601, China e-mail: [email protected]
44.69 % of intracranial tumors [1]. According to the WHO classification system, gliomas are classified into four different grades [2]. Glioblastoma multiforme (GBM) is the most aggressive and lethal types of brain tumors, accounting for approximately 60–70 % of malignant gliomas. Unfortunately, despite aggressive multimodal approach and significant gains in the investigation of glioblastoma biology, GBM patients still have a dismal prognosis, with median survivals of 12–15 months [1]. A large number of studies have reported various mechanisms of tumorigenesis and progression in malignant glioma. Among these mechanisms, signal transduction between glioma cells and the surrounding microenvironment plays a pivotal role in cells survival, growth, angiogenesis, migration, invasion and metastasis [3]. The effector pathway of transducing extracellular signals into intracellular relies heavily on membrane proteins, such as epidermal growth factor receptor (EGFR), basic fibroblast growth factor receptor (bFGFR) [4] and G-protein-coupled receptors (GPCRs) at glioma cells surface [5]. Undoubtedly, G-protein-coupled receptors (GPCRs) are the largest and most diverse membrane protein families, which are encoded by more than 800 members in the human genome and share common structural components by seven transmembrane (TM) a-helical segments connected by extracellular and intracellular loops [5]. G-protein-coupled receptors can recognize a wide spectrum of extracellular signals ranging from photons to ions, amino acids, small organic molecules, lipids, peptides and entire proteins. Furthermore, the function of GPCRs is to couple the binding of these ligands in order to change the conformation by activating specific heterotrimeric G proteins, after which, cytosolic signaling networks will be activated, thereby causing various cellular responses. The function of GPCRs is to couple the binding of these ligands in order to
123
Neurol Sci
change the conformation by activating specific heterotrimeric G proteins, after which, cytosolic signaling networks will be activated, thereby causing various cellular responses [6]. Recently, GPCRs have been described as key factors in tumor growth and metastasis [7]. By hijacking the normal physiological functions of GPCRs, malignant glioma cells can survive, proliferate autonomously, escape from the immune system, increase angiogenesis, invade their surrounding tissues and migrate to other organs [7]. Nowadays, most GPCRs ligands have been found and represent between 30 and 45 % of the current drug targets [8]. However, there are still more than 100 GPCRs whose ligands had not yet been discovered [9]; these GPCRs are called orphan GPCRs. On the basis that GPCRs start as orphan GPCRs, exploring the functions and mechanisms of orphan GPCRs is important for understanding the malignant glioma biology as well as drug discovery in malignant glioma prevention and treatment. GPR137 is an oGPCR-encoding gene and ubiquitously expressed in the central nervous system (CNS), mainly in the hippocampus [10]. It has been found that GPR133, GPR134, GPR135, GPR136, and GPR137, as a group, share 40–50 % homology with each other and GPR137 most closely resemble a prostate-specific odorant-like orphan GPCR (PSGR). Prostate-specific odorant-like orphan has been found to have restricted expression in human prostate tissues and used as diagnostic marker of prostate cancer. Its signaling has also been involved in prostate cancer cell progression. GPR133 as a member of the adhesion GPCR subfamily can activate the G(s) protein/adenylyl cyclase pathway. However, the function of GPR137 in glioma has not been investigated. To explore the potential role of GPR137 in human malignant glioma, we began with an expression analysis of GPR137 protein in human glioma specimens. The expression of GPR137 was subsequently detected in five glioma cell lines. We employed lentivirus-mediated siRNA to down-regulate GPR137 expression in two glioma cell lines, U251 and A172. Finally, the effects of GPR137 knockdown on glioma cell proliferation, colony formation and cell-cycle progression were investigated.
Materials and methods Immunohistochemistry Before the study began, written informed consent was obtained from all patients who participated in the study, which was approved by the ethics committee of the second affiliated hospital of Anhui Medical University. Twentynine glioma samples were obtained from March 2010 to September 2011 from the Department of Neurosurgery at
123
the Second Affiliated Hospital of Anhui Medical University [14 low-grade gliomas (I, II) cases, 15 high-grade gliomas (III, IV); grades were determined according to the 2007 WHO classification of tumors of the central nervous system]. All tumors were from patients with newly diagnosed gliomas who had received no therapy before sample collection. Tissue samples were paraffin embedded, dewaxed and rehydrated. The sections were then microwaved for antigen retrieval. For immunohistochemical staining, slides were treated with hydrogen peroxide (H2O2) for 10 min, washed with ddH2O and placed in PBS buffer. Anti-GPR137 (1:150 dilution; #11929-1-AP, Proteintech Group, Inc.) was then applied for incubation at room temperature. Biotinylated goat anti-rabbit IgG was used as the secondary antibody. The immunoreactions were detected by staining with 3,30 -diaminobenzidine (DAB). All stained slides were evaluated in a double-blinded manner by three pathologists independently, and the scores were supplied by the proportion of positive tumor cells and the intensity of the coloring [11]. The result of the tissues was determined from at least 1,000 cells that were counted systematically in ten visual fields selected at random. The proportion of positive tumor cells were recorded according to the following classification: 0, no cells stained; 1, \20 % of cells stained; 2, 20–60 % of cells stained and 3, [60 % of cells stained. However, the groups could also be classified into the following 4 groups by the intensity of the coloring: 0, no coloring; 1, yellowish; 2, brownish-yellow; and 3, dark brown. The two scores were combined to obtain the final one: scores from 0 to 1 indicate negative (-), whereas scores from 2 to 4 indicate weak positive (?), and 5–6 indicate strong positive (??). Cell culture Human glioblastoma cell lines U251, U-87MG, U373, A172, U-118MG and human embryonic kidney cell line 293T were cultured in Dulbecco’s modified Eagle medium (DMEM, Hyclone) with 10 % heat inactivated fetal bovine serum (FBS, Hyclone), in a humidified atmosphere containing 5 % CO2 at 37 °C. All cell lines were purchased from the cell bank type culture collection of Chinese Academy of Sciences (Shanghai, China). Construction of GPR137 shRNA lentivirus vector and cell infection The following stem–loop–stem oligos were synthesized. The negative control short-hairpin RNA (shRNA) was 50 CTAGCCCGGTTCTCCGAACGTGTCACGTATCTCGA GATACGTGACACGTTCGGAGAATTTTTTTAAT-3 0 . GPR137 shRNA was 50 -GATCCGAACAAAGGCTACCT
Neurol Sci
GGTATTCTCGAGAATACCAGGTAGCCTTTGTTCTT TTTTG-30 . The oligos were annealed and ligated into the pFH-L vector (Shanghai Hollybio, China). The lentiviralbased shRNA-expressing vectors were determined by DNA sequencing. The generated plasmids were named as pFH-LL-shGPR137 or -shCon. Recombinant lentiviral vectors and packaging vectors were transfected into 293T cells. Supernatants containing lentivirus expressing GPR137 shRNA or control shRNA were harvested 3 days after transfection. After then, the lentiviruses were purified via ultracentrifugation, and the titer of lentiviruses was confirmed. U251 and A172 were infected with the lentivirus constructs at 10 MOI and mock-infected cells were used as negative controls.
MTT assay U251 and A172 were, respectively, trypsinized, resuspended, seeded into 96-well plate with a concentration of 2,300 and 2,500 cells per well, and incubated at 37 °C 4 days post-lentivirus infection. On the following day 1, 2, 3, 4 and 5, to measure the cell number, 10 ll of 5 mg/ml MTT was added to the cultured cells, which were further incubated for 3 h. After removing the remaining medium, 100 ll of acidified isopropanol (in 0.01 M HCl) was added to each well at the end of incubation. The absorption value was measured at 595 nm on the spectrophotometer. Colony formation assay
Quantitative RT-PCR analysis Total cellular RNAs from the five cell lines were extracted using the Trizol reagent. cDNA was synthesized using M-MLV reverse transcriptase according to the protocol of the supplier. In brief, 1.5 lg of total RNA, 0.75 lg oligodT primer and nuclease-free water constituted a mixture and heated at 70 °C for 5 min and cooled on ice for another 5 min. Then the mixture was supplemented with 4 ll MMLV buffer, 0.5 ll RNasin, 0.75 ll M-MLV-RT and 1.25 ll dNTP up to a final volume of 20 ll, followed by incubation at 42 °C for 60 min. Each PCR reaction mixture comprised 10 ll of 29 SYBR Green Master Mix, 5 ll of cDNA (10 ng) and 0.8 ll of sense and antisense primers (2.5 lmol/ll), was run for 40 cycles with an initial denaturation at 95 °C for 60 s, followed by denaturation at 95 °C for 5 s and 60 °C for 30 s. The 2-DDCT method was applied to analyze the relative changes in gene expression levels, the primer sequences for PCR amplification of GPR137 gene were 50 -ACCTGGGGAACAAAG GCTAC-30 as well as 50 -TAGGACCGAGAGGCAAA GAC-30 . b-actin was used as an internal control. The primer sequences of b-actin were 50 -GTGGACATCCGCAAA GAC-30 as well as 50 - AAAGGGTGTAACGCAACTA-30 . Western blot U251 cells and A172 were collected 5 days after infection with the lentivirus constructs, and total protein was isolated from the cells and quantified by the bicinchoninic acid (BCA) method. Protein (20 lg) was loaded onto a 10 % SDS-PAGE and transferred to a polyvinylidene difluoride membrane (Millipore). Next, proteins were detected by their respective antibodies using an ECL kit (Amersham) and exposed to X-ray film. The protein level of GAPDH was used as a control and was detected by an anti-GAPDH antibody. Bands on the X-ray films were quantified with an ImageQuant densitometric scanner (Molecular Dynamics).
A total of 200 U251 and 400 U373 cells were, respectively, seeded in six-well plates after 4 days of lentivirus infection. The medium was changed at regular time intervals. The natural colonies were washed with PBS after 11 days of culture at 37 °C, and fixed with 4 % paraformaldehyde for 30 min at room temperature. The colonies were then stained by crystal violet for 10 min, and washed with water and airdried. The total number of colonies which contain more than 50 cells was counted under fluorescence microscopy. Fluorescence-activated cell sorting analysis The cell-cycle distribution was analyzed by flow cytometry with PI staining. In brief, 3,500 cells that were infected with lentivirus for 4 days were incubated in six-well plates and allowed to culture at 37 °C for 40 h. Cells were harvested after tripsinization, washed with ice-cold phosphate-buffered saline (PBS) and fixed with 70 % ice-cold ethanol. Then, cells were collected by centrifugation and resuspended in PBS containing RNase (100 lg/ml) and propidium iodide (PI, 40 lg/ml), and seeded at 37 °C for 1 h. Finally, 1.0 9 104 fixed cells were analyzed for the cell-cycle phase by FACS can (Cell Lab Quanta Beckman Coulter). Statistical analysis All values in the text and figures are expressed as the mean ± SD of at least triplicate determination. The Student’s t test was used for data analysis using the SPSS 13.0 software. A value of p \ 0.05 was considered statistically significant.
Results The expression levels of GPR137 protein in glioma tissue samples To determine the potential role of GPR137 in human glioma progression, we evaluated GPR137 expression in 29
123
Neurol Sci
Fig. 1 Representative immunohistochemical staining of GPR137 in glioma patients. All stained slides were evaluated under light microscope (920 lens). a Negative, the score equal to 0. b Weak
positive, the score equal to 2. c Weak positive, the score equal to 3. d Weak positive, the score equal to 4. e Strong positive, the score equal to 5. f Strong positive, the score equal to 6
surgical glioma specimens by immunohistochemistry. Representative immunohistochemical staining was shown in Fig. 1. The expression of GPR137 was significantly higher in high-grade gliomas (WHO grade III and IV) than in low-grade gliomas (WHO grade I and II), suggesting that GPR137 is related to glioma malignancy (Table 1, p \ 0.05, Fisher’s exact test).
Table 1 The relationship between the incidence of immunoreactivity for GPR137 in human glioma tissue specimens and the histological grades (N = 29) Sample
14
11 (78.6 %)
3 (21.4 %)
Lentivirus-mediated shRNA inhibited GPR137 mRNA and protein expression in U251 and A172 cells
Low-grade gliomas (I, II) High-grade gliomas (III, IV)
15
5 (35.3 %)
10 (66.7 %)
We detected the expression of GPR137 mRNA in glioma cell lines by qRT-PCR. As shown in Fig. 2a, GPR137 mRNA was expressed in all five cell lines. Then U251 and A172 cell lines were used for loss-of-function investigation
123
N
Expression of GPR137 Weak positive
p value*
Strong positive 0.0253
* Fisher’s exact test
in the following study. To verify whether the recombinant lentiviruses were able to infect human glioma cell lines, cells infected with Lv-shGPR137 and Lv-shCon were
Neurol Sci
Fig. 2 Knockdown of GPR137 expression using lentivirus-mediated RNAi in glioma cells. a The expression of GPR137 mRNA in five glioma cell lines was examined by qRT-PCR. b More than 90 % of U251 and A172 cells expressed GFP (910 lens). There was no significant difference between Lv-shCon group and the non-transfected group, suggesting the transfection process had no effect on cell growth. Expression analyses of GPR137 mRNA levels in U251
(c) and A172 (d) cells infected with Lv-shCon and Lv-shGPR137 by qRT-PCR. Expression analyses of GPR137 protein levels in U251 (e) and A172 (f) cells infected with Lv-shCon and Lv-shGPR137 by western blot. Con: cells without infection; Lv-shCon: cells infected with the Lv-shCon; Lv-shGPR137: cells infected with the LvshGPR137. There was a significant difference between Lv-shCon and Lv-shGPR137 (***p \ 0.001)
observed under a fluorescence microscope. Four days postinfection, efficiencies were [90 % (Fig. 2b), indicating high-efficiency infection by the lentivirus. To determine that the GPR137 gene was silenced by Lv-shGPR137, the mRNA and protein levels in U251 cells and A172 were evaluated using qRT-PCR and western blot. The mRNA levels of GPR137 were remarkably decreased in U251, A172 and U373 cells infected with the Lv-shGPR137 (p \ 0.001, Fig. 2c, d; p \ 0.01, Figure S1A). Moreover, as shown in Fig. 2e, f, the protein levels of GPR137 were consistently down-regulated in Lv-shGPR137 groups, compared with Lv-shCon groups.
Fig. 3a) and 52.7 % reduction in A172 cells (p \ 0.001, Fig. 3b), respectively. The results indicate that silencing of GPR137 inhibits the proliferation of glioma cells.
Effects of GPR137 knockdown on cell proliferation To investigate the effect of GPR137 knockdown on cell proliferation, MTT assay was performed in U251 and A172 cell lines following 5 days of lentivirus infection. In comparison with control lentivirus infected cells, deletion of GPR137 significantly inhibited the proliferation of both cell lines, by 37.4 % reduction in U251 cells (p \ 0.001,
Effects of GPR137 knockdown on colony-forming ability of glioma cells To detect the effect of GPR137 on the colony-forming capacity of glioma cells, the colony formation assay was performed in U251 and U373 cells. As shown in Fig. 4a, b, the size of each colony and the number of colonies formed in U251 cells infected with Lv-shGPR137 were significantly decreased when compared with those in uninfected and Lv-shCon infected cells. Knockdown of GPR137 could markedly suppress the colony formation of U251 cells (p \ 0.01, Fig. 4c). Similarly, down-regulation of GPR137 also suppressed the colony formation of U373 cells (p \ 0.001, Figure S1B and C). These results indicated that the reduced expression of GPR137 could significantly inhibit the colony formation in human glioma cells.
123
Neurol Sci
Effects of GPR137 knockdown on cell-cycle distribution To determine whether GPR137 is necessary for cell-cycle progression of the glioma cells, we assessed the cell-cycle distribution in U251 and A172 cells by flow cytometry (Fig. 5a, b). Compared to Lv-shCon groups, the cell percentages of S phase in Lv-shGPR137 groups were significant increased in both U251 and A172 cells (p \ 0.01, p \ 0.001, Fig. 5c, d). Concomitantly, the cell percentages of G0/G1 and G2/M phases were decreased in U251 and A172 cells after Lv-shGPR137 infection. The results indicated that knockdown of GPR137 could attenuate glioma cell growth and block cell-cycle progression. Discussion
Fig. 3 Effect of GPR137 knockdown on the proliferation of malignant glioma cell lines U251 (a) and A172 (b). The proliferation rates in the Lv-shGPR137 groups were significantly inhibited, as demonstrated by MTT assays. There was a significant difference between Lv-shCon and Lv-shGPR137 (***p \ 0.001)
Fig. 4 Down-regulation of GPR137 inhibited the colony formation of U251 cells. Representative images of the size (a) and number (b) of colonies in Con, Lv-shCon and Lv-shGPR137 groups under fluorescent microscopy and light microscopy (94 lens). c Statistical analysis
123
Malignant glioma is the second major cause of cancerrelated deaths worldwide. Unfortunately, traditional treatments remain inadequate for attaining tumor control. More recently, signal transduction pathways and related membrane proteins especially GPCRs that are known to be pivotal in malignant glioma have been targeted with novel agents. However, some orphan GPCRs expression and function in human glioma, such as GPR137 are still not clear.
of the number of colonies with crystal violet staining. There was a significant difference between Lv-shCon and Lv-shGPR137 (**p \ 0.01)
Neurol Sci
Fig. 5 Knockdown of GPR137 arrested the cell-cycle progression in malignant glioma cell lines U251 and A172. a and b Cell cycle of U251 and A172 cells was analyzed by flow cytometry. c and d Down-
regulation of GPR137 induced S arrest in both U251 and A172 cells. There was a significant difference between Lv-shCon and LvshGPR137 (**p \ 0.01, ***p \ 0.001)
Previous studies showed that GPR137 as a ubiquitously expressed receptor is detected in central nervous system (CNS), endocrine, breast and lung [12, 13], as well as involved in some cancers tumorigenic processes in vivo. Gong et al. [14] identified that GPR137 is an estrogen receptor (ER) target genes by affecting 17b-estradiol function. Neuhaus et al. based on intracellular Ca2? flux and odorant-related compound screening found that some steroids and b-ionone can be acted as ligands for PSGR [15]. Since PSGR-induced Ca2? signaling can activate endogenous human transient receptor potential vanilloid type 6 (TRPV6) channels [16] as well as b-ionone can inhibits cell proliferation [15], PSGR signaling is considered to play an important role in prostate cancer cell progression. These studies suggested that GPR137 may be a prominent factor for affecting tumor oncogenesis and progression. Thus, in order to explore the role of GPR137 in malignant glioma, we first detected the expression levels of GPR137 mRNA in five glioma cell lines; the result showed that it was expressed in all of them. In order to assess GPR137 function in glioma cell lines, we infected human glioblastoma U251 and A172 cells with GPR137-siRNA lentivirus or control lentivirus. Compared to controls, GPR137-siRNA-treated cells showed decreased proliferation and colony formation as well as an increase in the proportion of cells in S phases. Thus, this study has showed
that GPR137 is involved in the progression of glioma, suggesting the GPR137 may act as an oncogene to promote proliferation of glioma cells. Moreover, our study indicates that GPR137 promotes human glioma growth by regulating cell-cycle progression. In conclusion, knockdown of GPR137 expression with RNAi successfully reduced malignant glioma cell proliferation and cell-cycle progression. This study may provide the basis for further exploration of the role of GPR137 in the origin and development of human malignant glioma cells. We will continue to work on the mechanism by which GPR137 functions in malignant glioma cells. Acknowledgments We thank the great help from the Second Affiliated Hospital of Anhui Medical University, and supports from National Natural Science Foundation of China (81072066).
References 1. Wen PY, Kesari S (2008) Malignant gliomas in adults. N Engl J Med 359(5):492–507. doi:10.1056/NEJMra0708126359/5/492 2. Louis DN, Ohgaki H, Wiestler OD, Cavenee WK, Burger PC, Jouvet A, Scheithauer BW, Kleihues P (2007) The 2007 WHO classification of tumours of the central nervous system. Acta Neuropathol 114(2):97–109. doi:10.1007/s00401-007-0243-4 3. Venkatakrishnan AJ, Deupi X, Lebon G, Tate CG, Schertler GF, Babu MM (2013) Molecular signatures of G-protein-coupled receptors. Nature 494(7436):185–194. doi:10.1038/nature11896
123
Neurol Sci 4. Yao X-H, Liu Y, Chen K, Gong W, Liu M-Y, Bian X-W, Wang JM (2011) Chemoattractant receptors as pharmacological targets for elimination of glioma stem-like cells. Int Immunopharmacol 11(12):1961–1966. doi:10.1016/j.intimp.2011.08.021 5. Lazarczyk M, Matyja E, Lipkowski A (2007) Substance P and its receptors—a potential target for novel medicines in malignant brain tumour therapies (mini-review). Folia Neuropathol 45(3):99–107 6. Rosenbaum DM, Rasmussen SGF, Kobilka BK (2009) The structure and function of G-protein-coupled receptors. Nature 459(7245):356–363. doi:10.1038/nature08144 7. Dorsam RT, Gutkind JS (2007) G-protein-coupled receptors and cancer. Nat Rev Cancer 7(2):79–94. doi:10.1038/nrc2069 8. Lappano R, Maggiolini M (2011) G protein-coupled receptors: novel targets for drug discovery in cancer. Nat Rev Drug Discov 10(1):47–60. doi:10.1038/nrd3320 9. Yoshida M, Miyazato M, Kangawa K (2012) Orphan GPCRs and methods for identifying their ligands. Methods Enzymol 514:33–44. doi:10.1016/B978-0-12-381272-8.00002-7 10. Bohnekamp J, Schoneberg T (2011) Cell adhesion receptor GPR133 couples to Gs protein. J Biol Chem 286(49):41912–41916. doi:10.1074/jbc.C111.265934
123
11. Shimizu M, Saitoh Y, Itoh H (1990) Immunohistochemical staining of Ha-ras oncogene product in normal, benign, and malignant human pancreatic tissues. Hum Pathol 21(6):607–612 12. Vanti WB, Nguyen T, Cheng R, Lynch KR, George SR, O’Dowd BF (2003) Novel human G-protein-coupled receptors. Biochem Biophys Res Commun 305(1):67–71 13. Regard JB, Sato IT, Coughlin SR (2008) Anatomical profiling of G Protein-coupled receptor expression. Cell 135(3):561–571. doi:10.1016/j.cell.2008.08.040 14. Gong T, Xuan J, Chen L, Riggins RB, Li H, Hoffman EP, Clarke R, Wang Y (2011) Motif-guided sparse decomposition of gene expression data for regulatory module identification. BMC Bioinformatics 12(1):82. doi:10.1186/1471-2105-12-82 15. Neuhaus EM, Zhang W, Gelis L, Deng Y, Noldus J, Hatt H (2009) Activation of an olfactory receptor inhibits proliferation of prostate cancer cells. J Biol Chem 284(24):16218–16225. doi:10. 1074/jbc.M109.012096M109.012096 16. Spehr J, Gelis L, Osterloh M, Oberland S, Hatt H, Spehr M, Neuhaus EM (2011) G protein-coupled receptor signaling via Src kinase induces endogenous human transient receptor potential vanilloid type 6 (TRPV6) channel activation. J Biol Chem 286(15):13184–13192. doi:10.1074/jbc.M110.183525
ORIGINAL ARTICLE
Inhibition of GPR137 expression reduces the proliferation and colony formation of malignant glioma cells Gang Zong • Hongliang Wang • Jia Li • Yongsheng Xie • Erbao Bian • Bing Zhao
Received: 14 November 2013 / Accepted: 3 May 2014 Ó Springer-Verlag Italia 2014
Abstract GPR137 are ubiquitously expressed in the central nervous system. However, the role of GPR137 in human malignant glioma is still poorly known. In the present study, we firstly detected the expression of GPR137 in 29 human glioma tissue specimens by immunohistochemistry and in 5 malignant glioma cell lines by quantitative RT-PCR. The expression of GPR137 was much stronger in high-grade gliomas than in low-grade gliomas. Lentivirus-mediated small interfering RNAs (siRNAs) were employed to knock down GPR137 expression in glioma cells. Inhibition of GPR137 expression by RNAi significantly inhibited the proliferation and colony-forming capacity of U251, A172 and U373 cells. Moreover, flow cytometry analysis showed that knockdown of GPR137 led to the cell-cycle arrest at the S phase. Our results indicated that GPR137 is involved in the progression of human glioma, suggesting GPR137 as a potential oncogene of glioma cells. Keywords GPR137 Glioma RNAi Proliferation Colony Cell cycle Introduction Gliomas are the most common type of primary malignancies in the central nervous system (CNS), accounting for
Electronic supplementary material The online version of this article (doi:10.1007/s10072-014-1817-2) contains supplementary material, which is available to authorized users. G. Zong H. Wang J. Li Y. Xie E. Bian B. Zhao (&) Department of Neurosurgery, The Second Affiliated Hospital of Anhui Medical University, and Cerebral Vascular Disease Research Center, Anhui Medical University, 678 Fu Rong Road, Hefei 230601, China e-mail: [email protected]
44.69 % of intracranial tumors [1]. According to the WHO classification system, gliomas are classified into four different grades [2]. Glioblastoma multiforme (GBM) is the most aggressive and lethal types of brain tumors, accounting for approximately 60–70 % of malignant gliomas. Unfortunately, despite aggressive multimodal approach and significant gains in the investigation of glioblastoma biology, GBM patients still have a dismal prognosis, with median survivals of 12–15 months [1]. A large number of studies have reported various mechanisms of tumorigenesis and progression in malignant glioma. Among these mechanisms, signal transduction between glioma cells and the surrounding microenvironment plays a pivotal role in cells survival, growth, angiogenesis, migration, invasion and metastasis [3]. The effector pathway of transducing extracellular signals into intracellular relies heavily on membrane proteins, such as epidermal growth factor receptor (EGFR), basic fibroblast growth factor receptor (bFGFR) [4] and G-protein-coupled receptors (GPCRs) at glioma cells surface [5]. Undoubtedly, G-protein-coupled receptors (GPCRs) are the largest and most diverse membrane protein families, which are encoded by more than 800 members in the human genome and share common structural components by seven transmembrane (TM) a-helical segments connected by extracellular and intracellular loops [5]. G-protein-coupled receptors can recognize a wide spectrum of extracellular signals ranging from photons to ions, amino acids, small organic molecules, lipids, peptides and entire proteins. Furthermore, the function of GPCRs is to couple the binding of these ligands in order to change the conformation by activating specific heterotrimeric G proteins, after which, cytosolic signaling networks will be activated, thereby causing various cellular responses. The function of GPCRs is to couple the binding of these ligands in order to
123
Neurol Sci
change the conformation by activating specific heterotrimeric G proteins, after which, cytosolic signaling networks will be activated, thereby causing various cellular responses [6]. Recently, GPCRs have been described as key factors in tumor growth and metastasis [7]. By hijacking the normal physiological functions of GPCRs, malignant glioma cells can survive, proliferate autonomously, escape from the immune system, increase angiogenesis, invade their surrounding tissues and migrate to other organs [7]. Nowadays, most GPCRs ligands have been found and represent between 30 and 45 % of the current drug targets [8]. However, there are still more than 100 GPCRs whose ligands had not yet been discovered [9]; these GPCRs are called orphan GPCRs. On the basis that GPCRs start as orphan GPCRs, exploring the functions and mechanisms of orphan GPCRs is important for understanding the malignant glioma biology as well as drug discovery in malignant glioma prevention and treatment. GPR137 is an oGPCR-encoding gene and ubiquitously expressed in the central nervous system (CNS), mainly in the hippocampus [10]. It has been found that GPR133, GPR134, GPR135, GPR136, and GPR137, as a group, share 40–50 % homology with each other and GPR137 most closely resemble a prostate-specific odorant-like orphan GPCR (PSGR). Prostate-specific odorant-like orphan has been found to have restricted expression in human prostate tissues and used as diagnostic marker of prostate cancer. Its signaling has also been involved in prostate cancer cell progression. GPR133 as a member of the adhesion GPCR subfamily can activate the G(s) protein/adenylyl cyclase pathway. However, the function of GPR137 in glioma has not been investigated. To explore the potential role of GPR137 in human malignant glioma, we began with an expression analysis of GPR137 protein in human glioma specimens. The expression of GPR137 was subsequently detected in five glioma cell lines. We employed lentivirus-mediated siRNA to down-regulate GPR137 expression in two glioma cell lines, U251 and A172. Finally, the effects of GPR137 knockdown on glioma cell proliferation, colony formation and cell-cycle progression were investigated.
Materials and methods Immunohistochemistry Before the study began, written informed consent was obtained from all patients who participated in the study, which was approved by the ethics committee of the second affiliated hospital of Anhui Medical University. Twentynine glioma samples were obtained from March 2010 to September 2011 from the Department of Neurosurgery at
123
the Second Affiliated Hospital of Anhui Medical University [14 low-grade gliomas (I, II) cases, 15 high-grade gliomas (III, IV); grades were determined according to the 2007 WHO classification of tumors of the central nervous system]. All tumors were from patients with newly diagnosed gliomas who had received no therapy before sample collection. Tissue samples were paraffin embedded, dewaxed and rehydrated. The sections were then microwaved for antigen retrieval. For immunohistochemical staining, slides were treated with hydrogen peroxide (H2O2) for 10 min, washed with ddH2O and placed in PBS buffer. Anti-GPR137 (1:150 dilution; #11929-1-AP, Proteintech Group, Inc.) was then applied for incubation at room temperature. Biotinylated goat anti-rabbit IgG was used as the secondary antibody. The immunoreactions were detected by staining with 3,30 -diaminobenzidine (DAB). All stained slides were evaluated in a double-blinded manner by three pathologists independently, and the scores were supplied by the proportion of positive tumor cells and the intensity of the coloring [11]. The result of the tissues was determined from at least 1,000 cells that were counted systematically in ten visual fields selected at random. The proportion of positive tumor cells were recorded according to the following classification: 0, no cells stained; 1, \20 % of cells stained; 2, 20–60 % of cells stained and 3, [60 % of cells stained. However, the groups could also be classified into the following 4 groups by the intensity of the coloring: 0, no coloring; 1, yellowish; 2, brownish-yellow; and 3, dark brown. The two scores were combined to obtain the final one: scores from 0 to 1 indicate negative (-), whereas scores from 2 to 4 indicate weak positive (?), and 5–6 indicate strong positive (??). Cell culture Human glioblastoma cell lines U251, U-87MG, U373, A172, U-118MG and human embryonic kidney cell line 293T were cultured in Dulbecco’s modified Eagle medium (DMEM, Hyclone) with 10 % heat inactivated fetal bovine serum (FBS, Hyclone), in a humidified atmosphere containing 5 % CO2 at 37 °C. All cell lines were purchased from the cell bank type culture collection of Chinese Academy of Sciences (Shanghai, China). Construction of GPR137 shRNA lentivirus vector and cell infection The following stem–loop–stem oligos were synthesized. The negative control short-hairpin RNA (shRNA) was 50 CTAGCCCGGTTCTCCGAACGTGTCACGTATCTCGA GATACGTGACACGTTCGGAGAATTTTTTTAAT-3 0 . GPR137 shRNA was 50 -GATCCGAACAAAGGCTACCT
Neurol Sci
GGTATTCTCGAGAATACCAGGTAGCCTTTGTTCTT TTTTG-30 . The oligos were annealed and ligated into the pFH-L vector (Shanghai Hollybio, China). The lentiviralbased shRNA-expressing vectors were determined by DNA sequencing. The generated plasmids were named as pFH-LL-shGPR137 or -shCon. Recombinant lentiviral vectors and packaging vectors were transfected into 293T cells. Supernatants containing lentivirus expressing GPR137 shRNA or control shRNA were harvested 3 days after transfection. After then, the lentiviruses were purified via ultracentrifugation, and the titer of lentiviruses was confirmed. U251 and A172 were infected with the lentivirus constructs at 10 MOI and mock-infected cells were used as negative controls.
MTT assay U251 and A172 were, respectively, trypsinized, resuspended, seeded into 96-well plate with a concentration of 2,300 and 2,500 cells per well, and incubated at 37 °C 4 days post-lentivirus infection. On the following day 1, 2, 3, 4 and 5, to measure the cell number, 10 ll of 5 mg/ml MTT was added to the cultured cells, which were further incubated for 3 h. After removing the remaining medium, 100 ll of acidified isopropanol (in 0.01 M HCl) was added to each well at the end of incubation. The absorption value was measured at 595 nm on the spectrophotometer. Colony formation assay
Quantitative RT-PCR analysis Total cellular RNAs from the five cell lines were extracted using the Trizol reagent. cDNA was synthesized using M-MLV reverse transcriptase according to the protocol of the supplier. In brief, 1.5 lg of total RNA, 0.75 lg oligodT primer and nuclease-free water constituted a mixture and heated at 70 °C for 5 min and cooled on ice for another 5 min. Then the mixture was supplemented with 4 ll MMLV buffer, 0.5 ll RNasin, 0.75 ll M-MLV-RT and 1.25 ll dNTP up to a final volume of 20 ll, followed by incubation at 42 °C for 60 min. Each PCR reaction mixture comprised 10 ll of 29 SYBR Green Master Mix, 5 ll of cDNA (10 ng) and 0.8 ll of sense and antisense primers (2.5 lmol/ll), was run for 40 cycles with an initial denaturation at 95 °C for 60 s, followed by denaturation at 95 °C for 5 s and 60 °C for 30 s. The 2-DDCT method was applied to analyze the relative changes in gene expression levels, the primer sequences for PCR amplification of GPR137 gene were 50 -ACCTGGGGAACAAAG GCTAC-30 as well as 50 -TAGGACCGAGAGGCAAA GAC-30 . b-actin was used as an internal control. The primer sequences of b-actin were 50 -GTGGACATCCGCAAA GAC-30 as well as 50 - AAAGGGTGTAACGCAACTA-30 . Western blot U251 cells and A172 were collected 5 days after infection with the lentivirus constructs, and total protein was isolated from the cells and quantified by the bicinchoninic acid (BCA) method. Protein (20 lg) was loaded onto a 10 % SDS-PAGE and transferred to a polyvinylidene difluoride membrane (Millipore). Next, proteins were detected by their respective antibodies using an ECL kit (Amersham) and exposed to X-ray film. The protein level of GAPDH was used as a control and was detected by an anti-GAPDH antibody. Bands on the X-ray films were quantified with an ImageQuant densitometric scanner (Molecular Dynamics).
A total of 200 U251 and 400 U373 cells were, respectively, seeded in six-well plates after 4 days of lentivirus infection. The medium was changed at regular time intervals. The natural colonies were washed with PBS after 11 days of culture at 37 °C, and fixed with 4 % paraformaldehyde for 30 min at room temperature. The colonies were then stained by crystal violet for 10 min, and washed with water and airdried. The total number of colonies which contain more than 50 cells was counted under fluorescence microscopy. Fluorescence-activated cell sorting analysis The cell-cycle distribution was analyzed by flow cytometry with PI staining. In brief, 3,500 cells that were infected with lentivirus for 4 days were incubated in six-well plates and allowed to culture at 37 °C for 40 h. Cells were harvested after tripsinization, washed with ice-cold phosphate-buffered saline (PBS) and fixed with 70 % ice-cold ethanol. Then, cells were collected by centrifugation and resuspended in PBS containing RNase (100 lg/ml) and propidium iodide (PI, 40 lg/ml), and seeded at 37 °C for 1 h. Finally, 1.0 9 104 fixed cells were analyzed for the cell-cycle phase by FACS can (Cell Lab Quanta Beckman Coulter). Statistical analysis All values in the text and figures are expressed as the mean ± SD of at least triplicate determination. The Student’s t test was used for data analysis using the SPSS 13.0 software. A value of p \ 0.05 was considered statistically significant.
Results The expression levels of GPR137 protein in glioma tissue samples To determine the potential role of GPR137 in human glioma progression, we evaluated GPR137 expression in 29
123
Neurol Sci
Fig. 1 Representative immunohistochemical staining of GPR137 in glioma patients. All stained slides were evaluated under light microscope (920 lens). a Negative, the score equal to 0. b Weak
positive, the score equal to 2. c Weak positive, the score equal to 3. d Weak positive, the score equal to 4. e Strong positive, the score equal to 5. f Strong positive, the score equal to 6
surgical glioma specimens by immunohistochemistry. Representative immunohistochemical staining was shown in Fig. 1. The expression of GPR137 was significantly higher in high-grade gliomas (WHO grade III and IV) than in low-grade gliomas (WHO grade I and II), suggesting that GPR137 is related to glioma malignancy (Table 1, p \ 0.05, Fisher’s exact test).
Table 1 The relationship between the incidence of immunoreactivity for GPR137 in human glioma tissue specimens and the histological grades (N = 29) Sample
14
11 (78.6 %)
3 (21.4 %)
Lentivirus-mediated shRNA inhibited GPR137 mRNA and protein expression in U251 and A172 cells
Low-grade gliomas (I, II) High-grade gliomas (III, IV)
15
5 (35.3 %)
10 (66.7 %)
We detected the expression of GPR137 mRNA in glioma cell lines by qRT-PCR. As shown in Fig. 2a, GPR137 mRNA was expressed in all five cell lines. Then U251 and A172 cell lines were used for loss-of-function investigation
123
N
Expression of GPR137 Weak positive
p value*
Strong positive 0.0253
* Fisher’s exact test
in the following study. To verify whether the recombinant lentiviruses were able to infect human glioma cell lines, cells infected with Lv-shGPR137 and Lv-shCon were
Neurol Sci
Fig. 2 Knockdown of GPR137 expression using lentivirus-mediated RNAi in glioma cells. a The expression of GPR137 mRNA in five glioma cell lines was examined by qRT-PCR. b More than 90 % of U251 and A172 cells expressed GFP (910 lens). There was no significant difference between Lv-shCon group and the non-transfected group, suggesting the transfection process had no effect on cell growth. Expression analyses of GPR137 mRNA levels in U251
(c) and A172 (d) cells infected with Lv-shCon and Lv-shGPR137 by qRT-PCR. Expression analyses of GPR137 protein levels in U251 (e) and A172 (f) cells infected with Lv-shCon and Lv-shGPR137 by western blot. Con: cells without infection; Lv-shCon: cells infected with the Lv-shCon; Lv-shGPR137: cells infected with the LvshGPR137. There was a significant difference between Lv-shCon and Lv-shGPR137 (***p \ 0.001)
observed under a fluorescence microscope. Four days postinfection, efficiencies were [90 % (Fig. 2b), indicating high-efficiency infection by the lentivirus. To determine that the GPR137 gene was silenced by Lv-shGPR137, the mRNA and protein levels in U251 cells and A172 were evaluated using qRT-PCR and western blot. The mRNA levels of GPR137 were remarkably decreased in U251, A172 and U373 cells infected with the Lv-shGPR137 (p \ 0.001, Fig. 2c, d; p \ 0.01, Figure S1A). Moreover, as shown in Fig. 2e, f, the protein levels of GPR137 were consistently down-regulated in Lv-shGPR137 groups, compared with Lv-shCon groups.
Fig. 3a) and 52.7 % reduction in A172 cells (p \ 0.001, Fig. 3b), respectively. The results indicate that silencing of GPR137 inhibits the proliferation of glioma cells.
Effects of GPR137 knockdown on cell proliferation To investigate the effect of GPR137 knockdown on cell proliferation, MTT assay was performed in U251 and A172 cell lines following 5 days of lentivirus infection. In comparison with control lentivirus infected cells, deletion of GPR137 significantly inhibited the proliferation of both cell lines, by 37.4 % reduction in U251 cells (p \ 0.001,
Effects of GPR137 knockdown on colony-forming ability of glioma cells To detect the effect of GPR137 on the colony-forming capacity of glioma cells, the colony formation assay was performed in U251 and U373 cells. As shown in Fig. 4a, b, the size of each colony and the number of colonies formed in U251 cells infected with Lv-shGPR137 were significantly decreased when compared with those in uninfected and Lv-shCon infected cells. Knockdown of GPR137 could markedly suppress the colony formation of U251 cells (p \ 0.01, Fig. 4c). Similarly, down-regulation of GPR137 also suppressed the colony formation of U373 cells (p \ 0.001, Figure S1B and C). These results indicated that the reduced expression of GPR137 could significantly inhibit the colony formation in human glioma cells.
123
Neurol Sci
Effects of GPR137 knockdown on cell-cycle distribution To determine whether GPR137 is necessary for cell-cycle progression of the glioma cells, we assessed the cell-cycle distribution in U251 and A172 cells by flow cytometry (Fig. 5a, b). Compared to Lv-shCon groups, the cell percentages of S phase in Lv-shGPR137 groups were significant increased in both U251 and A172 cells (p \ 0.01, p \ 0.001, Fig. 5c, d). Concomitantly, the cell percentages of G0/G1 and G2/M phases were decreased in U251 and A172 cells after Lv-shGPR137 infection. The results indicated that knockdown of GPR137 could attenuate glioma cell growth and block cell-cycle progression. Discussion
Fig. 3 Effect of GPR137 knockdown on the proliferation of malignant glioma cell lines U251 (a) and A172 (b). The proliferation rates in the Lv-shGPR137 groups were significantly inhibited, as demonstrated by MTT assays. There was a significant difference between Lv-shCon and Lv-shGPR137 (***p \ 0.001)
Fig. 4 Down-regulation of GPR137 inhibited the colony formation of U251 cells. Representative images of the size (a) and number (b) of colonies in Con, Lv-shCon and Lv-shGPR137 groups under fluorescent microscopy and light microscopy (94 lens). c Statistical analysis
123
Malignant glioma is the second major cause of cancerrelated deaths worldwide. Unfortunately, traditional treatments remain inadequate for attaining tumor control. More recently, signal transduction pathways and related membrane proteins especially GPCRs that are known to be pivotal in malignant glioma have been targeted with novel agents. However, some orphan GPCRs expression and function in human glioma, such as GPR137 are still not clear.
of the number of colonies with crystal violet staining. There was a significant difference between Lv-shCon and Lv-shGPR137 (**p \ 0.01)
Neurol Sci
Fig. 5 Knockdown of GPR137 arrested the cell-cycle progression in malignant glioma cell lines U251 and A172. a and b Cell cycle of U251 and A172 cells was analyzed by flow cytometry. c and d Down-
regulation of GPR137 induced S arrest in both U251 and A172 cells. There was a significant difference between Lv-shCon and LvshGPR137 (**p \ 0.01, ***p \ 0.001)
Previous studies showed that GPR137 as a ubiquitously expressed receptor is detected in central nervous system (CNS), endocrine, breast and lung [12, 13], as well as involved in some cancers tumorigenic processes in vivo. Gong et al. [14] identified that GPR137 is an estrogen receptor (ER) target genes by affecting 17b-estradiol function. Neuhaus et al. based on intracellular Ca2? flux and odorant-related compound screening found that some steroids and b-ionone can be acted as ligands for PSGR [15]. Since PSGR-induced Ca2? signaling can activate endogenous human transient receptor potential vanilloid type 6 (TRPV6) channels [16] as well as b-ionone can inhibits cell proliferation [15], PSGR signaling is considered to play an important role in prostate cancer cell progression. These studies suggested that GPR137 may be a prominent factor for affecting tumor oncogenesis and progression. Thus, in order to explore the role of GPR137 in malignant glioma, we first detected the expression levels of GPR137 mRNA in five glioma cell lines; the result showed that it was expressed in all of them. In order to assess GPR137 function in glioma cell lines, we infected human glioblastoma U251 and A172 cells with GPR137-siRNA lentivirus or control lentivirus. Compared to controls, GPR137-siRNA-treated cells showed decreased proliferation and colony formation as well as an increase in the proportion of cells in S phases. Thus, this study has showed
that GPR137 is involved in the progression of glioma, suggesting the GPR137 may act as an oncogene to promote proliferation of glioma cells. Moreover, our study indicates that GPR137 promotes human glioma growth by regulating cell-cycle progression. In conclusion, knockdown of GPR137 expression with RNAi successfully reduced malignant glioma cell proliferation and cell-cycle progression. This study may provide the basis for further exploration of the role of GPR137 in the origin and development of human malignant glioma cells. We will continue to work on the mechanism by which GPR137 functions in malignant glioma cells. Acknowledgments We thank the great help from the Second Affiliated Hospital of Anhui Medical University, and supports from National Natural Science Foundation of China (81072066).
References 1. Wen PY, Kesari S (2008) Malignant gliomas in adults. N Engl J Med 359(5):492–507. doi:10.1056/NEJMra0708126359/5/492 2. Louis DN, Ohgaki H, Wiestler OD, Cavenee WK, Burger PC, Jouvet A, Scheithauer BW, Kleihues P (2007) The 2007 WHO classification of tumours of the central nervous system. Acta Neuropathol 114(2):97–109. doi:10.1007/s00401-007-0243-4 3. Venkatakrishnan AJ, Deupi X, Lebon G, Tate CG, Schertler GF, Babu MM (2013) Molecular signatures of G-protein-coupled receptors. Nature 494(7436):185–194. doi:10.1038/nature11896
123
Neurol Sci 4. Yao X-H, Liu Y, Chen K, Gong W, Liu M-Y, Bian X-W, Wang JM (2011) Chemoattractant receptors as pharmacological targets for elimination of glioma stem-like cells. Int Immunopharmacol 11(12):1961–1966. doi:10.1016/j.intimp.2011.08.021 5. Lazarczyk M, Matyja E, Lipkowski A (2007) Substance P and its receptors—a potential target for novel medicines in malignant brain tumour therapies (mini-review). Folia Neuropathol 45(3):99–107 6. Rosenbaum DM, Rasmussen SGF, Kobilka BK (2009) The structure and function of G-protein-coupled receptors. Nature 459(7245):356–363. doi:10.1038/nature08144 7. Dorsam RT, Gutkind JS (2007) G-protein-coupled receptors and cancer. Nat Rev Cancer 7(2):79–94. doi:10.1038/nrc2069 8. Lappano R, Maggiolini M (2011) G protein-coupled receptors: novel targets for drug discovery in cancer. Nat Rev Drug Discov 10(1):47–60. doi:10.1038/nrd3320 9. Yoshida M, Miyazato M, Kangawa K (2012) Orphan GPCRs and methods for identifying their ligands. Methods Enzymol 514:33–44. doi:10.1016/B978-0-12-381272-8.00002-7 10. Bohnekamp J, Schoneberg T (2011) Cell adhesion receptor GPR133 couples to Gs protein. J Biol Chem 286(49):41912–41916. doi:10.1074/jbc.C111.265934
123
11. Shimizu M, Saitoh Y, Itoh H (1990) Immunohistochemical staining of Ha-ras oncogene product in normal, benign, and malignant human pancreatic tissues. Hum Pathol 21(6):607–612 12. Vanti WB, Nguyen T, Cheng R, Lynch KR, George SR, O’Dowd BF (2003) Novel human G-protein-coupled receptors. Biochem Biophys Res Commun 305(1):67–71 13. Regard JB, Sato IT, Coughlin SR (2008) Anatomical profiling of G Protein-coupled receptor expression. Cell 135(3):561–571. doi:10.1016/j.cell.2008.08.040 14. Gong T, Xuan J, Chen L, Riggins RB, Li H, Hoffman EP, Clarke R, Wang Y (2011) Motif-guided sparse decomposition of gene expression data for regulatory module identification. BMC Bioinformatics 12(1):82. doi:10.1186/1471-2105-12-82 15. Neuhaus EM, Zhang W, Gelis L, Deng Y, Noldus J, Hatt H (2009) Activation of an olfactory receptor inhibits proliferation of prostate cancer cells. J Biol Chem 284(24):16218–16225. doi:10. 1074/jbc.M109.012096M109.012096 16. Spehr J, Gelis L, Osterloh M, Oberland S, Hatt H, Spehr M, Neuhaus EM (2011) G protein-coupled receptor signaling via Src kinase induces endogenous human transient receptor potential vanilloid type 6 (TRPV6) channel activation. J Biol Chem 286(15):13184–13192. doi:10.1074/jbc.M110.183525
