Ecotoxicology and Environmental Safety 113 (2015) 491–498

Contents lists available at ScienceDirect

Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv

Assessment of pesticide residues and gene expression in common carp exposed to atrazine and chlorpyrifos: Health risk assessments Houjuan Xing a,b,1, Zhilei Wang b,1, Hongda Wu c, Xia Zhao a, Tao Liu a, Shu Li a, Shiwen Xu a,n a

College of Veterinary Medicine, Northeast Agricultural University, 59 Mucai Street, Harbin 150030, PR China Animal Health Supervision Institute of Heilongjiang Province, 243 Haping Road, Xiangfang District, Harbin 150069, PR China c Institute of Animal Science, Academy of Agricultural Sciences of Heilongjiang Province, 368 Xuefu Road, Xiangfang District, Harbin 150086, PR China b

art ic l e i nf o

a b s t r a c t

Article history: Received 29 September 2014 Received in revised form 3 December 2014 Accepted 27 December 2014

This study assessed the impacts of atrazine (ATR), chlorpyrifos (CPF) and combined ATR/CPF exposure on the kidney of common carp (Cyprinus carpio L.). The carp were sampled after a 40-d exposure to CPF and ATR, individually or in combination, followed by a 40-d recovery to measure the expression levels of heat shock proteins genes (HSP60, HSP70 and HSP90) and pesticide residues in the kidney tissue. The results revealed that the mRNA and protein levels of HSP60, HSP70 and HSP90 were induced in the kidney of common carp by ATR, CPF, and ATR/CPF mixture. The accumulated amounts of ATR, CPF, and their metabolites in the kidney tissues exhibited dose-dependency. These results exhibited that increasing concentration of ATR and CPF in the environment causes considerable stress for common carp, suggesting that the expression levels of HSP60, HSP70 and HSP90 may act as potential biomarkers for assessing the environmental ATR and CPF risk for carp. & 2015 Published by Elsevier Inc.

Keywords: Heat shock proteins Pesticide residues mRNA Western blot Fish

1. Introduction In agricultural areas worldwide, there is an increasing concern about watershed contamination due to the widespread use of pesticides. Atrazine (ATR) is one of the most widely used pesticides in the world, mainly due to its relatively low cost and ease of application. Chlorpyrifos (CPF) is a conventional organophosphorous insecticide and is widely used to control a variety of pests in agriculture and animal farm (Saulsbury et al., 2009). ATR and CPF are considered a moderately persistent chemical in the environment with a halflife ranging from a few days to months (Song et al., 2009; Palma et al., 2009). ATR is found in relatively low levels in the environment, usually less than 1 ppb, but can be found at levels as high as 21 ppb in groundwater, 42 ppb in surface waters, 102 ppb in river basins in agricultural areas, and up to 224 ppb in Midwestern streams during May–August (Kolpin et al., 1998; Powell et al., 2011). ATR concentrations of up to 108 μg/L have been reported in rivers of North America (USEPA, 2002). CPF has been detected in surface waters at average levels of 0.01– 1.95 μg/L (Cerejeira et al., 2003; Palma et al., 2009). Direct application of CPF to water bodies to control mosquitoes or agricultural run-off from treated areas can result in CPF contamination of up to n

Corresponding author. Fax: þ 86 451 55190407. E-mail address: [email protected] (S. Xu). 1 These authors contributed equally to this work.

http://dx.doi.org/10.1016/j.ecoenv.2014.12.040 0147-6513/& 2015 Published by Elsevier Inc.

4.3 μg/L in streams and lakes (Thomas and Nicholson, 1989; Richards and Baker, 1993; Wood and Stark, 2002). Because of extensive usage and moderate solubility in water, they have been commonly detected as a contaminant in surface and ground-water of many countries (Banks et al., 2005; Du Preez et al., 2005; Zhou et al., 2009). With intensive use of these agricultural chemicals in recent years, the toxic effects have become a great threat to the health of human and aquatic animals (Nakadai et al., 2006; Rowe et al., 2007; Moore et al., 2007; Ali et al., 2008; Ernst et al., 2014). ATR has induced severe hormonal disturbances in amphibians (Hayes et al., 2002) and tumors in rats (Peyre et al., 2014). ATR has been classified as a possible human carcinogen by the International Agency for Research on Cancer (1999). In recent years, the highly conserved family of heat shock proteins (HSPs) has received extensive attention for their roles in response to stress. Members of different HSP families are grouped according tomolecular size and perform varying and different roles in the cell. The HSP60 is involved in protein stability and folding (Cechetto et al., 2000), the HSP70 family is necessary for translocation and protein folding (Xing et al., 2013), and the HSP90 family is involved in steroid receptor formation and protein folding (Liu et al., 2013a). These HSP families are important for immune function (Wallin et al., 2002) and have been demonstrated to be upregulated in fish during stress (Xing et al., 2013). Numerous reports analyzed the effects of environmental stressors on the expression of HSP60, HSP70 and HSP90 genes in fish, including pesticide accumulation (Dowling et al., 2006; Yang et al., 2010a),

492

H. Xing et al. / Ecotoxicology and Environmental Safety 113 (2015) 491–498

PCBs (Na et al., 2009), PAHs (Abdel-Gawad and Khalil, 2013) and heavy metal accumulation (Rajeshkumar and Munuswamy, 2011). However, there are only a few papers on the expression alterations of HSP60, HSP70 and HSP90 genes in fish challenged by pesticide (Liu et al., 2013a; Yang et al., 2010b). Of particular interest is the joint toxicity of CPF and ATR, which has been shown to exhibit greater than additive toxicity to several aquatic invertebrate species (Schuler et al., 2005). There are only a few reports focusing on the joint toxicity of ATR and CPF on vertebrate species, and the present study focused on aspects of acute toxicity (Wacksman et al., 2006). Among many aquatic organisms, fish is a valuable biomonitor of environmental pollution, including common carp (Cyprinus carpio L.). The major function of the kidney in fish is to maintain body fluid homeostasis, the same as higher vertebrates, but additionally, it is a major lymphoid organ (Press and Evensen, 1999). Thus, a study of the primitive kidney of vertebrates as exemplified by fish is of particular importance to fully understand the immune system of all vertebrates. Here, we examined the mRNA and protein levels of HSP60, HSP70 and HSP90 genes in the kidney of common carp exposed to ATR and CPF alone and in combination by quantitative real-time PCR and western blot.

2. Materials and methods 2.1. Fish All procedures used in the present study were approved by the Institutional Animal Care and Use Committee of Northeast Agricultural University. The fish model was developed as described in our previous article (Xing et al., 2012). The common carp (mean body length, 12.5 71.29 cm; mean body weight, 190710 g) used in this study were purchased from an aquarium specializing in freshwater fish species and maintained in laboratory tanks (90  55  45 cm3) with continuous aeration. The fish were acclimated to experimental conditions for 15 d using dechlorinated tap water (CaCO3: 230 73.16 mg/L, Ca: 42.57 1.2 mg/L; dissolved oxygen concentration remained above 7 mg/L; pH 7.47 0.2). The water temperature was adjusted to 20 71 °C and the photoperiod was 12 h of light and 12 h of dark. Fish were fed once a day with commercial food (Jiaji Co., Zhenjiang, China) according to the manufacturer's guidelines during the acclimation and experimental period. 2.2. Chemicals ATR (purity 98.0%) and CPF (purity 99.5%) were purchased from Sigma-Aldrich Chemical Co. (USA). Stock solutions of ATR and CPF were prepared in analytical grade acetone (purity 99%), and all working solutions were made from this stock solution. The concentration of acetone was kept at o0.05% in all pesticide solutions used. 2.3. Experimental design 2.3.1. Exposure test Experimental fish were randomly divided into eleven groups: three ATR treatment groups (4.28, 42.8 and 428 μg/L), three CPF treatment groups (1.16, 11.6 and 116 μg/L), three ATR/CPF combination treatment groups (1.13, 11.3 and 113 μg/L), one solvent control (acetone) group, and one water control group. The binary mixtures were composed of a 1:1 mass ratio of ATR and CPF. Each treatment group was 20 fish and 2 replicates. ATR and CPF are stable in water and have a long half-life. The concentrations used in the present study have been found in the environment. The fish

were exposed under semi-static conditions for 40 d to water and pesticide, which were completely replaced once every 2 d by transferring fish to freshly prepared pesticide solutions. At the end of the exposure, fish were sacrificed by decapitation and then bled. The kidneys were then excised immediately on an ice-cold plate and washed in physiological saline solution (0.86% NaCI). The tissues were stored at  80 °C for the RNA and protein isolation and the determination of tissue pesticide contents. 2.3.2. Recovery test Ten fish from each exposure group were kept as a set in fresh, pesticide-free water for 40 d in large 200 L glass aquaria with filters and continuous aeration. The conditions during the recovery experiment were the same as those described above. In this study, there were ten fish per group killed at the two sampling events, and five fish per group were used in official test. The remaining tissues were used in preliminary experiment and served as standby tissues. During the experiment, no mortality was observed over the course of the experiment in either the control fish or in any of the treatment groups. 2.4. Tissue pesticide content analysis 2.4.1. Tissue ATR content analysis Tissue samples were homogenized and extracted by the method of Wang et al. (2013). The extracts were filtered and combined, and then 3 g of NaCI was added successively to each sample and dissolved by shaking the suspension. The filtrate was re-extracted three times with 30 mL of trichloromethane. The extracts were combined, passed through anhydrous Na2SO4 columns, and collected. The eluates were concentrated into a triangular flask by rotary evaporation, dissolved with 1.5 mL of methanol, and filtered. The concentrations of ATR in extracts were analyzed with an Agilent high-performance liquid chromatography (HPLC) system. HPLC was performed with Waters equipment, equipped with a diode array using an ODS 5-micron Hypersil capillary column (250 mm long, 4.6 mm in diameter) following the procedures described by Muňoz and Rosés (2000). Mobile phases used in the isocratic elution were distilled water and methanol (v/v: 20/80). The column head temperature was 25 °C and flow rate was held constant at 1 mL/min. The volume injected was 10 μL. The eluents were monitored by UV detection of a wavelength of 222 nm for ATR, atrazine-2-hydroxy, and atrazinedesethyl. 2.4.2. Tissue CPF content analysis For CPF content analysis, approximately 2 g (wet wt) of stored soft tissues samples was weighed in a centrifuge tube (50 mL). Each sample received 1 g of anhydrous Na2SO4 and 10 mL of acetidin and was homogenized using an IKA homogenizer at 6000 rev/min for 2 min. Then, the tool bit was washed using 10 mL of acetidin. The homogenate was centrifuged at 5000 rev/min for 5 min to obtain the supernatant. The residue in the centrifuge tube was re-extracted once with 10 mL of acetidin and centrifuged. The two supernatants were concentrated into a rotary evaporation flask by rotary evaporation at 40 °C, and the precipitate was dissolved with 5 mL of acetonitrile by convolution agitate and supersonic ablution. The extracts were passed through Acor aluminum oxide columns and collected. The eluates were evaporated to dryness under a nitrogen stream at 50 °C. The residue was finally dissolved in 2 mL of N-hexane and filtered for the HPLC analysis of the concentrations of CPF in extracts. The HPLC procedure was similar to the method used by Abu-Qare and Abou-Donia (2001). Briefly, mobile phases used in the isocratic elution were distilled with water and acetonitrile (v/v: 40/60). The column head temperature was 25 °C, and the flow rate was held constant at 1 mL/

H. Xing et al. / Ecotoxicology and Environmental Safety 113 (2015) 491–498

Table 1 Gene-special primer for HSP60, HSP70, HSP90 and β-actin used in the real-time PCR. Gene

Accession number

Primer (5′-3′)

Product size (bp)

HSP60

BC068415

90

HSP70

AY035309.1

HSP90

AF068773

Forward: CGCTCAGGTGGCTACTATTTC Reverse: ACACCCTTACGACCGACTTTC Forward: TGAGAACATCAACGAGCCCA Reverse: TTGTCAAAGTCCTCCCCACC Forward: CTTGAGGAAGGCGAGAAAC Reverse: ATCCTCCCAGTCATTGCTT Forward: GATGGACTCTGGTGATGGTGTGAC Reverse: TTTCTCTTTCGGCTGTGGTGGTG

β-Actin AF057040

195 261 167

493

2.6. Total RNA isolation and reverse transcription Total RNA was isolated from the livers of each fish using Trizol reagent according to the manufacturer's instructions (Invitrogen). The reverse transcription reactions (40 mL) consisted of 10 mg of total RNA, 1 mL of Moloney murine leukemia virus reverse transcriptase, 1 mL of RNase inhibitor, 4 mL of deoxynucleoside triphosphate, 2 mL of Oligo dT, 4 mL of dithiothreitol, and 8 mL of 5  reverse transcriptase buffer. The reverse transcription procedure used was based on instructions from the manufacturer (Invitrogen). Quantitative RT-PCR was used to detect the expression of the HSP60 gene using SYBR Premix Ex Taq (Takara, Shiga, Japan), and quantitative RT-PCR was conducted on each of the liver tissues.

Table 2 Concentrations of ATR and its metabolites in the kidney from the common carp after exposure and a recovery period. Treatment groups

Acetone control Atrazine (μg/L)

Mixture of atrazine and chlorpyrifos (μg/L)

ATR (mg/kg)

0 4.28 42.8 428 1.13 11.3 113

Atrazine-desethyl (mg/kg)

Atrazine-2-hydroxy (mg/kg)

Exposure

Recovery

Exposure

Recovery

Exposure

Recovery

n.d. 0.177 0.006 1.717 0.021 4.59 7 0.126 0.217 0.005 1.69 7 0.099 4.26 7 0.156

n.d. 0.08 70.003 0.46 70.007n 0.19 70.003n 0.03 70.001n 0.43 70.006n 0.29 70.004n

n.d. 0.777 0.017 2.247 0.085 4.86 7 0.129 0.94 7 0.002 2.25 7 0.106 2.63 7 0.143

n.d. 0.09 70.002n 0.56 70.019n 0.45 70.015n 0.17 70.008n 0.48 70.013n 0.79 70.025n

n.d. 0.46 7 0.017 0.90 7 0.043 4.127 0.134 0.87 7 0.026 1.39 7 0.047 3.60 7 0.125

n.d. 0.08 7 0.003n 0.42 7 0.014n 0.32 7 0.011n 0.167 0.013n 0.667 0.021n 0.26 7 0.012n

Note: Values are the means 7 SD (n ¼5). n.d. indicates not determined results. n

Significant differences (Po 0.05) between the exposure group and the recovery group at the same concentration.

Table 3 Concentrations of CPF and its metabolites in the kidney from the common carp after exposure and a recovery period. Treatment groups

Control Chlorpyrifos (μg/L)

Mixture of atrazine and chlorpyrifos (μg/L)

CPF (mg/kg)

0 1.16 11.6 116 1.13 11.3 113

Chlorpyrifos-oxon (mg/kg)

Exposure

Recovery

Exposure

Recovery

n.d. 0.177 0.012 1.157 0.108 2.487 0.005 0.217 0.017 0.84 7 0.048 1.85 7 0.087

n.d. 0.03 7 0.003n 0.497 0.033n 0.82 7 0.042n 0.08 7 0.003n 0.277 0.013n 0.65 7 0.019n

n.d. 0.66 7 0.041 1.03 7 0.081 9.47 7 0.169 0.51 7 0.037 1.247 0.117 7.94 7 0.171

n.d. 0.107 0.006n 0.43 7 0.022n 0.38 7 0.034n 0.127 0.013n 0.497 0.012n 0.747 0.001n

Note: Values are the means 7 SD (n ¼5). n.d. indicates not determined results. n

Significant differences (Po 0.05) between the exposure group and the recovery group at the same concentration.

min. The volume injected was 10 μL. The eluents were monitored by UV detection at a wavelength of 230 nm for CPF and chlorpyrifos-oxon.

2.5. Primer design The primers for real-time amplification of the HSP60, HSP70, HSP90 and β-actin cDNA were designed using Oligo_6.0 Software (Molecular Biology Insights, Cascade, CO) based on the deposited sequences in GenBank under the accession numbers BC061485, AY035309.1, AF068773 and AF057040 (Table 1). β-actin (GenBank accession no. AF057040), a house-keeping gene was used as an internal reference. BLASTX and BLASTN were used to determine PCR assay specificity. The reaction specificity of each assay was verified by observing a single peak in the melting curve. The quantitative RT-PCR work was conducted according to the MIQE guidelines (Bustin et al., 2009).

The reaction mixtures were incubated in an ABI PRISM 7500 quantitative RT-PCR system (Applied Biosystems, Foster City, CA). The following program was used: 1 cycle at 95 °C for 30 s followed by 40 cycles at 95 °C for 5 s and at 60 °C for 34 s. Dissociation curves were analyzed with Dissociation Curve 1.0 software (Applied Biosystems) for each quantitative RT-PCR reaction to detect and eliminate the possible primer-dimer and nonspecific amplifications. The magnitude of change in gene expression relative to ΔΔ acetone control was determined by the 2  Ct method of Livak and Schmittgen (2001). 2.7. Western blot analysis An equivalent amount of tissue (depending on the tissue examined, between 50 and 150 mg) was homogenized in 800 mL of ice-cold grind buffer (20 mM Tris–HCl, pH 7.4, 2 mM EDTA, 2 mM EGTA, 1 mM PMSF, 30 mM NaF, 30 mM sodium pyrophosphate, 0.1% SDS, 1% Triton X-100 and protease inhibitor cocktail). The sample was then centrifuged for 10 min at 10,000 g at 4 °C, and

494

H. Xing et al. / Ecotoxicology and Environmental Safety 113 (2015) 491–498

Fig. 1. Effects of ATR, CPF and ATR/CPF mixture on the mRNA and protein expression of HSP60 gene in the kidneys of common carp. (A), (B) and (C) are the results of a 40-d exposure to ATR, CPF and ATR/CPF mixture, respectively. (D), (E) and (F) are the results of a 40-d recovery. The mRNA and protein expression from the solvent control group were used as the reference values in panels A–F. Each value represented the mean7 SD of 5 individuals. *Significant differences (P o0.05) between the control and the exposure groups. # Significant differences (Po 0.05) between the exposure and the recovery groups at the same concentration.

supernatant was collected. Protein content was measured according to Bradford's procedure (Bradford, 1976). Equal amounts of total protein (40 μg/condition) were subjected to SDS–polyacrylamide gel electrophoresis under reducing conditions on 12% gels. Separated proteins were then transferred to nitrocellulose membranes using a tank transfer for 2 h at 200 mA in Tris–glycine buffer containing 20% methanol. Membranes were blocked with 5% skim milk for 16–24 h and incubated overnight with diluted primary rabbit antibody HSP60, HSP70 and HSP90 (1:100, production of polyclonal antibody by our lab) followed by a horseradish peroxidase (HRP) conjugated secondary antibody against rabbit IgG (1:1500, Santa Cruz, USA). To verify equal loading of samples, the membrane was incubated with monoclonal β-actin antibody (1:1000, Santa Cruz, USA), followed by a HRP conjugated goat anti-mouse IgG (1:1000). The protein bands were visualized by enhanced chemiluminescence detection reagents (Applygen Technologies Inc., Beijing, China). The signal was detected by X-ray films (TransGen Biotech Co., Beijing, China). The optical density (OD) of each band was determined by Image VCD gel imaging system, and the HSP60, HSP70 and HSP90 protein expression were detected as the ratio of OD of HSP60, HSP70 and HSP90 and OD of β-actin, respectively.

2.8. Statistical analysis Statistical analysis of all data was performed using SPSS for Windows (version 13, SPSS Inc., Chicago, IL). One-way ANOVA with a post hoc test was used to elucidate if there were significant differences between the treatment groups and the solvent control group. The difference between the exposure group and the recovery group at the same concentration was assessed by using paired t-test. All expressed data were collected in quintuple from at least five fish and were expressed as mean 7standard deviation. Differences were considered to be significant at P o0.05.

3. Results 3.1. Accumulation of ATR, CPF, and their metabolites in the kidney tissue The concentrations of ATR and its metabolites (atrazine-2-hydroxy and atrazine-desethyl) in the kidney of common carp are summarized in Table 2. ATR and its metabolites (atrazine-desethyl and atrazine-2-hydroxy) in the kidney of common carp cultivated in pesticide-free control water were not detected. As the herbicide/pesticide concentration in water increased, the accumulation of ATR and its metabolites in the kidney significantly increased.

H. Xing et al. / Ecotoxicology and Environmental Safety 113 (2015) 491–498

495

Fig. 2. Effects of ATR, CPF and ATR/CPF mixture on the mRNA and protein expression of HSP70 gene in the kidneys of common carp. (A), (B) and (C) are the results of a 40-d exposure to ATR, CPF and ATR/CPF mixture, respectively. (D)–(F) are the results of a 40-d recovery. The mRNA and protein expression from the solvent control group were used as the reference values in panels A–F. Each value represented the mean 7 SD of 5 individuals. *Significant differences (P o0.05) between the control and the exposure groups. #Significant differences (Po 0.05) between the exposure and the recovery groups at the same concentration.

After recovery for 40 d, the accumulation of ATR and its metabolites in the kidney was significantly lower (P o0.05) than compared with that in the corresponding exposure group, although their accumulation in tissues was still detected. The concentrations of CPF and its metabolite (chlorpyrifosoxon) in the kidney of common carp are summarized in Table 3. CPF and chlorpyrifos-oxon in the kidney of common carp cultivated in pesticide-free control water were not detected. With the increase in herbicide/pesticide concentration in water, the accumulation of CPF and chlorpyrifos-oxon in the kidney for the CPF and ATR/CPF combined groups was significantly elevated above controls in all cases. CPF accumulation in kidney at all 11.6 μg/L CPF group was higher than chlorpyrifos-oxon accumulation. After recovery for 40 d, the accumulation of CPF and chlorpyrifos-oxon in the kidney of fish from the CPF and ATR/CPF combined groups was significantly lower (P o0.05) than that in the corresponding exposure group; however, their accumulation in tissues was still detected.

highest level at 42.8, 11.6 and 11.3 μg/L groups. After 40 d recovery, the mRNA and protein levels of HSP60 decreased significantly (P o0.05) at 4.28 and 42.8 μg/L ATR, at 11.6 and 116 μg/L CPF, and at 1.13 and 11.3 μg/L ATR/CPF combination compared to the corresponding exposure groups.

3.2. The expression of HSP60 in the kidney

3.4. The expression of HSP90 in the kidney

The effects of ATR, CPF and ATR/CPF mixture on the mRNA and protein levels of HSP60 in common carp are shown (Fig. 1). For common carp exposed to ATR and CPF alone and in combination, the HSP60 mRNA and protein levels at all groups increased after exposure. And the HSP60 mRNA and protein levels reached its

The effects of ATR, CPF and ATR/CPF mixture on the mRNA and protein levels of HSP90 in common carp are shown (Fig. 3). Following exposure (40 d) to ATR, CPF or ATR/CPF mixture, the mRNA and protein levels of HSP90 at all treatment groups except for 4.28 μg/L ATR, 11.6 and 11.6 μg/L CPF groups increased significantly

3.3. The expression of HSP70 in the kidney The effects of ATR, CPF and ATR/CPF mixture on the mRNA and protein levels of HSP70 in common carp are shown (Fig. 2). Compared with the acetone control group, a significantly increase (P o0.05) in the HSP70 mRNA and protein levels was observed in the kidney from exposure-treated fish after 40 d of exposure. For common carp exposed to CPF and ATR/CPF mixture, the HSP70 mRNA and protein levels reached its highest level at 11.6 and 11.3 μg/L groups. After 40 d recovery, the mRNA and protein level of HSP70 decreased significantly (Po 0.05) at all recovery groups compared to the corresponding exposure groups.

496

H. Xing et al. / Ecotoxicology and Environmental Safety 113 (2015) 491–498

Fig. 3. Effects of ATR, CPF and ATR/CPF mixture on the mRNA and protein expression of HSP90 gene in the kidneys of common carp. (A), (B) and (C) are the result of a 40-d exposure to ATR, CPF and ATR/CPF mixture, respectively. (D)–(F) are the result of a 40-d recovery. The mRNA and protein expression from the solvent control group were used as the reference values in panels A–F. Each value represented the mean 7 SD of 5 individuals. *Significant differences (P o0.05) between the control and the exposure groups. #Significant differences (Po 0.05) between the exposure and the recovery groups at the same concentration.

(P o0.05) compared to the acetone control group. However, there was no significant change in the HSP90 expression at other groups compared with the acetone control group. After 40 d recovery, the mRNA and protein levels of HSP90 at 428, 116 and 1.13 μg/L groups decreased significantly (P o0.05) compared to the corresponding exposure groups. Nevertheless, a significantly increase (P o0.05) in the HSP90 mRNA expression at 1.13 μg/L was observed compared to the corresponding exposure groups.

4. Discussion Pesticide pollution in the aquatic environment has been increasing due to their extensive use in agriculture. Alterations in the chemical composition of natural aquatic environments can affect the freshwater fauna, particularly fish (Oruc, 2010; Jin et al., 2010; Xing et al., 2014). Numerous studies have shown that a high accumulation level for ATR, CPF, and their metabolites was found in the liver, spleen and head kidney of common carp exposed to ATR, CPF and the ATR/CPF mixture (Wang et al., 2013; Xing et al., 2014). The kidney in fish plays a crucial part in immune responses. It not only is to maintain body fluid homeostasis, the same as higher vertebrates, but it also is in part analogous to the bone marrow in mammals (Meseguer et al., 1995). Because of its function characteristics, it has been taken as an object of study. The

results of the present study indicated that the accumulations of ATR, CPF, and their metabolites were detected in the kidney of common carp by ATR, CPF and an ATR/CPF mixture, suggesting that ATR, CPF and their metabolites were present in the organism because ATR and CPF have low solubility in water (Kidd and James, 1991; Powell et al., 2011). ATR can be found at levels as high as 21 ppb in groundwater, 42 ppb in surface waters, 102 ppb in river basins in agricultural areas, and up to 224 ppb in Midwestern streams during May–August (Kolpin et al., 1998). Del Prado Lu (2010) reported the presence of CPF (0.07 mg/L) residues in river water samples in agricultural areas. Our results have also demonstrated that the concentrations of ATR, CPF, and their metabolites were increased with increasing concentrations of ATR, CPF and the ATR/CPF mixture. The results could be related to the lipophilic nature of ATR and CPF thus enhancing their bioaccumulation. Alternatively, the relatively high accumulations of ATR and CPF in common carp could be due to their relatively readily reabsorption from the gastrointestinal tract and to their characteristic metabolism in the kidney (Yu and Yang, 2010). The metabolism of poisons in vivo was usually presented curve mode, therefore, a 10 or 100 times higher concentration of the pesticides in the exposure treatments do not give 10 or 100 times increase of the pesticides in the kidney in our manuscript. After recovery for 40 d, our results suggested that the dissipation of ATR, CPF, and their metabolites in the organism is a long-term process. High

H. Xing et al. / Ecotoxicology and Environmental Safety 113 (2015) 491–498

concentrations of ATR, CPF, and their metabolites in carp kidney indicated that possible tissue damage could exist (Yang et al., 2010b; Xing et al., 2012; Li et al., 2013). It has been suggested that the heat shock proteins might serve as biomarkers of stress and environmental insult in aquatic organisms (Sanders, 1993). Elevated levels of various HSPs have been measured in tissues of fish exposed to environmental contaminants, such as pesticides (Bagchi et al., 1996; Hassanein et al., 1999; Sanders, 1993). These HSPs species are essential cellular elements associated with protein folding and transport, receptor binding and proteolysis (Zarate and Bradley, 2003). Liu et al. (2013b) reported that the mRNA level of HSP70 was up-regulated in grass carp exposed to trifloxystrobin, azoxystrobin and kresoxim-methyl when they evaluated fungicides toxicity in grass carp at embryo developmental stage. Trichlorfon at concentration levels of 0.1 and 0.5 mg/L induced a time and dose-dependent increase in the expression of the HSP70 (Sinha et al., 2010). Liu et al. (2013a) found that exposure to ATR, CPF and ATR/CPF mixture increased the expression levels of HSP60, HSP70 and HSP90 in the brain of common carp. Similarly, the change of HSP60, HSP70 and HSP90 was also observed in the kidney of common carp in our study. Therefore, we suggest that increasing concentration of ATR and CPF in the environment causes considerable stress for common carp. The results are compliant with histopathological findings and antioxidant enzyme in the kidney of common carp (Xing et al., 2012). Pesticide effects on organisms were often investigated using single toxicants under laboratory conditions. However, under environmental conditions, mixtures of pesticides or pesticide metabolites were often present and may cause interactive effects. ATR was shown to cause additive toxicity with organophosphate compounds in aquatic invertebrate species (Belden and Lydy, 2000; Jin-Clark et al., 2002). Interestingly, there are only a few reports focusing on the joint toxicity of ATR and CPF on vertebrate species including fish species. For example, Tyler Mehler et al. (2008) demonstrated that the combination of ATR and CPF posed little additional risk than that of CPF alone to the tested fish species. Wacksman et al. (2006) reported that ATR had no effect or a small antagonistic effect on CPF toxicity in Pimephales promelas. In contrast, the joint toxicity of ATR and CPF to the African clawed frog exhibited additive toxicity for ATR concentrations up to 1000 mg/L (Wacksman et al., 2006). Our previous studies indicated that the joint toxicity of ATR and CPF in oxidative-stress, histological and morphological parameters and acetylcholinestease was greater than that of ATR or CPF alone (Xing et al., 2012). Similarly, the joint toxicity of ATR and CPF in HSP60, HSP70 and HSP90 was also observed in the kidney of common carp in our study. Because of this study utilised an aquatic vertebrate in the laboratory and may not reflect adequately the toxicity of the ATR/CPF mixture in the natural environment, the toxic effects of chronic exposure to the ATR/CPF mixture need to be evaluated in a future study to better understand the joint mechanism of toxicity of the ATR/CPF mixture in fish.

5. Conclusions In conclusion, this study indicated that the HSP60, HSP70 and HSP90 expression in the mRNA and protein level were induced in the kidney of common carp by ATR, CPF and ATR/CPF mixture, the joint toxicity of ATR and CPF is greater than that of ATR or CPF alone. The accumulated amounts of ATR, CPF, and their metabolites in the kidney tissues exhibited dose-dependency. These results exhibited that increasing concentration of ATR and CPF in the environment causes considerable stress for common carp, suggesting that the expression levels of HSP60, HSP70 and HSP90 may

497

act as potential biomarkers for assessing the environmental ATR and CPF risk for carp.

Acknowledgements The authors would like to thank Ying Han and Hui Zhang at the College of Animal Science and Technology, Northeast Agricultural University for their assistance. China Postdoctoral Science Foundation (Project no. 2012M511437) and Postdoctoral Foundation of Heilongjiang Province (Project no. LBH-Z10269) supported this study.

References Abu-Qare, A.W., Abou-Donia, M.B., 2001. Development of a high-performance liquid chromatographic method for the quantification of chlorpyrifos, pyridostigmine bromide, N,N-diethyl-m-toluamide and their metabolites in rat plasma and urine. J. Chromatogr. B Biomed. Sci. Appl. 754, 533–538. Abdel-Gawad, F.Kh, Khalil, W.K.B., 2013. Modulation of stress related protein genes in the bass (Epinephelus guaza) caught from the Gulf of Suez, the Red Sea, Egypt. Ecotoxicol. Environ. Saf. 96, 175–181. Ali, D., Nagpure, N.S., Kumar, S., Kumar, R., Kushwaha, B., 2008. Genotoxicity assessment of acute exposure of chlorpyrifos to freshwater fish Channa punctatus (Bloch) using micronucleus assay and alkaline single-cell gel electrophoresis. Chemosphere 71, 1823–1831. Banks, K.E., Hunter, D.H., Wachal, D.J., 2005. Chlorpyrifos in surface waters before and after a federally mandated ban. Environ. Int. 31, 351–356. Bagchi, D., Bhattacharya, G., Stohs, S.J., 1996. In vitro and in vivo induction of heat shock (stress) protein (Hsp) gene expression by selected pesticides. Toxicology 112, 57–68. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Anal. Biochem. 72, 248–254. Belden, J.B., Lydy, M.J., 2000. Impact of atrazine on organophosphate insecticide toxicity. Environ. Toxicol. Chem. 19, 2266–2274. Bustin, S.A., Benes, V., Garson, J.A., Hellemans, J., Huggett, J., Kubista, M., Mueller, R., Nolan, T., Pfaffl, M.W., Shipley, G.L., Vandesompele, J., Wittwer, C.T., 2009. The MIQE guide-lines: minimum information for publication of quantitative realtime PCR experiments. Clin. Chem. 55, 611–622. Cechetto, J.D., Soltys, B.J., Gupta, R.S., 2000. Localizationofmitochondrial 60-kD heat shock chaperonin protein (Hsp60) in pituitary growth hormone secretory granules and pancreatic zymogen granules. J. Histochem. Cytochem. 48 (2000), 45–56. Cerejeira, M.J., Viana, P., Batista, S., Pereira, T., Silva, E., Valerio, M.J., Silva, A., et al., 2003. Pesticides in Portugal surface and ground waters. Water Res. 37, 1055–1063. Del Prado Lu, J.L., 2010. Multipesticide residue assessment of agricultural soil and water in major farming areas in Benguet, Philippines. Arch. Environ. Contam. Toxicol. 59, 175–181. Dowling, V., Hoarau, P.C., Romeo, M., O'Halloran, J., van Pelt, F., Brien, N.O., Sheehan, D., 2006. Protein carbonylation and heat shock response in Ruditapes decussatus following p,p′-dichlorodiphenyldichloroethylene (DDE) exposure: a proteomic approach reveals that DDE causes oxidative stress. Aquat. Toxicol. 77, 11–18. Du Preez, L.H., Jansen van Rensburg, P.J., Jooste, A.M., Carr, J.A., Giesy, J.P., Gross, T.S., Kendall, P.J., et al., 2005. Seasonal exposures to triazine and other pesticides in surface waters in the Western Highveld corn-production region in South Africa. Environ. Pollut. 135, 131–141. Ernst, W., Doe, K., Cook, A., Burridge, L., Lalonde, B., Jackman, P., Aubé, J.G., Page, F., 2014. Dispersion and toxicity to non-target crustaceans of azamethiphos and deltamethrin after sea lice treatments on farmed salmon, Salmo salar. Aquaculture 424–425, 104–112. Hayes, T.B., Collins, A., Lee, M., Mendoza, M., Noriega, N., Stuart, A.A., Vonk, A.P., 2002. Hermaphroditic, demasculated frogs after exposure to the herbicide atrazine at low ecologically relevant doses. Proc Natl Acad Sci USA 99, 5476–5480. Hassanein, H.M., Banhawy, M.A., Soliman, F.M., Abdel-Rehim, S.A., Müller, W.E., Schröder, H.C., 1999. Induction of hsp70 by the herbicide oxyfluorfen (Goal) in the Egyptian Nile fish, Oreochromis niloticus. Arch Environ Contam Toxicol 37, 78–84. International Agency for Research on Cancer (IARC), 1999. Evaluating Carcinogenic Risks in Humans. Some Chemicals that Cause Tumours of the Kidney or Urinary Bladder in Rodents and Some other Substances, vol. 73. World Health Organization, Lyon, France, pp. 59–113. Jin-Clark, Y., Lydy, M.J., Zhu, K.Y., 2002. Effects of atrazine and cyanazine on chlorpyrifos toxicity in Chironomus tentans (Diptera: Chironomidae). Environ. Toxicol. Chem. 21, 598–603. Jin, Y., Zhang, X., Shu, L., Chen, L., Sun, L., Qian, H., Liu, W., Fu, Z., 2010. Oxidative stress response and gene expression with atrazine exposure in adult female

498

H. Xing et al. / Ecotoxicology and Environmental Safety 113 (2015) 491–498

zebrafish (Danio rerio). Chemosphere 78, 846–852. Kidd, H., James, D.R., 1991. The Agrochemicals Handbook, A0791/Aug 91, 3rd ed. Royal Society of Chemistry Information Services, Cambridge. Kolpin, D.W., Thurman, E.M., Linhart, S.M., 1998. The environmental occurrence of herbicides: the importance of degradates in ground water. Arch. Environ. Contam. Toxicol. 35, 385–390. Liu, T., Zhang, Z., Chen, D., Wang, L., Yao, H., Zhao, F., Xing, H., Xu, S., 2013a. Effect of atrazine and chlorpyrifos exposure on heat shock protein response in the brain of common carp (Cyprinus carpio L.). Pest. Biochem. Physiol. 107, 277–283. Liu, L., Jiang, C., Wu, Z.Q., Gong, Y.X., Wang, G.X., 2013b. Toxic effects of three strobilurins (trifloxystrobin, azoxystrobin and kresoxim-methyl) on mRNA expression and antioxidant enzymes in grass carp (Ctenopharyngodon idella) juveniles. Ecotoxicol. Environ. Saf. 98, 297–302. Li, X., Liu, L., Zhang, Y., Fang, Q., Li, Y., Li, Y., Li, Y., 2013. Toxic effects of chlorpyrifos on lysozyme activities, the contents of complement C3 and IgM, and IgM and complement C3 expressions in common carp (Cyprinus carpio L.). Chemosphere 93, 428–433. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25, 402–408. Muňoz, I., Rosés, N., 2000. Comparison of extraction methods for the determination of atrazine accumulation in freshwater molluscs (Physa acuta drap. and Ancylus fluviatilis müll, gastropoda). Wat. Res. 34, 2846–2848. Meseguer, J., Lopez-Ruiz, A., Garcia-Ayala, A., 1995. Reticulo-endothelial stroma of the head–kidney from the seawater teleost gilthead seabream (Sparus aurata L.): an ultrastructural and cytochemical study. Anat. Rec. 241, 303–309. Moore, A., Lower, N., Mayer, I., Greenwood, L., 2007. The impact of a pesticide on migratory activity and olfactory function in Atlantic salmon (Salmo salar L.) smolts. Aquaculture 273, 350–359. Na, Y.R., Seok, S.H., Baek, M.W., Lee, H.Y., Kim, D.J., Park, S.H., Lee, H.K., Park, J.H., 2009. Protective effects of vitamin E against 3,3′,4,4′,5-pentachlorobiphenyl (PCB126) induced toxicity in zebrafish embryos. Ecotoxicol. Environ. Saf. 72, 714–719. Nakadai, A., Li, Q., Kawada, T., 2006. Chlorpyrifos induces apoptosis in human monocyte cell line U937. Toxicology 224, 202–209. Oruc, E.O., 2010. Oxidative stress, steroid hormone concentrations and acetylcholinesterase activity in Oreochromis niloticus exposed to chlorpyrifos. Pest. Biochem. Physiol. 96, 160–166. Palma, P., Palma, V.L., Fernandes, R.M., Bohn, A., Soares, A.M.V.M., Barbosa, I.R., 2009. Embryo-toxic effects of environmental concentrations of chlorpyrifos on the crustacean Daphnia magna. Ecotoxicol. Environ. Saf. 72, 1714–1718. Peyre, L., Zucchini-Pascal, N., Rahmani, R., 2014. Atrazine represses S100A4 gene expression and TPA-induced motility in HepG2 cells. Toxicol. Vitro 28, 156–163. Press, C.M., Evensen, Ø, 1999. The morphology of the immune system in teleost fishes. Fish Shellfish Immunol. 9, 309–318. Powell, E.R., Faldladdin, N., Rand, A.D., Pelzer, D., Schrunk, E.M., Dhanwada, K.R., 2011. Atrazine exposure leads to altered growth of HepG2 cells. Toxicol. Vitro 25, 644–651. Rajeshkumar, S., Munuswamy, N., 2011. Impact of metals on histopathology and expression of HSP70 in different tissues of Milk fish (Chanos chanos) of Kaattuppalli Island, South East Coast, India. Chemosphere 83, 415–421. Richards, R.P., Baker, D.B., 1993. Pesticide concentration patterns in agricultural drainage networks in the lake Erie basin. Environ. Toxicol. Chem. 12, 13–26. Rowe, A.M., Brundage, K.M., Barnett, J.B., 2007. In vitro atrazine-exposure inhibits human natural killer cell lytic granule release. Toxicol. Appl. Pharmacol. 221, 179–188. Saulsbury, M.D., Heyliger, S.O., Wang, K., Johnson, D.J., 2009. Chlorpyrifos induces oxidative stress in oligodendrocyte progenitor cells. Toxicology 259, 1–9. Sanders, B.M., 1993. Stress proteins in aquatic organisms: an environmental

perspective. Crit. Rev. Toxicol. 23, 49–75. Schuler, L.J., Trimble, A.J., Belden, J.B., Lydy, M.J., 2005. Joint toxicity of triazine herbicides and organophosphate insecticides to the midge Chironomus tentans. Arch. Environ. Contam. Toxicol. 49 (2), 173–177. Sinha, A.K., Vanparys, C., De Boeck, G., Kestemont, P., Wang, N., Nguyen, P.T., Scippo, M.L., De Coen, W., Robbens, J., 2010. Expression characteristics of potential biomarker genes in Tra catfish, Pangasianodon hypophthalmus, exposed to trichlorfon. Comp. Biochem. Physiol. Part D Genom. Proteom. 5, 207–216. Song, Y., Zhu, L.S., Wang, J., Wang, J.H., Liu, W., Xie, H., 2009. DNA damage and effects on antioxidative enzymes in earthworm (Eisenia foetida) induced by atrazine. Soil Biol. Biochem. 41, 905–909. Thomas, K., Nicholson, B.C., 1989. Pesticide losses in runoff from a horticultural catchment in South Australia and their relevance to stream and reservoir water quality. Environ. Technol. Lett. 1989 (10), 117–129. Tyler Mehler, W., Schuler, L.J., Lydy, M.J., 2008. Examining the joint toxicity of chlorpyrifos and atrazine in the aquatic species: Lepomis macrochirus, Pimephales promelas and Chironomus tentans. Environ. Pollut. 152, 217–224. USEPA (US Environmental Protection Agency), 2002. Reregistration Eligibility Science Chapter for Atrazine Environmental Fate and Effects Chapter. Washington, DC, USA. Wallin, R.P., Lundqvist, A., Moré, S.H., von Bonin, A., Kiessling, R., Ljunggren, H.G., 2002. Heat-shock proteins as activators of the innate immune system. Trends Immunol. 23, 130–135. Wang, X., Xing, H., Jiang, Y., Wu, H., Sun, G., Xu, Q., Xu, S., 2013. Accumulation, histopathological effects and response of biochemical markers in the spleens and head kidneys of common carp exposed to atrazine and chlorpyrifos. Food Chem. Toxicol. 62, 148–158. Wacksman, M.N., Maul, J.D., Lydy, M.J., 2006. Impact of atrazine on chlorpyrifos toxicity to four aquatic vertebrates. Arch. Environ. Contam. Toxicol. 51 (4), 681–689. Wood, B., Stark, J.D., 2002. Acute toxicity of drainage ditch water from a Washington State cranberry-growing region to Daphnia pulexin laboratory bioassays. Ecotoxicol. Environ. Saf. 53, 273–280. Xing, H., Li, S., Wang, Z., Gao, X., Xu, S., Wang, X., 2012. Histopathological changes and antioxidant response in brain and kidney of common carp exposed to atrazine and chlorpyrifos. Chemosphere 88, 377–383. Xing, H., Li, S., Wang, X., Gao, X., Xu, S., Wang, X., 2013. Effects of atrazine and chlorpyrifos on the mRNA levels of HSP70 and HSC70 in the liver, brain, kidney and gill of common carp (Cyprinus carpio L.). Chemosphere 90, 910–916. Xing, H., Zhang, Z., Yao, H., Liu, T., Wang, L., Xu, S., Li, S., 2014. Effects of atrazine and chlorpyrifos on cytochrome P450 in common carp liver. Chemosphere 104, 244–250. Yang, L., Zha, J., Zhang, X., Li, W., Li, Z., Wang, Z., 2010a. Alterations in mRNA expression of steroid receptors and heat shock proteins in the liver of rare minnow (Grobiocypris rarus) exposed to atrazine and p, p-DDE. Aquat. Toxicol. 98, 381–387. Yang, L., Zha, J., Li, W., Li, Z., Wang, Z., 2010b. Atrazine affects kidnet and adrenal hormones (AHs) related genes expressions of rare minnow (Gobiocyprisrarus). Aquat. Toxicol. 97, 204–211. Yu, L.Z., Yang, X.L., 2010. Effects of cytochromes P450 induces and inhibitors on difloxacin N-demethylation in the kidney of Chinese idle (Ctenopharyngodon idellus). Environ. Toxicol. Pharmacol. 29, 202–208. Zarate, Z., Bradley, T.M., 2003. Heat shock proteins are not sensitive indicators of hatchery stress in salmon. Aquaculture 223, 175–187. Zhou, Q., Pang, L., Xie, G., Xiao, J., Bai, H., 2009. Determination of atrazine and simazine in environmental water samples by dispersive liquid–liquid microextraction with high performance liquid chromatography. Anal. Sci. 25, 73–76.