Environmental Pollution 230 (2017) 432e443

Contents lists available at ScienceDirect

Environmental Pollution journal homepage: www.elsevier.com/locate/envpol

Histopathological effects, responses of oxidative stress, inflammation, apoptosis biomarkers and alteration of gene expressions related to apoptosis, oxidative stress, and reproductive system in chlorpyrifosexposed common carp (Cyprinus carpio L.)* b € Serdar Altun a, *, Selçuk Ozdemir , Harun Arslan c a

Department of Pathology, Faculty of Veterinary Medicine, Atatürk University, Yakutiye, 25240, Erzurum, Turkey Department of Genetics, Faculty of Veterinary Medicine, Atatürk University, Yakutiye, 25240, Erzurum, Turkey c Department of Basic Sciences, Faculty of Fisheries, Atatürk University, Yakutiye, 25240, Erzurum, Turkey b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 25 February 2017 Received in revised form 25 April 2017 Accepted 26 June 2017 Available online 1 July 2017

In this study, we aimed to identify the toxic effects of chlorpyrifos exposure on the tissues of common carp. For this purpose, we evaluated histopathological changes in the brain, gills, liver, kidney, testis, and ovaries after 21 days of chlorpyrifos exposure. Activation of 8-OHdG, cleaved caspase-3, and iNOS were assesed by immunofluorescence assay in chlorpyrifos-exposed brain and liver tissue. Additionally, we measured the expression levels of caspase-3, caspase-8, iNOS, MT1, CYP1A, and CYP3A genes in chlorpyrifos-exposed brain tissue, as well as the expression levels of FSH and LH genes in chlorpyrifosexposed ovaries, using qRT-PCR. We observed severe histopathological lesions, including inflammation, degeneration, necrosis, and hemorrhage, in the evaluated tissues of common carp after both high and low levels of exposure to chlorpyrifos. We detected strong and diffuse signs of immunofluorescence reaction for 8-OHdG, iNOS, and cleaved caspase-3 in the chlorpyrifos-exposed brain and liver tissues. Furthermore, we found that chlorpyrifos exposure significantly upregulated the expressions of caspase-3, caspase-8, iNOS, and MT1, and also moderately upregulated CYP1A and CYP3A in the brain tissue of exposed carp. We also noted downregulation of FSH and LH gene expressions in chlorpyrifos-exposed ovary tissues. Based on our results, chlorpyrifos toxication caused crucial histopathological lesions in vital organs, induced oxidative stress, inflammation, and apoptosis in liver and brain tissues, and triggered reproductive sterility in common carp. Therefore, we can propose that chlorpyrifos toxication is highly dangerous to the health of common carp. Moreover, chlorpyrifos pollution in the water could threaten the common carp population. Use of chlorpyrifos should be restricted, and aquatic systems should be monitored for chlorpyrifos pollution. © 2017 Elsevier Ltd. All rights reserved.

Keywords: Chlorpyrifos Toxicity Common carp Histopathology Immunofluorescence Gene expression Caspase-3

1. Introduction Pesticides have been used extensively in the farming of fruits, vegetables, and other crops in agricultural areas around the world.

Abbreviations: CPF, Chlorpyrifos; iNOS, inducible Nitric Oxide Synthase; 8OHdG, 8-hydroxy-2-deoxyguanosine; IF, Immunofluorescence; H&E, Hematoxylin and eosin; MT1, Metallothionein 1; CYP1A and CYP3A, Cytochrome P450s; FSH, Follicule stimulating hormone; LH, Luteinizing hormone. * This paper has been recommended for acceptance by Dr. Harmon Sarah Michele. * Corresponding author. E-mail address: [email protected] (S. Altun). http://dx.doi.org/10.1016/j.envpol.2017.06.085 0269-7491/© 2017 Elsevier Ltd. All rights reserved.

However, they can be carried into water systems through runoff, spray drift, or storms (Oerke and Dehne, 2004; Dong et al., 2009). Due to uncontrolled usage, they can accumulate in water and become toxic to aquatic animals. Polluted groundwater is also dangerous to humans, whether through direct or indirect exposure (Nemeth-Konda et al., 2002). Moreover, pesticide production has been recently increased, and the harmful effects of these chemicals on aquatic animals have increased simultaneously (Jin et al., 2015). For this reason, the adverse effects of pesticides on non-target organisms need to be assessed in detail. Chlorpyrifos (CPF) is an organophosphate (OP) that is widely used in agricultural pest control, although its usage is restricted in inhabited areas (Humphrey et al., 2004; U.S. Environmental Protection Agency

S. Altun et al. / Environmental Pollution 230 (2017) 432e443

(USEPA, 2002)). It inhibits the activity of acetylcholinesterases (Sumon et al., 2016; Xing et al., 2012a), leading to severe adverse effects on non-target organisms, especially aquatic animals. The common carp (Cyprinus carpio L.) is a freshwater fish that is economically important around the world (Li et al., 2010), as well as a bioindicator species for toxication studies and this species of fish is also hunted and cultivated extensively as a food source worldwide. (Huang et al., 2007). In addition, river regulation, pesticide misuse, and heavy metal contamination threat the population of common carp (Ahmad et al., 2015). Previous studies have reported that CPF can cause histopathological changes, oxidative stress, nephrotoxicity and genotoxicity, and changes in swimming performance in aquatic organisms, as well as affecting reproductive systems and development (de Campos Ventura et al., 2008; Xing et al., 2012a; Gomez-Canela et al., 2017). During toxication, several oxidative stress and apoptotic markers, including iNOS, 8-OHdG, cleaved caspase-3, and caspase  8, could be stimulated in non-target organisms (Zelje zi c et al., 2016; Chen et al., 2015; Xing et al., 2012b). Nitric oxide (NO), a signaling molecule, is produced by nitric oxide synthase enzymes (NOS). There are three distinct isoforms of NOS: neuronal NOS, endothelial NOS (eNOS), and inducible NOS (iNOS). iNOS can promote to synthesis of NO, which plays a central role in vasodilation, neurotransmission, host cell defense, and toxicity of pesticides and heavy metals (Moncada and Higgs, 1995; Ortiz-Ortiz et al., 2009; Pi et al., 2003; Wang et al., 2013). A number of previous reports have demonsrated that NO and iNOS are used as oxidative stress markers and are important in determining fish toxicity (Gonzalez et al., 2007; Saeij et al., 2000; Wang et al., 2013). Furthermore, CPF can induce the generation of reactive oxygen species (ROS) such as hydrogen peroxide (H2O2), superoxide (O
2 ), and hydroxyl radical (HO). This can cause enzyme inactivation and DNA damage such as 8-hydroxydeoxyguanosine (8-OHdG) (Lee et al., 2007; La Du et al., 1999). 8-OHdG is used as an oxidative stress and DNA damage marker (Kawanishi et al., 2017). A previous studies has shown increased 8-OHdG in deltamethrin and cypermethrin exposedtissues of common carp (Arslan et al., 2017a, 2017b). Apoptosis, or programmed cell death (PCD), is characterized by several biochemical events, including internucleosomal DNA fragmentation, chromatin condensation, cellular shrinkage, and membrane blebbing (Monteiro et al., 2009). Caspase-3, a member of the caspase family of aspartic acid-directed cysteine proteases, plays a role in both extrinsic (death receptor) and intrinsic (mitochondrial) apoptosis pathways (Martinez et al., 2010; Wong, 2011). Cleaved caspase-3 can be used as a biomarker of DNA repair, integrity, and genome surveillance (Gurtu et al., 1997). Caspase-8 is an initiator caspase protein which plays a role in extrinsic apoptotic pathways (Kumar et al., 2007). It is known that apoptosis can be induced by pesticide toxication (Jin et al., 2013; Gao et al., 2013); however, little information about the apoptotic effects of CPF on common carp is available in previous literature. Thus, investigation of the effects of CPF on apoptotic markers (caspase-3 and caspase8) could be necessary for further studies. Metallothioneins (MTs, including MT1, MT2, MT3, and MT4) bind to metals such as zinc, copper, cadmium, mercury, silver, arsenic, etc. They are primarily produced in the liver and kidney. The function of MTs is not clearly known, but previous studies have suggested that they exist to eleminate the adverse effects of heavy metals and pesticides, as well as to protect organisms from several stress-related conditions, such as oxidative stress (Kagi and Schaffer, 1988; Ali et al., 2009a,b; Ferencz and Hermesz, 2015). Pesticide toxication may induce MT synthesis in fish (Linde-Arias et al., 2008). Cytochrome P450s are proteins that play an important role in the metabolism of xenobiotics such as pesticides (Zhu

433

et al., 2016). It is also responsible for the metabolism of pollutants, drugs, and several carcinogenic chemicals (Oliva et al., 2014). There are several types of Cytochrome P450 isoforms, such as CYP1A and CYP3A, which play a role in drug and xenobiotic metabolism (Beijer et al., 2013). MT1, CYP1A, and CYP3A production are associated with reactive oxygen species (ROS); thus, they can be used as oxidative stress biomarkers (Ma et al., 2013; Xing et al., 2014). Little information is available on whether CPF exposure changes expressions of MT1, CYP3A, and CYP1A genes in the brain tissue of common carp. Reproductive disfunction resulting from pollutants has been observed in several fish species, particularly zebrafish. There are several reproductive disfunction agents, including pharmaceuticals, pesticides, and other chemicals. If these agents are present in water, they can enter through the gills, skin, or gut and accumulate € ffker and Tyler, 2012). Gonadotropin-releasing in a fish's body (So hormone (GnRH) promotes the synthesis of gonadotrophins, luteinizing hormone (LH), and follicle-stimulating hormone (FSH) in fish (Mnif et al., 2011; Nishi and Hundal, 2013). Previous studies have indicated that CPF causes histopathological changes in reproductive organs and alteration of FSH and LH expressions in rats (Manjunatha and Philip, 2016; Tanvir et al., 2016; Nishi and Hundal, 2013). However, it was not clear whether CPF exposure would lead to histopathological lesions in the reproductive system or affect the expression of FSH and LH genes in common carp. This study provides current information about the harmful effects of CPF on common carp. We assessed histopathological efffects, activation of iNOS, 8-OHdG, and cleaved caspase, and alteration in several gene expressions including caspase-3, caspase8, iNOS, MT1, CYP1A, CYP3A, FSH, and LH in chronic CPF-exposed common carp. 2. Materials and methods 2.1. Chemical Chlorpyrifos (CPF) C9H11Cl3NO3PS (CAS Number: 2921-88-2, 98% purity, molecular weight 350.59) was purchased from SigmaAldrich (Missouri, ABD). Molecular structure of CPF was shown in Fig. 1. Stock solution CPF was prepared by dissolving in acetone (99% purity). 2.2. Fish Common carp was selected according to 80 ± 10 g weight and 11.5 ± 0.4 cm length. 24 male and 24 female for toxic group, and 24 fish from both sexes (12 male and 12 female) for control group were obtained from Atatürk University, Faculty of Fisheries and the Inland Water Fish Breeding and Research Center. This study was performed as accordance with the approved ethical rules of Atatürk

Fig. 1. Molecular structure of chlorpyrifos.

434

S. Altun et al. / Environmental Pollution 230 (2017) 432e443

University. Fish were fed with pellet feed (crude protein 45%, oil 20%, cellulose 2.5%, Aquamax, Samsun, Turkey) twice a day for 60 days in a stock pond to provide their acclimatization to the environmental conditions and then this feeding programme was applied during the experiment. Measured water quality parameters were; O2 ¼ 8.3 ± 0.1 ppm, pH ¼ 7.6 ± 0.2, SO
2 4 ¼ 10.32 ppm,


CO
2 3 ¼ 124 ppm, HCO3 ¼ 145.6 ppm, NO3 ¼ 3.45 ppm, NO2 ¼ trace, conductivity ¼ 276 ms/cm, total hardness ¼ 119 ppm of CaCO3, and temperature (24e33  C) and water was changed every day. After the adaptation period, fish were divided into six groups. Each aquarium (volume 70 L) contained 12 fish and totally 72 fish were used in the present study. 2.3. Experimental design The fish were exposed to the chemical for periods of 21 days in static aquarium systems. The fish in group I and II were the control. The fish in groups III and IV were given dose of 0.2 mg/L (1/5 LC50), V and VI were given dose of 0.1 mg/L (1/10 LC50) concentration of chlorpyrifos for 21 days (Table 1) (Xing et al., 2015). At the end of the exposure period, all fish were immediately sacrificed by decapitation. The gills, liver, kidney, testis, and half of brain and ovarium tissues were taken for histopathological examination and immunofluorescence assay, also another half of brain and ovarium tissues were quickly removed and stored at
80  C for the total RNA isolation. 2.4. Histopathological examination At the end of the experiment, brain, liver, gill, kidney, testis and ovarium tissue samples were stored for 1 day being fixed in a 10% buffered formalin solution for histopathology and immunofluorescence. Tissue samples were washed with tap water before routine serial treatment of samples with graded alcohol and xylene were performed in Shandon Citadel 2000 tissue system (Minnesota, USA). After routine histopathological processing, all samples were embedded in parrafin block and 5 mm sections were prepared using a rotary microtome (Leicia RM 2255, Wetzlar, Germany). All sections were stained with hematoxylin and eosin (H&E) for standard histopathological evaluation. Slides were examined under the light microscopy (Olympus BX51 with DP72 camera attachment, Tokyo, Japan).

antibodies were diluted with a solution (ab 64211; Abcam, Cambridge, UK). Sections were incubated with diluted antibodies (iNOS, ab15323, 1/200 dilution, Abcam, Cambridge, UK). 8-OHdG, (sc66036, 1/200 dilution, Santa Cruz, Texas USA). Cleaved caspase-3, (NB600-1235, 1/250 diluation, Novus Biologicals, Cambridge, UK) at room temperature for 45 min. The secondary goat anti rabbit IgG polyclonal fluorescent antibody (FITC) (ab 6717, 1/100 dilution, Abcam, Cambridge, UK) was used on sections incubated with the iNOS and active caspase-3 antibodies, whereas the secondary goat anti mouse IgG fluorescent monoclonal antibody (FITC) (ab 6785, 1/ 400 dilution, Abcam, Cambridge, UK) was used on sections incubated with the 8-OHdG antibody. Finally all sections were covered with glycerin diluted 1/9 in distilled water for evaluation by fluorescence microscopy (Zeiss Scope A1 with Axio cam ICc5 camera attachment system, Oberkochen, Germany). 2.6. Total RNA isolation and reverse transcription quantitative realtime PCR (RT-qPCR) For the evaluation of mRNA expression of caspase-3, caspase-8, iNOS, MT1, CYP1A, CYP3A, FSH and LH, real-time PCR analysis was performed in CFX96 TouchTM Real-Time PCR Detection System (Bio-Rad, California, USA). Total RNA was isolated from ovarium and brain tissues using TRIZOL reagent (Invitrogen, Cat:15596026, California, USA) according to the manufacturer's instructions. The RNA samples were treated with RNase-free water with DEPC (Thermo Scientific, Massachusetts, USA) and then cDNA sythesis was performed using QuantiTect Reverse Transcription (Qiagen, Cat:330411, Hilden, Germany) from 1 mg of the treated RNA according to manufacturer's instructions. 1 mg each cDNA was used as templates for amplification using SYBER Green Master Mix (Qiagen, Cat: 330500, Hilden, Germany) and gene specific primers. Real Time PCR primers (b-Actin, caspase-3, caspase-8, iNOS, MT1, CYP1A, CYP3A, FSH and LH) were designed according to the sequence of common carp (Cyprinus carpio L.) using the primer design program Oligo 6.0 and Primer 5.0. These primers and their PCR conditions were given in Table 2. b-Actin was used as an internal control for qRT-PCR. Each PCR reaction was performed in triplicate. The specificity of PCR amplification was confirmed by agarose gel electrophoresis and melting curve analysis. Relative fold of expression of genes was determined with the 2
DDCT method (Livak and Schmittgen, 2001) (see Table 3). 2.7. Statistical analysis

2.5. Immunofluorescence assay Brain and liver tissue sections were used for immunofluorescence staining. After deparaffinization, a 3% H2O2 (Hydrogen peroxide; 18304-1L, Sigma, Missouri, USA) solution was applied dropwise on each slide for ten minutes to inactivate endogenous peroxidase activity. Then, the slides were boiled in antigen retrieval solution (ab 96674, Abcam, Cambridge, UK) (pH 6.0) in a microwave for 15 min to unmasked the antigens. After cooling, sections were incubated for 15 min with a protein block solution (ab 80436, Abcam, Cambridge, UK) to prevent nonspecific binding. All

Table 1 Chlorpyrifos treatment desing for 21 days. Group

I

II

III

IV

V

VI

Treat.

Control Male (n ¼ 12)

Control Female (n ¼ 12)

Dose Lethal Dose

X X

X X

CPF Male H. Dose (n ¼ 12) 0.2 mg/L 1/5 LC50

CPF Female H. Dose (n ¼ 12) 0.2 mg/L 1/5 LC50

CPF Male L. Dose (n ¼ 12) 0.1 mg/L 1/10 LC50

CPF Female L. Dose (n ¼ 12) 0.1 mg/L 1/10 LC50

Statistical analysis of all data was performed using SPSS (Version 16.0 Inc, USA). One-way ANOVA was used to analyse the mRNA levels of caspase-3, caspase-8, iNOS, MT1, CYP1A, CYP3A, FSH and LH between treatment and control groups. Followed by Tukey's post-hoc test was performed using the Graph pad prism software Inc., (Version 7.0, California, USA). qRT-PCR results are expressed as mean ± SEM (Standard error of mean). Statistically differences were considered to be significant at p < 0.05, p < 0.01 and p < 0.001. For the histopathological scores, in total 10 randomly selected microscopic areas at 20Xe40 magnification from each organ slides of fish exposed to CPF were examined. The scores were classified semi-quantitatively, considering the number of microscopic fields with lesions and were noted as follows: none:
(0 lesion), mild: þ (1e4 lesions), moderate: þþ (5e8 lesions) and severe: þþþ (9 lesions). Immunofluorescence reactivity in all brain and liver parts were semi-quantitatively assessed under fluorescence microscopy interms of severity and tissue distribution (none:-, slightly:þ, intermediate:þþ, high:þþþ). Obtained scores were analyzed statistically by using SPSS statistical software (SPSS for windows, version 20.0). Differences in measured parameters among the

S. Altun et al. / Environmental Pollution 230 (2017) 432e443

435

Table 2 Primer sequences and qRT-PCR conditions. Primer

Sequences (50 -30 )

Length (bp)

Accession no

Reaction Conditions

b-Actin

F: ACGTTGCACACTTGATGGAT R: CTCAAGTTACCGGCAGATGA F: GTTGGTACATGGGCACTGAG R: TATGGTGGTCGGTAATGGTG F: TTGCTTCTCACTGGCTCATC R: CTCCAAACGTTTAACGAGCA F: CCTGCCCATGGACTAAAGAT R: ATCCGACACACAGAGACAGC F: TTCCTTCCTTTCACCATTCC R: TCCAGATTGAAGCTTGATGG F: CACAAGAAGAAGCGAGTGGA R: CCGAAGATGAAGATCATGGA F: TGCGCCAAGAGTAAGTGTTT R: ACCACAATTGCAAGTTCCAG F: GTTATGGTGATGCTGTTGCC R: TGGTGTCAATTGTGATGCAG F: CATTAGCGGATGACTGTTGG R: ATGAAGCATGCATTTACCCA

124

M24113.1

94  C for 15 s, 55  C 30 s/72  C 30 s (40 cycle)

201

AJ242906.1

94  C for 15 s, 58  C 30 s/72  C 30 s (40 cycle)

166

KF055462.1

94  C for 15 s, 57  C 30 s/72  C 30 s (40 cycle)

162

KC822471.1

94  C for 15 s, 58  C 30 s/72  C 30 s (40 cycle)

149

AB048939.1

94  C for 15 s, 59  C 30 s/72  C 30 s (40 cycle)

146

GU046696.1

94  C for 15 s, 61  C 30 s/72  C 30 s (40 cycle)

156

AY789469.1

94  C for 15 s, 60  C 30 s/72  C 30 s (40 cycle)

127

AB003583.1

94  C for 15 s, 58  C 30 s/72 0C 30 s (40 cycle)

195

X59889.1

94  C for 15 s, 56  C 30 s/72 0C 30 s (40 cycle)

iNOS Caspase 3 Caspase 8 CYP1A CYP3A MT1 FSH LH

Table 3 Showing changes of caspase 3, caspase 8, iNOS, MT1, CYP1A, CYP3A, FSH, and LH gene expression levels in high and low dose CPF exposed to brain tissues. Caspase 3 Dosage Low dose High dose Caspase 8 Dosage Low dose High dose iNOS Dosage Low dose High dose MT1 Dosage Low dose High dose CYP1A Dosage Low dose High dose CYP3A Dosage Low dose High dose FSH Dosage Low dose High dose LH Dosage Low dose High dose

Cont 0.62 ± 0.012 0.62 ± 0.012

21 days exposure 2.34 ± 0.018** 3.18 ± 0.027***

Levene sig 0.212 0.212

Cont 0.72 ± 0.014 0.72 ± 0.014

21 days exposure 1.86 ± 0.013** 2.44 ± 0.014**

Levene sig 0.855 0.855

Cont 0.96 ± 0.015 0.96 ± 0.015

21 days exposure 2.77 ± 0.011*** 3.45 ± 0.015***

Levene sig 0.775 0.775

Cont 0.62 ± 0.017 0.62 ± 0.017

21 days exposure 1.17 ± 0.022* 1.42 ± 0.014**

Levene sig 0.311 0.311

Cont 0.55 ± 0.015 0.55 ± 0.015

21 days exposure 1.04 ± 0.022* 1.43 ± 0.021*

Levene sig 0.210 0.210

Cont 0.68 ± 0.007 0.68 ± 0.007

21 days exposure 1.05 ± 0.017* 1,25 ± 0.013*

Levene sig 0.170 0.170

Cont 3.02 ± 0.014 3.02 ± 0.014

21 days exposure 1.57 ± 0.016** 1.22 ± 0.011***

Levene sig 0.718 0.718

Cont 2.7 ± 0.04 2.7 ± 0.04

21 days exposure 1.49 ± 0.2** 1.31 ± 0.1***

Levene sig 0.151 0.151

The results of caspase 3, caspase 8, iNOS, MT1, CYP1A, CYP3A, FSH, and LH gene expressions are expressed as Mean ± SE. (*P < 0.05, **P < 0.01, ***P < 0.001). Levene significance P > 0.05.

groups were analyzed with a nonparametric test (KruskaleWallis). Dual comparisons between groups exhibiting significant values were evaluated with a ManneWhitney U test (p < 0.05). 3. Results and discussion 3.1. Histopathological evaluations Brain tissue obtained from control groups showed normal features (Fig. 2A). Hyperemic vessels (Fig. 2C) and degenerated

neurons (Fig. 2B) were the first obvious findings in the low dose experimental group. Severe hemorrhage (Fig. 2G and H) and necrotic neurons (Fig. 2E, F, I) were detected in the high dose experimental group. Necrotic cell stages, including pyknosis karyorrhexis and karyolysis, were observed in neurons (Fig. 2E, F, I). Neuropil loss, reduction of Nissl bodies, inflammatory cell infiltration (Fig. 2G), and intramyelinic oedema (Fig. 2F) were observed in the brain tissue of the experimental group. Normal architectures of the gill, liver, and kidney tissues were noted in the control group (Fig. 3A, D, G). Epithelial hypertrophy and hyperplasia of lamellar cells were detected after low dose exposure (Fig. 3B). Additionally, lamellar disorganisation, inflammatory cell infiltration, and telangiectasis with severe hemorrhage (Fig. 3C) were observed after high dose exposure. Hydropic and vacuolar degeneration in hepatocytes and hyperemic vessels were observed in liver tissue of experimental group (Fig. 3E). Focal necrosis in hepatocytes and diffuse inflammatory cell accumulation were detected in both the high and low dose exposure groups (Fig. 3E and F). Degeneration in the tubular epithelium cells and dilatation of Bowman's space and atrophic glomerulus with inflammation were detected in the kidney tissues of the low dose group (Fig. 3H). Severe hemorrhage and dilation in tubules were observed in the high dose group (Fig. 3I). Obtained findings were similar to our previous pesticides toxication study (Arslan et al., 2017a, 2017b). The gills could be the first affected tissues because they are first way the toxic element entered the fish, and the liver is the primary organ responsible for detoxification and kidneys are responsible for removing toxic elements from blood. The severity of the observed lessions in evaluated organs of toxic groups increased proportionally with dose. There was statistically significant difference between low and high dose groups (p < 0.05). No lesions were detected in either male and female reproductive organs (Fig. 4A, D). Various germ cells of spermatogenesis, such as sertoli, spermatogonia, spermatocytes, spermatids, and spermatozoa, were detected in the control group of male animals (Fig. 4A). Follicles and oocytes of oogenesis were observed in the control group of female animals (Fig. 4D). Severe necrotic changes were detected in all germ cells of spermatogenesis of both exposure groups (Fig. 4B and C). Atretic follicles and degenerative changes in oocytes were also observed in the experimental groups (Fig. 4E and F). We observed crucial histopathological lesions in vital organs. Although histopthological studies on the reproductive organs of common carp were not received, similar findings were reported on

436

S. Altun et al. / Environmental Pollution 230 (2017) 432e443

Fig. 2. Histopathological lessions of brain tissue. A) Normal histology of the brain tissue, cerebellum, neurons (arrows). Control group. H&E. 20 mm. B) Degenerated neurons (arrows) in cerebellum. Low dose group. H&E. 20 mm. C) Necrotic neurons (arrows) and hyperemic vessels (arrow head) in cerebellum. High dose group. H&E. 20 mm. D) Normal histology of the brain tissue, optic lobe, neurons (arrows). Control group. H&E. 20 mm. E) Degenerated and necrotic neurons (arrows) in optic lobe. Low dose group. H&E. 20 mm. F) Necrotic neurons (arrows) in optic lobe. High dose group. H&E. 20 mm. G) Hemorrhage (arrow head) and inflammatory cell (arrow) infiltration in brain. High dose group. H&E. 20 mm. H) Severe hemorrhage (arrow) in brain tissue. High dose group. H&E. 20 mm. I) Neuropil loss and reduction of Nissl bodies and necrotic neurons (arrows) in brain tissue. High dose group. H&E. 20 mm.

zebrafish reproductive organs exposed to CPF (Manjunatha and Philip, 2016). The observed degenerative and necrotic findings in other organs were reported as direct responses triggered by the pesticides, and these previous studies on the acute toxic effects of chlorpyrifos on common carp confirmed our results (Chamarthi et al., 2014; Khatun et al., 2016; Xing et al., 2012a, 2012b). Additionally, we observed severe hemorrhage with active hyperemia in evaluated tissues of common carp in our chronic toxication study. Hyperemia defined as increased blood flow in a part of tissue or organ, and occurs in two forms. First way, active hyperemia is releated with active inflammation. Second way, passive hyperemia (congestion) is due to obstruction of venous return. In congestion, blood accumulates in dilated capillaries and venules. Confirmed iNOS activation by IF (Fig. 5H and I and Fig. 6H and I) and qRT-PCR (Fig. 7C) show that our hemorrhagic findings could be related with first way. Moreover, we detected the hemorrhagic areas with degenerated and hyperemic arterioles (Figs. S1A, B, C) in our observations. Also hemmorhage findings in tissues was increased proportionally with amount of toxic dose exposure (p < 0.05). According to our findings, chronic toxication of CPF could induce chronic expression of vasoactive mediators and lead to vascular endothelial damage in tissues. Thus, it is thought that the hemorrhagic effect of CPF is related to prolonged exposure. Severe damage to the brain, gills, liver, and kidney threaten the life of an aquatic animal by changing their normal physiological activities and possibly leading to the animal's death. However, recent findings about harmful effects on their reproductive organs

showed that CPF, which is the most common and widely-used pesticide in the world, not only affects their health but also € hler and Triebskorn, 2013). directly threatens their population (Ko Damaged tissues could not perform their normal tasks. Therefore, evaluating swimming behaviors and analyzing the urine and blood of aquatic animals found in natural environments may provide useful indications of the effect of current pollution. 3.2. Immunoflourescence assay results No significant positivity was observed in the control group except for some weak immunopositive reactions (Fig. 5A, D, G and Fig. 6A, D, G) The high dose group showed stronger and more diffuse signals of immunofluorescence reaction than the low dose group, for all markers (p < 0.05). Immunofluorescence positivity of 8-OHdG and cleaved caspase3 were detected in the cytoplasm and nucleus of neurons in the brain (Fig. 5C) and hepatocytes (Fig. 6C) in the liver. The number and density of positive cells increased proportionally with toxic exposure (p < 0.05). Immunofluorescence positivity of iNOS was observed in the cytoplasm and in extracellular areas of the brain and liver (Figs. 5H, I and 6H, I). The density of positive neurons and hepatocytes increased in direct proportion to the dose (low and high). There was statistically significant differences between low and high dose toxic groups (p < 0.05). Immunohistochemical applications have been effectively used by the researchers to reveal toxic effects of chemicals in

S. Altun et al. / Environmental Pollution 230 (2017) 432e443

437

Fig. 3. Histopathological lessions of gills, liver and kidney tissues. A) Normal features of gills. Lamellaes of gill tissue (arrow). Control group. H&E. 20 mm. B) Epithelial hypertrophy, hyperplasia of lamellar cells. Gill tissue. Low dose group. H&E. 20 mm. C) Lamellar disorganisation, inflammatory cell infiltration (arrow head), hemorrhage (arrow). Gill tissue. High dose group. H&E. 20 mm. D) The structure of normal liver. Vena centralis of liver (arrow head). Control group. H&E. 20 mm. E) Hydropic and vacuolar degenerated hepatocytes (arrow head), hypreamic vena centralis and portal triad vessels (arrows) in liver. Low dose group. H&E. 20 mm. F) Necrotic hepatocytes (arrow head) and diffuse inflammatory cell accumulation (arrow) in liver. High dose group. H&E. 20 mm. G) Normal histology of kidney. Glomerulus (arrow) and tubulus (arrow head) structure. Control group. H&E. 20 mm. H) Degenerated tubular epithelium cells (arrow head) and atrophic glomerulus in kidney tissue. Low dose group. H&E. 20 mm. I) Severe hemorrhage (arrows), cystic tubule (star) and expansion of Bowman's space (arrow head) in kidney tissue. High dose group. H&E. 20 mm.

Fig. 4. Histopathological lessions of reproductive tissues. A) Normal histology of testis tissue. Sertoli cells (thin arrow), spermatogonia and spermatocytes (arrow), spermatozoa (arrow head). Control group. H&E. 20 mm. B) Necrosis in sertoli (thin arrow) and spermatogonia cells (arrow). Low dose group. H&E. 20 mm. C) Severe necrotic cells of spermatogenic process (arrows). High dose group. H&E. 20 mm. D) Normal structures of follicles (arrow) and oocyt (arrow head) of ovarium tissue. Control group. H&E. 20 mm. E) Atretic follicles (arrows), ovarium tissue. Low dose group. H&E. 20 mm. F) Atretic follicles (arrow) and necrotic changes in oocyt wall (arrow head). H&E. 50 mm.

438

S. Altun et al. / Environmental Pollution 230 (2017) 432e443

Fig. 5. Immunofluorescence staining results of brain tissue. A) Neurons (arrows) of brain tissue. Control group. 8-OHdG. IF. 20 mm. B) Positivity in neurons (arrows). Low dose group. 8-OHdG. IF. 20 mm. C) Positivity in neurons (arrows). High dose group. 8-OHdG. IF. 20 mm. D) Neurons (arrows) of brain tissue. Control group. Cleavled caspase-3. IF. 20 mm. E) Positivity in neurons of brain tissue. Low dose group. Cleavled caspase-3. IF. 20 mm. F) Positivity in neurons of brain tissue. High dose group. Cleavled caspase-3. IF. 20 mm. G) Neurons (arrows) of brain tissue. Control group. iNOS. IF. 20 mm. H) Positivity in neurons (arrows). Low dose group. iNOS. IF. 20 mm. I) Positivity in neurons (arrows). High dose group. iNOS. IF. 20 mm.

experimental studies (Macirella et al., 2016). Because of this, the specificity and sensitivity of immunofluorescence assay is an accepted fact. Although different methods, such as biochemical analysis, were used to determine oxidative stress and cell damage markers in common carp (Xing et al., 2012a, 2012b, 2015), we did not identify any immunofluorescence application. This agrees with previous a immunohistochemical study (Xing et al., 2012a). The activation of 8-OHdG, cleaved caspase-3, and iNOS may result in DNA damage, oxidative stress, apoptosis, and inflammation in CPFexposed brain and liver tissue.

3.3. qRT-PCR results 3.3.1. Evaluations of caspase-3 and caspase-8 mRNA transcript levels The mechanism of chlorpyrifos-induced apoptosis in the brain tissue of the common carp was clearly not known. In order to investigate this, we evaluated the expression of caspase-3 and caspase-8 genes in CPF-exposed brain tissue of common carp. We found that caspase-3 expression was significantly upregulated in brain tissue after 21 days of CPF exposure (Fig. 7A) at both low (0.1 mg/L) and high doseages (0.2 mg/L). We also found that caspase-8 expression was upregulated (Fig. 7B) at both low and high dosages. Meanwhile, upregulation of the caspase-3 gene in the brain confirmed IF results (Fig. 5E and F). CPF inhibits acetylcholinesterase, thereby causing neurological and immunological abnormalities in animals and humans (Moser,

2000; Blakley et al., 1999; Thrasher et al., 2002). CPF-induced apoptosis was observed in several human cells including NK cells, human T cells, human monocyte cell line U937, and neuroblastoma cell line SH-SY5Y (Nakadai et al., 2006; Li et al., 2007, 2009; Raszewski et al., 2015). Furthermore, CPF could have harmful effects on aquatic animals, particularly fish. Several previous reports have observed that CPF leads to serious histopathological lesions, oxidative stress, and inflammation in aquatic organisms (Ali et al., 2009a,b; Xing et al., 2012a, 2012b). It is known that pesticides such as cypermethrin, deltamethrin and lambda-cyhalothrin trigger apoptosis in fish (Piner and Uner, 2012; Jin et al., 2011; Olsvik et al., 2014). A previous study indicated that CPF caused apoptosis in the liver of zebrafish (Zhang et al., 2017). Other studies have observed that CPF exposure induced apoptosis in the freshwater teleost Channa punctatus (Mishra and Devi, 2014) and zebrafish (Yu et al., 2015). Similar to these studies on human, mammal, and fish species, our findings suggested that chronic CPF exposure triggers intrinsic and extrinsic apoptotic pathways by increasing the expression of caspase-3 and caspase-8 genes in the brains of common carp.

3.3.2. Evaluation of iNOS, MT1, CYP1A, and CYP3A mRNA transcript levels To investigate the expression level of iNOS gene in the brains of carp after CPF exposure, we performed qRT-PCR. In the present study, we observed that iNOS gene expression significantly upregulated in the brain tissue of common carp after low and high levels

S. Altun et al. / Environmental Pollution 230 (2017) 432e443

439

Fig. 6. Immunofluorescence staining results of liver tissue. A) Liver tissue, vena centralis (arrow). Control group. 8-OHdG. IF. 20 mm. B) Positive reactions in hepatocytes (arrows). Low dose group. 8-OHdG. IF. 20 mm. C) Positive reactions in hepatocytes (arrows). High dose group. 8-OHdG. IF. 20 mm. D) Liver tissue, vena centralis (arrow). Control group. Cleavled caspase-3. IF. 20 mm. E) Positive hepatocytes (arrows). Low dose group. Cleavled caspase-3. IF. 20 mm. F) Positive hepatocytes (arrows). High dose group. Cleavled caspase-3. IF. 20 mm. G) Liver tissue, vena centralis (arrow). Control group. iNOS. IF. 20 mm. H) Positivity in hepatocytes (arrows). Low dose group. iNOS. IF. 20 mm. I) Positivity in hepatocytes (arrows). High dose group. iNOS. IF. 20 mm.

of CPF exposure (Fig. 7C). Moreover, we found iNOS positivity resulting in immunoflourescence assay. Thus, upregulation of the iNOS gene in the brain confirmed IF results (Fig. 5H and I). Pesticides and heavy metals can induce the production of NO, which plays a central role in physiological and pathophysiological mechanisms in nervous and immunological systems (Duzguner and Erdogan, 2012; Shao et al., 2012; Mou et al., 2012; Szabo, 1996). NO also regulates neurotransmitter release, neurotransmitter re-uptake, and regulation gene expression in the brain (Shao et al., 2012). Moreover, NO could be produced too much in result oxidative stress in tissues. iNOS can produce NO (Wang et al., 2013). Oxidative stress can be induced by certain pesticides, and free radicals such as reactive oxygen species (ROS) are produced in consequence of oxidative stress (Almeida et al., 1997; Rahman, 2007). Also, iNOS can be activated by oxidative stress, so it may be used as an oxidative stress biomarker (Xing et al., 2012b). Previous studies indicated that CPF induced NO synthesis and iNOS gene expression in swine granulosa cells, the liver tissue of Wister rats, and rat ileal muscle strips (Basini et al., 2012; Elelaimy et al., 2012; Darwiche et al., 2017). Wang et al. (2013) reported that CPF exposure induced the production of NO and upregulation of the iNOS gene in the brain tissue of the common carp. In another study, Chen et al. (2015) demonstrated that CPF caused oxidative stress and induced NO production in the immune system organs of common carp. In accordance with the previous studies, our findings indicated that chronic CPF exposure induces oxidative stress and infammation in carp brain tissue.

To our knowledge, no study has addressed CPF exposure changes to MT1 gene expression in the brain tissue of common carp. For this reason, we investigated the expression of MT1 in the brains of common carp after CPF exposure. In the present study, we indicated that MT1 gene expression in carp brain tissue was upregulated by low and high levels of CPF exposure (Fig. 7D). MTs may eleminate the adverse effects of heavy metals and pesticides, and they also protect organisms from several stress conditions, such as oxidative stress (Kagi and Schaffer, 1988; Ali et al., 2009a,b; Ferencz and Hermesz, 2015). MTs accumulation in CPF-exposed animal tissues may be related to oxidative stress level, as CPF is an organophosphate (OP) which causes the production of ROS. In addition, Rahman et al. (2017) reported that MTs induction is related to ROS and is therefore related to oxidative stress. A previous study showed that exposure to Ni and CPF mixtures increased the mRNA level of MT1 in the Dicentrarchus labrax (Banni et al., 2011). Lee and Nam (2016) observed that immune challenge, hypoxia, thermal elevation, and xenobiotic exposure upregulated MTs gene expressions in Pacific abalone (Haliotis discus hannai). Another study indicated that acute cypermethrin exposure induced upregulation of MTs gene expression in common carp (Arslan et al., 2017b). Our results indicated that MT1 gene expression may increase depending on oxidative stress status as a result of CPF exposure. Xing et al. (2014) suggested that the alteration of CYP3A expression may be used as a biomarker in the evaluation of CPF toxicity in common carp. Thus, in order to explore the mechanism

440

S. Altun et al. / Environmental Pollution 230 (2017) 432e443

Fig. 7. Effect of CPF exposure for 21 days on mRNA levels of caspase-3, caspase-8, iNOS and MT1 genes in the brain of Common Carp. Values represent the mean ± SD of 3 indipendent samples; error bars indicate standard deviation. Statistical significance (*P < 0.05, **p < 0.01 and ***p < 0.001) was analyzed using a factorial ANOVA. A) Represent the relative mRNA expression levels of caspase-3 gene. B) Represent the relative mRNA expression levels of caspase-8 gene. C) Represent the relative mRNA expression levels of iNOS gene. D) Represent the relative mRNA expression levels of MT1 gene.

of Cytochrome P450s in CPF-exposed brain tissue of common carp, we identified the expression levels of CYP1A and CYP3A genes and found that both gene expressions were upregulated in brain tissue after low and high levels of CPF exposure (Fig. 8A and B). Cytochrome P450s play a pivotal role in responses to different pesticides. CPF exposure increased the expression of CYP1A and CYP3A genes, which are related to CPF toxication in fish (DzulCaamal et al., 2012; Xing et al., 2014; Jeon et al., 2016). Additionally, cytochrome P450s are associated with oxidative stress (Jeon et al., 2016). The expression of CYP1A was upregulated in CPFexposed liver tissue of common carp (Xing et al., 2014). Wheelock et al. (2005) reported that esfenvalerate and CPF exposure induced an increase in CYP1A levels in Chinook salmon (Oncorhynchus tshawytscha). In another study, CYP1A and CYP3A gene expression increased in zebrafish embryos after CPF treatment (Jeon et al., 2016). Our findings indicated that CYP1A and CYP3A could be used as biomarkers for CPF toxication and oxidative stress in common carp. 3.3.3. Evaluation of FSH and LH mRNA transcript levels Reports on the effects of CPF toxication on the gene expressions of FSH and LH in fish are extremely limited. In the present study, we evaluated FSH and LH gene expressions in common carp ovaries after CPF treatment and found that both the FSH and the LH expressions were downregulated in the ovaries of common carp after

low and high levels of CPF exposure (Fig. 8C and D). Gonadotropin-releasing hormone (GnRH), which is released from the hypothalamus, plays a role in reproductive system regulation in vertebrates such as fish. GnRH induces synthesis of gonadotropin hormones (GTHs), luteinizing hormone (LH), and follicle-stimulating hormone (FSH) (Zohar et al., 2010). FSH regulates the vitellogenesis in females and spermatogenesis in males, while LH is related to oocyte maturation, ovulation, and spermiation in fish (Parhar et al., 2003; Yaron et al., 2009; Levavi-Sivan et al., 2010). Several environmental pollutants, including CPF, fenthion, fenitrithion, and dimethoate, reduce the gene expression of FSH and LH (Kitamura et al., 2003; Gore, 2001). Furthermore, pesticides caused the reduction of ovarian weight, atresia of primary, secondary and antral follicles, and structural alteration of the ovarian stroma in female rats (Park et al., 2014; El-Sharkawy et al., 2014; Satar et al., 2015). CPF is known as a endocrine disruptor pesticides, which could alter the normal function of the endocrine system in human and animals (Mnif et al., 2011). Previous studies observed that CPF toxication affects GnRH gene expression and downregulates FSH and LH gene expressions in humans and animals (Gore, 2001; Padungtod et al., 2000). Our findings observed that FSH and LH downregulation could be linked to reducing the activity of acetylcholinesterase and the supression of GnRH in the brain due to CPF exposure. Furthermore, we observed histopathological lesions in the ovaries (Fig. 4E and F). Thus, the reduction of

S. Altun et al. / Environmental Pollution 230 (2017) 432e443

441

Fig. 8. Effect of CPF exposure for 21 days on mRNA levels of CYP1A, CYP3A, FSH and LH genes in the brain and ovarium of Common Carp, respectively. Values represent the mean ± SD of 3 indipendent samples; error bars indicate standard deviation. Statistical significance (*P < 0.05, **P < 0.01 and ***p < 0.001) was analyzed using a factorial ANOVA. A) Represent the relative mRNA expression levels of CYP1A gene. B) Represent the relative mRNA expression levels of CYP3A gene. C) Represent the relative mRNA expression levels of FSH gene. D) Represent the relative mRNA expression levels of LH gene.

FSH and LH expressions may also be linked to the distruption of ovary functions because of CPF toxicity.

4. Conclusion In conclusion, chlorpyrifos exposure for 21 days causes severe histopathological changes in the gills, liver, brain, kidney, ovaries, and testis of common carp. Chlorpyrifos exposure activates 8OHdG, iNOS, and cleaved caspase-3 in liver and brain tissue. In addition, chlorpyrifos leads to significant upregulation of caspase3, caspase-8, iNOS, and MT1 gene expressions in the brain and downregulation of FSH and LH gene expressions in the ovaries. These findings showed that chlorpyrifos promotes inflammation, DNA damage, oxidative stress, and apoptosis in the liver and brain, and also causes reproductive dysfunction. While pathological lesions in the gills, liver, kidney, and ovaries due to chlorpyrifos toxication could potentially heal before fibrous tissue proliferation because of high regeneration ability, damage to the brain and testis may be irreversible. Thus, we can suggest that chlorpyrifos exposure is highly dangerous to the health of common carp. Furthermore, chlorpyrifos pollution in the water could threaten common carp population levels. Based on our knowledge, use of chlorpyrifos should be restricted, and aquatic systems should be monitored for chlorpyrifos pollution.

Acknowledgements We thanks to Eastern Anatolia Advanced Technology Application and Research Center (DAYTAM) of Atatürk University for supporting. This study didn't receive any specific grand from funding agencies in the public, commercial or not for profit sectors. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.envpol.2017.06.085. References Ali, D., Nagpure, N.S., Kumar, S., Kumar, R., Kushwaha, B., Lakra, W.S., 2009a. Assessment of genotoxic and mutagenic effects of chlorpyrifos in freshwater fish Channa punctatus (Bloch) using micronucleus assay and alkaline single-cell gel electrophoresis. Food Chem. Toxicol. 47, 650e656.  Dee r, A.K., Nemcso  k, J., Hermesz, E., 2009b. Expression of two Ali, K.S., Ferencz, A., metallothionein genes in different brain regions of common carp. Acta Biol. Hung 60, 149e158. Almeida, M., Fanini, F., Davino, S., Aznar, A., Koch, O., de M Barros, S., 1997. Pro-and antioxidant parameters in rat liver after short term exposure to hexachlorobenzene. Hum. Exp. Toxicol. 16, 257e261. Ahmad, H., Yousafzai, A.M., Siraj, M., Ahmad, R., Ahmad, I., Nadeem, M.S., Ahmad, W., Akbar, N., Muhammad, K., 2015. Pollution problem in river Kabul: accumulation estimates of heavy metals in native fish species. Biomed. Res. Int. 2015, 537368. € Arslan, H., Altun, S., Ozdemir, S., 2017a. Acute toxication of deltamethrin results in

442

S. Altun et al. / Environmental Pollution 230 (2017) 432e443

activation of iNOS, 8-OHdG and up-regulation of caspase 3, iNOS gene expression in common carp (Cyprinus carpio L.). Aquat. Toxicol. 187, 90e99. € Arslan, H., Ozdemir, S., Altun, S., 2017b. Cypermethrin toxication leads to histopathological lesions and induces inflammation and apoptosis in common carp (Cyprinus carpio L.). Chemosphere 180, 491e499. Banni, M., Jebali, J., Guerbej, H., Dondero, F., Boussetta, H., Viarengo, A., 2011. Mixture toxicity assessment of nickel and chlorpyrifos in the sea bass Dicentrarchus labrax. Arch. Environ. Contam. Toxicol. 60, 124e131. Basini, G., Bianchi, F., Bussolati, S., Baioni, L., Ramoni, R., Grolli, S., et al., 2012. Atrazine disrupts steroidogenesis, VEGF and NO production in swine granulosa cells. Ecotoxicol. Environ. Saf. 85, 59e63. Beijer, K., Gao, K., Jonsson, M.E., 2013. Effluent from drug manufacturing affects cytochrome P450 1 regulation and function in fish. Chemosphere 90, 1149e1157. Blakley, B.R., Yole, M.J., Brousseau, P., Boermans, H., Fournier, M., 1999. Effect of chlorpyrifos on immune function in rats. Vet. Hum. Toxicol. 41, 140e144. Chamarthi, R.R., Bangeppagari, M., Gooty, J.M., Mandala, S., Tirado, J.O., Marigoudar, S.R., 2014. Histopathological alterations in the gill, liver and brain of Cyprinus carpio on exposure to quinalphos. Am. J. Life Sci. 2 (4), 211e216. Chen, D., Zhang, Z., Yao, H., Liang, Y., Xing, H., Xu, S., 2015. Effects of atrazine and chlorpyrifos on oxidative stress-induced autophagy in the immune organs of common carp (Cyprinus carpio L.). Fish. Shellfish Immunol. 44, 12e20. Darwiche, W., Delanaud, S., Dupont, S., Ghamlouch, H., Ramadan, W., Joumaa, W., heillard, J., 2017. Impact of prenatal and postnatal exposure to Bach, V., Gay-Que the pesticide chlorpyrifos on the contracton of rat ileal muscle strips: involvement of an inducible nitric oxide synthase-dependent pathway. Neurogastroenterol. Motl 29, e12918. de Campos Ventura, B., de Angelis, D.d.F., Marin-Morales, M.A., 2008. Mutagenic and genotoxic effects of the Atrazine herbicide in Oreochromis niloticus (Perciformes, Cichlidae) detected by the micronuclei test and the comet assay. Pestic. Biochem. Physiol. 90, 42e51. Dong, X., Zhu, L., Wang, J., Xie, H., Hou, X., Jia, W., 2009. Effects of atrazine on cytochrome P450 enzymes of zebrafish (Danio rerio). Chemosphere 77, 404e412. Duzguner, V., Erdogan, S., 2012. Chronic exposure to imidacloprid induces inflammation and oxidative stress in the liver & central nervous system of rats. Pest. Biochem. Physiol. 104, 58e64. pez, M.L., García-Latorre, E., Vega-Lo pez, A., 2012. Dzul-Caamal, R., Domínguez-Lo Implications of cytochrome P450 isoenzymes, aryl-esterase and oxonase activity in the inhibition of acetylcholinesterase of Chirostoma jordani treated with phosphorothionate pesticides. Ecotoxicol. Environ. Saf. 84, 199e206. El-Sharkawy, E.E., Kames, A.O., Sayed, S.M., Nisr, N.A., Wahba, N.M., Elsherif, W.M., 2014. The ameliorative effect of propolis against methoxychlor induced ovarian toxicity in rat. Exp. Toxicol. Pathol. 66, 415e421. Elelaimy, A.I., Ibrahim, H.M., Ghaffar, F.R.A., Alawthan, Y.S., 2012. Evaluation of subchronic chlorpyrifos poisoning on immunological and biochemical changes in rats and protective effect of eugenol. J. Appl. Pharm. Sci. 2, 51e61.  Hermesz, E., 2015. Impact of acute Cd2þ exposure on the antioxidant Ferencz, A., defence systems in the skin and red blood cells of common carp (Cyprinus carpio). Environ. Sci. Pollut. Res. Int. 22, 6912e6919. Gao, D., Xu, Z., Qiao, P., Liu, S., Zhang, L., He, P., Zhang, X., Wang, Y., Min, W., 2013. Cadmium induces liver cell apoptosis through caspase-3A activation in purse red common carp (Cyprinus carpio). Plos One 8, e83423. Gomez-Canela, C., Prats, E., Pina, B., Tauler, R., 2017. Assessment of chlorpyrifos toxic effects in zebrafish (Danio rerio) metabolism. Environ. Pollut. 220, 1231e1243. Gonzalez, S.F., Buchmann, K., Nielsen, M.E., 2007. Real-time gene expression analysis in carp (Cyprinus carpio L.) skin: inflammatory responses caused by the ectoparasite Ichthyophthirius multifiliis. Fish. Shellfish Immunol. 22, 641e650. Gore, A.C., 2001. Environmental toxicant effects on neuroendocrine function. Endocrine 14 (2), 235e246. Gurtu, V., Kain, S.R., Zhang, G., 1997. Fluorometric and colorimetric detection of caspase activity associated with apoptosis. Anal. Biochem. 251, 98e102. Huang, D.J., Zhang, Y.M., Song, G., Long, J., Liu, J.H., Ji, W.H., 2007. Contaminantsinduced oxidative damage on the carp Cyprinus carpio collected from the Upper Yellow River, China. Environ. Monit. Assess. 128, 483e488. Humphrey, C.A., Klumpp, D.W., Raethke, N., 2004. Ambon damsel (Pomacentrus amboinensis) as a bioindicator organism for the Great Barrier Reef: responses to chlorpyrifos. Bull. Environ. Contam. Toxicol. 72, 888e895. Jeon, H.J., Lee, Y.H., Kim, M.J., Choi, S.D., Park, B.J., Lee, S.E., 2016. Integrated biomarkers induced by chlorpyrifos in two different life stages of zebrafish (Danio rerio) for environmental risk assessment. Environ. Toxicol. Pharmacol. 43, 166e174. Jin, Y., Liu, Z., Peng, T., Fu, Z., 2015. The toxicity of chlorpyrifos on the early life stage of zebrafish: asurvey on the endpoints at development, locomotor behavior, oxidative stress and immunotoxicity. Fish. Shellfish Immunol. 43, 405e414. Jin, Y., Pan, X., Cao, L., Ma, B., Fu, Z., 2013. Embryonic exposure to cis-bifenthrin enantioselectively induces the transcription of genes related to oxidative stress, apoptosis and immunotoxicity in zebrafish (Danio rerio). Fish. Shellfish Immunol. 34, 717e723. Jin, Y., Zheng, S., Fu, Z., 2011. Embryonic exposure to cypermethrin induces apoptosis and immunotoxicity in zebrafish (Danio rerio). Fish. Shellfish Immunol. 30 (4e5), 1049e1054. Kagi, J.H.R., Schaffer, A., 1988. Biochemistry of metallothionein. Biochemistry 27, 8509e8515. Kawanishi, S., Ohnishi, S., Ma, N., Hiraku, Y., Oikawa, S., Murata, M., 2017. Nitrative and oxidative DNA damage in infection-related carcinogenesis in relation to

cancer stem cells. Genes Environ. 38, 26. Kitamura, S., Suzuki, T., Ohta, S., Fujimoto, N., 2003. Antiandrogenic activity and metabolism of the organophosphorus pesticide fenthion and related compounds. Environ. Health Perspect. 111 (4), 503e508. Khatun, N., Rahman, T., Mahanta, R., 2016. Histopathological studies of chlorpyrifos toxicity in catfish. Glob. J. Med. Res. Microbiol. Pathology 16 (3). €hler, H.R., Triebskorn, R., 2013. Wildlife ecotoxicology of pesticides: can we Track Ko effects to the population level and beyond? Science 341 (6147), 759e765. Kumar, A., Sinha, R.A., Tiwari, M., Singh, R., Koji, T., Manhas, N., Rastogi, L., Pal, L., Shrivastava, A., Sahu, R.P., Godbole, M.M., 2007. Hyperthyroidism induces apoptosis in rat liver through activation of death receptor-mediated pathways. J. Hepatol. 46 (5), 888e898. La Du, B.N., Aviram, M., Billecke, S., Navab, M., Primo-Parmo, S., Sorenson, R.C., Standiford, T.J., 1999. On the physiological role(s) of the paraoxonases. Chem. Biol. Interact. 120, 379e388. Lee, C.H., Kamijima, M., Kim, H., Shibata, E., Ueyama, J., Suzuki, T., Takagi, K., Saito, I., Gotoh, M., Hibi, H., Naito, H., Nakajima, T., 2007. 8-Hydroxydeoxyguanosine levels in human leukocyte and urine according to exposure to organophosphorus pesticides and paraoxonase 1 genotype. Int. Arch. Occup. Environ. Health 80, 217e227. Lee, S.Y., Nam, Y.K., 2016. Transcriptional responses of metallothionein gene to different stress factors in Pacific abalone (Haliotis discus hannai). Fish. Shellfish Immunol. 58, 530e541. Levavi-Sivan, B., Bogerd, J., Mananos, E.L., Gomez, A., Lareyre, J.J., 2010. Perspectives on fish gonadotropins and their receptors. Gen. Comp. Endocrinol. 165, 412e437. Li, Q., Kobayashi, M., Kawada, T., 2007. Organophosphorus pesticides induced apoptosis in human NK cells. Toxicology 239, 89e95. Li, Q., Kobayashi, M., Kawada, T., 2009. Chlorpyrifos induces apoptosis in human T cells. Toxicology 255, 53e57. Li, Z.H., Li, P., Rodina, M., Randak, T., 2010. Effect of human pharmaceutical Carbamazepine on the quality parameters and oxidative stress in common carp (Cyprinus carpio L.) spermatozoa. Chemosphere 80, 530e534. cio, A.F., Novo, L.A., de Alburquerque, C., Moreira, J.C., 2008. Linde-Arias, A.R., Ina MultiBiomarker approach in fish to assess the impact of pollution in a large Brazilian river, Paraiba do Sul. Environ. Pollut. 156, 974e979. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2 (-Delta Delta C(T)) method. Methods 25, 402e408. Ma, J., Liu, Y., Niu, D., Li, X., 2013. Effects of chlorpyrifos on the transcription of CYP3A cDNA, activity of acetylcholinesterase, and oxidative stress response of goldfish (Carassius auratus). Environ. Toxicol. 30, 422e429. Manjunatha, B., Philip, G.H., 2016. Reproductive toxicity of chlorpyrifos tested in zebrafish (Danio rerio) Histological and hormonal end points. Toxicol. Ind. Health 10, 1808e1816. Martinez, M.M., Reif, R.D., Pappas, D., 2010. Detection of apoptosis: a review of conventional and novel techniques. Anal. Methods 2, 996e1004. Mishra, A., Devi, Y., 2014. Histopathological alterations in the brain (optic tectum) of the fresh water teleost Channa punctatus in response to acute and subchronic exposure to the pesticide Chlorpyrifos. Acta Histochem 116 (1), 176e181. Mnif, W., Hassine, A.I.H., Bouaziz, A., Bartegi, A., Thomas, O., Roig, B., 2011. Effect of endocrine disruptor pesticides: a review. Int. J. Environ. Res. Public Health 8 (6), 2265e2303. Moncada, S., Higgs, E.A., 1995. Molecular mechanisms and therapeutic strategies related to nitric oxide. FASEB J. 9, 1319e1330. Monteiro, S.M., dos Santos, N.M., Calejo, M., Fontainhas-Fernandes, A., Sousa, M., 2009. Copper toxicity in gills of the teleost fish, Oreochromis niloticus: effects in apoptosis induction and cell proliferation. Aquat. Toxicol. 94, 219e228. Moser, V.C., 2000. Dose-response and time-course of neurobehavioral changes following oral chlorpyrifos in rats of different ages. Neurotoxicol. Teratol. 22, 713e723. Mou, Y.H., Yang, J.Y., Cui, N., Wang, J.M., Hou, Y., Song, S., Wu, C.F., 2012. Effects of cobalt chloride on nitric oxide and cytokines/chemokines production in microglia. Int. Immunopharmacol. 13, 120e125. Nakadai, A., Li, Q., Kawada, T., 2006. Chlorpyrifos induces apoptosis in human monocyte cell line U937. Toxicology 224, 202e209. Nemeth-Konda, L., Füleky, G., Morovjan, G., Csokan, P., 2002. Sorption behaviour of acetochlor, atrazine, carbendazim, diazinon, imidacloprid and isoproturon on Hungarian agricultural soil. Chemosphere 48, 545e552. Nishi, K., Hundal, S.S., 2013. Chlorpyrifos induced toxicity in reproductive organs of female Wistar rats. Food Chem. Toxicol. 62, 732e738. Oerke, E.C., Dehne, H.W., 2004. Safeguarding production losses in major crops and the role of crop protection. Crop Prot. 23, 275e285. Oliva, M., Gravato, C., Guilhermino, L., et al., 2014. EROD activity and cytochrome P4501A induction in liver and gills of Senegal Solea solea senegalensis from a polluted Huelva Estuary(SW Spain). Comp. Biochem. Physiol. Toxicol. Pharmacol. 166, 134e144. Olsvik, P.A., Ørnsrud, R., Lunestad, B.T., Steine, N., Fredriksen, B.N., 2014. Transcriptional responses in Atlantic salmon (Salmo salar) exposed to deltamethrin, alone or in combination with azamethiphos. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 162, 23e33. n, J.M., Gonza lez-Polo, R.A., Niso-Santano, M., Soler, G., Ortiz-Ortiz, M.A., Mora Bravo-San Pedro, J.M., Fuentes, J.M., 2009. Nitric oxide-mediated toxicity in paraquat-exposed SH-SY5Y cells: a protective role of 7-nitroindazole neurotox. Res 16, 160e173.

S. Altun et al. / Environmental Pollution 230 (2017) 432e443 Padungtod, C., Savitz, D.A., Overstreet, J.W., Christiani, D.C., Ryan, L.M., Xu, X., 2000. Occupational pesticide exposure and semen quality among Chinese workers. J. Occup. Environ. Med. 42 (10), 982e992. Parhar, I.S., Soga, T., Ogawa, S., Sakuma, Y., 2003. FSH and LH-b subunits in the preoptic nucleus: ontogenic expression in teleost. Gen. Comp. Endocrinol. 132, 369e378. Park, S., Kim, S., Jin, H., Lee, K., Bae, J., 2014. Impaired development of female mouse offspring maternally exposed to simazine. Environ. Toxicol. Pharmacol. 38, 845e851. Pi, J., Horiguchi, S., Sun, Y., Nikaido, M., Shimojo, N., Hayashi, T., Yamauchi, H., Itoh, K., Yamamoto, M., Sun, G., Waalkes, M.P., Kumagai, Y., 2003. A potential mechanism for the impairment of nitric oxide formation caused by prolonged oral exposure to arsenate in rabbits Free. Radic. Biol. Med. 35, 102e113. Piner, P., Uner, N., 2012. Oxidative and apoptotic effects of lambda-cyhalothrin modulated by piperonyl butoxide in the liver of Oreochromis niloticus. Environ. Toxicol. Pharmacol. 33 (3), 414e420. Rahman, K., 2007. Studies on free radicals, antioxidants, and co-factors. Clin. Interv. Aging 2, 219. Rahman, M.T., Haque, N., Abu Kasim, N.H., De Ley, M., 2017. Origin, function, and fate of metallothionein in human blood. Rev. Physiol. Biochem. Pharmacol. http://dx.doi.org/10.1007/112_2017_1. Raszewski, G., Lemieszek, M.K., Łukawski, K., Juszczak, M., Rzeski, W., 2015. Chlorpyrifos and cypermethrin induce apoptosis in human neuroblastoma cell line SH-SY5Y. Basic & Clin. Pharmacol. Toxicol. 116, 158e167. Saeij, J.P.J., Stet, R.J.M., Groeneveld, A., Verburg-van Kemenade, L.B.M., van Muiswinkel, W.B., Wiegertjes, G.F., 2000. Molecular and functional characterization of a fish inducible-type nitric oxide synthase. Immunogenetics 51, 339e346. Satar, D.A., Tap, O., Ay, M.O., 2015. Electron microscopic examination of the effects of methyl parathion exposure on the ovaries. Eur. Rev. Med. Pharmacol. Sci. 19, 2725e2731. Shao, X.-P., Liu, W.B., Lu, K.-L., Xu, W.N., Zhang, W.-W., Wang, Y., Zhu, J., 2012. Effects of tribasic copper chloride on growth, copper status, antioxidant activities, immune responses and intestinal microflora of blunt snout bream (Megalobrama amblycephala) fed practical diets. Aquaculture 338e341, 154e159. €ffker, M., Tyler, C.R., 2012. Endocrine disrupting chemicals and sexual behaviors So in fish e a critical review on effects and possible consequences. Crit. Rev. Toxicol. 420, 653e668. Sumon, K.A., Rico, A., Ter Horst, M.M.S., Van den Brink, P.J., Haque, M.M., Rashid, H., 2016. Risk assessment of pesticides used in rice-prawn concurrent systems in Bangladesh. Sci. Total Environ. 568, 498e506. Szabo, C., 1996. Physiological and pathophysiological roles of nitric oxide in the central nervous system. Brain Res. Bull. 41, 131e141. Tanvir, E.M., Afroz, R., Chowdhury, M., Gan, S.H., Karim, N., Islam, M.N., Khalil, M.I., 2016. A model of chlorpyrifos distribution and its biochemical effects on the liver and kidneys of rats. Hum. Exp. Toxicol. 35, 991e1004.

443

Thrasher, J.D., Heuser, G., Broughton, A., 2002. Immunological abnormalities in humans chronically exposed to chlorpyrifos. Arch. Environ. Health 57, 181e187. U.S. Environmental Protection Agency (USEPA), 2002. Interim Reregistration Eligibility Decision for Chlorpyrifos. Wang, L.L., Liu, T., Wang, C., Zhao, F.Q., Zhang, Z.W., Yao, H.D., Xing, H.J., Xu, S.W., 2013. Effects of atrazine and chlorpyrifos on the production of nitric oxide and expression of inducible nitric oxide synthase in the brain of common carp (Cyprinus carpio L.). Ecotoxicol. Environ. Saf. 93, 7e12. Wheelock, C.E., Eder, K.J., Werner, I., Huang, H., Jones, P.D., Brammell, B.F., Elskus, A.A., Hammock, B.D., 2005. Individual variability in esterase activity and CYP1A levels in Chinook salmon (Oncorhynchus tshawytscha) exposed to esfenvalerate and chlorpyrifos. Aquat. Toxicol. 74 (2), 172e192. Wong, R.S.Y., 2011. Apoptosis in cancer: from pathogenesis to treatment. J. Exp. Clin. Cancer Res. 30, 87. Xing, H., Li, S., Wang, Z., Gao, X., Xu, S., Wang, X., 2012a. Oxidative stress response and histopathological changes due to atrazine and chlorpyrifos exposure in common carp. Pestic. Biochem. Physiol. 103, 74e80. Xing, H., Li, S., Wang, Z., Gao, X., Xu, S., Wang, X., 2012b. Histopathological changes and antioxidant response in brain and kidney of common carp exposed to atrazine and chlorpyrifos. Chemosphere 88, 377e383. Xing, H., Wang, Z., Gao, X., Chen, D., Wang, L., Li, S., Xu, S., 2015. Atrazine and chlorpyrifos exposure induces liver autophagic response in common carp. Ecotoxicol. Environ. Saf. 113, 52e58. Xing, H., Zhang, Z., Yao, H., Liu, T., Wang, L., Xu, S., Li, S., 2014. Effects of atrazine and chlorpyrifos on cytochrome P450 in common carp liver. Chemosphere 104, 244e250. Yaron, Z., Bogomolnaya, A., Drori, S., Biton, I., Aizen, J., Kulikovsky, Z., et al., 2009. Spawning induction in the Carp: past experience and future prospects a review. Isr. J. Aquacult-Bamid 61, 5e26. Yu, K., Li, G., Feng, W., Liu, L., Zhang, J., Wu, W., Xu, L., Yan, Y., 2015. Chlorpyrifos is estrogenic and alters embryonic hatching, cell proliferation and apoptosis in zebrafish. Chem. Biol. Interact. 239, 26e33.    Zelje zi c, D., Mladini c, M., Zunec, S., Luci c Vrdoljak, A., Kasuba, V., Tariba, B.,   Zivkovi c, T., Marjanovi c, A.M., Pavi ci c, I., Mili c, M., Rozgaj, R., Kopjar, N., 2016. Cytotoxic, genotoxic and biochemical markers of insecticide toxicity evaluated in human peripheral blood lymphocytes and an HepG2 cell line. Food Chem. Toxicol. 96, 90e106. Zhang, J., Liu, L., Ren, L., Feng, W., Lv, P., Wu, W., Yan, Y., 2017. The single and joint toxicity effects of chlorpyrifos and beta-cypermethrin in zebrafish (Danio rerio) early life stages. J. Hazard Mater 334, 121e131. Zhu, F., Moural, T.W., Nelson, D.R., Palli, S.R., 2016. A specialist herbivore pest adaptation to xenobiotics through up-regulation of multiple Cytochrome P450s. Sci. Rep. 6, 20421. http://dx.doi.org/10.1038/srep20421. ~ oz-Cueto, J.A., Elizur, A., Kah, O., 2010. Neuroendocrinology of Zohar, Y., Mun reproduction in teleost fish. Gen. Comp. Endocrinol. 165 (3), 438e455.